ID: 1080319001

View in Genome Browser
Species Human (GRCh38)
Location 11:30984682-30984704
Sequence GCAGCTGTTTAGTTGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080318997_1080319001 14 Left 1080318997 11:30984645-30984667 CCCAAGGATTTGCAAACTCTACC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1080318999_1080319001 -7 Left 1080318999 11:30984666-30984688 CCCGTGACTTTAAGAAGCAGCTG 0: 1
1: 0
2: 3
3: 14
4: 216
Right 1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1080318998_1080319001 13 Left 1080318998 11:30984646-30984668 CCAAGGATTTGCAAACTCTACCC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1080318996_1080319001 15 Left 1080318996 11:30984644-30984666 CCCCAAGGATTTGCAAACTCTAC 0: 1
1: 0
2: 1
3: 5
4: 160
Right 1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 125
1080319000_1080319001 -8 Left 1080319000 11:30984667-30984689 CCGTGACTTTAAGAAGCAGCTGT 0: 1
1: 0
2: 1
3: 29
4: 241
Right 1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080319001 Original CRISPR GCAGCTGTTTAGTTGAAAGC AGG Intronic
900571559 1:3361187-3361209 GCAGCTGCTTGGTTTAAAGGGGG - Intronic
900760778 1:4468734-4468756 GCAGCTGTTTACTTGAAGTCAGG - Intergenic
902800630 1:18827411-18827433 GCAGGTGTGTAGTTGAGAACTGG - Intergenic
905296308 1:36956511-36956533 GCAGCTGTTTTCTTGGGAGCTGG - Intronic
906503840 1:46362466-46362488 GCAGCAGTATTGTTGACAGCAGG - Intronic
907895353 1:58684067-58684089 GCTTCTGTTTGGTTGAAAGATGG + Intronic
911036084 1:93549881-93549903 CCACCTGTTTAGATGAAAGTGGG + Intronic
911849222 1:102794778-102794800 GCAACTGTTTAGCTGATATCTGG + Intergenic
915059760 1:153171682-153171704 GCAGCTGTGAAGTTGAGAGGTGG - Intergenic
918272062 1:182911427-182911449 GCAATTTTTTTGTTGAAAGCTGG - Intronic
918725998 1:187925082-187925104 GCAGCTGGTTGGTTGGAAGTGGG - Intergenic
922055448 1:222038217-222038239 GCAGCTGGTTAGTTAAGGGCAGG - Intergenic
922309536 1:224375209-224375231 GCAACTCTTGAGATGAAAGCAGG - Intronic
1063961293 10:11307420-11307442 GGAGATGTTTAGATGAAAGTGGG + Intronic
1065358813 10:24869795-24869817 CCAGCTGGTTAGTTGAGAGGTGG - Intronic
1068869296 10:61926533-61926555 GCAGCTGTGTCCTTGAGAGCTGG + Intronic
1069028673 10:63571990-63572012 GCATCTGATTAATTCAAAGCTGG + Intronic
1073732120 10:106301335-106301357 TCATTTGCTTAGTTGAAAGCTGG + Intergenic
1078062263 11:8055813-8055835 GCACCTGTGGAGTTGGAAGCAGG + Intronic
1079758978 11:24304028-24304050 GCATTTGTTTAGTTGTAAGTAGG + Intergenic
1080319001 11:30984682-30984704 GCAGCTGTTTAGTTGAAAGCAGG + Intronic
1085361567 11:75892715-75892737 TCAGGTGTTCATTTGAAAGCTGG - Intronic
1089895648 11:121927924-121927946 GAGACTGTTTAGTTGAATGCTGG - Intergenic
1090147552 11:124341552-124341574 GCAGCTGTCTACCTGGAAGCAGG - Intergenic
1091820264 12:3470738-3470760 GCTGGTGTGGAGTTGAAAGCAGG - Intronic
1092640753 12:10506362-10506384 GCAGCTCTTCTGTTGATAGCTGG + Exonic
1093873601 12:24322090-24322112 ACTGCTGTTTAGTTGACAGATGG - Intergenic
1098135193 12:67394716-67394738 GCAGCTGAGAAGTTGAGAGCTGG + Intergenic
1098206342 12:68114194-68114216 GAAGCTGTTTAGTTGAGAAAAGG + Intergenic
1099560666 12:84170631-84170653 GCAGCTGATTATTTCAAACCAGG + Intergenic
1101522397 12:105496023-105496045 GCATCTGTGAAGTTGGAAGCTGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102371868 12:112388499-112388521 GAAGATGTTGAGTTTAAAGCTGG + Intergenic
1103732357 12:123036364-123036386 CCAGTTGTTTAGTTCACAGCAGG + Intronic
1105052684 12:133068746-133068768 TTAGCTGATTAGCTGAAAGCTGG + Intergenic
1106651659 13:31696936-31696958 GTAGCTTTGTAGTTAAAAGCTGG - Intergenic
1108005308 13:45940273-45940295 GAAGCTGTTTTTTTTAAAGCTGG + Intergenic
1112063808 13:95769581-95769603 TCAGCTAATTAGTTGGAAGCAGG + Intronic
1115409534 14:33058005-33058027 GCTTCTGTTTATTAGAAAGCTGG + Intronic
1116400100 14:44496167-44496189 GCACCTGATTAGTGTAAAGCAGG - Intergenic
1118529921 14:66692353-66692375 GCACCTGTTTAGTTCCTAGCAGG - Intronic
1119077299 14:71654370-71654392 GCAGTTTGTTATTTGAAAGCTGG + Intronic
1120853789 14:89195523-89195545 GTAGCTGTTTGGTGGACAGCGGG + Intronic
1125605028 15:40935282-40935304 GGAGCTGGTTAGTTGCACGCAGG + Intronic
1130886719 15:88099191-88099213 GCAGCTTATTAGTAGAAAGATGG + Intronic
1130957250 15:88636441-88636463 CCATCTGTTTAGTTCAAAACTGG - Intronic
1136527487 16:30841565-30841587 TCAGCTGTTTGGTTCACAGCAGG - Intronic
1140026936 16:71299196-71299218 GGAGCTGTCGAGTTGAAAGCCGG - Intergenic
1141948605 16:87326348-87326370 GCAGCTGTTTTGGGGACAGCTGG - Intronic
1144235026 17:13252022-13252044 GCAGCTGGTTGGTTGACACCTGG + Intergenic
1146139752 17:30355390-30355412 GCAGCAGTGTAGTTGGAAGGAGG + Intergenic
1147466655 17:40616050-40616072 GCAGCTGGCTAGTGGGAAGCAGG + Intergenic
1148792223 17:50179849-50179871 GCAGGTGTTCTGTAGAAAGCAGG - Intergenic
1150113438 17:62522671-62522693 GCAGTTGTTTAGTTGAATATTGG + Intronic
1151026697 17:70685548-70685570 GGAGCTGTGTGGTTTAAAGCAGG + Intergenic
1153874754 18:9359186-9359208 GCTGCTGGTTGGTTGGAAGCTGG + Intronic
1154396751 18:13997809-13997831 GCAGCTGAACAGTTGAAAACAGG + Intergenic
1156176265 18:34550452-34550474 ACAGCTGTTAAGTTAAAATCTGG - Intronic
1159135334 18:64330701-64330723 GCAGTTGTTTAGATAAAAGGTGG - Intergenic
1163315679 19:16538988-16539010 GCAGTTGTTTAGGTGAGAGATGG - Intronic
1164023341 19:21328609-21328631 GTTGCTGTTAAGTAGAAAGCCGG - Intronic
1164845092 19:31425387-31425409 GCAGAAGTTTAGCTAAAAGCAGG - Intergenic
925689997 2:6511996-6512018 ACAGATGTTTAGTTCACAGCAGG - Intergenic
927366408 2:22302146-22302168 ACAGCAGTTTATTTGAAAGTGGG + Intergenic
928682841 2:33720450-33720472 GTAGATGGTTAGTTGAAAACGGG + Intergenic
929012631 2:37460424-37460446 GCATGTGTTTAGTTTAAAGTGGG - Intergenic
929214385 2:39395804-39395826 CCATCTGTTTAGTTAAAAGGAGG + Intronic
935406589 2:102716722-102716744 GCATGTGTTAAGTTGAAAACAGG + Exonic
935540431 2:104341493-104341515 GCAGCTAAATTGTTGAAAGCTGG + Intergenic
936152791 2:110030834-110030856 TCAGCTGTTAAGTGGAAAGGAGG + Intergenic
936191889 2:110340578-110340600 TCAGCTGTTAAGTGGAAAGGAGG - Intergenic
938958326 2:136318938-136318960 TCATCTGTTAAGTTGAAACCAGG + Intergenic
939854067 2:147335911-147335933 GAATCTGTTTAGTTGAAATTTGG + Intergenic
942308975 2:174636215-174636237 GCAGCTGCTTAGTTGAAAAATGG - Intronic
946681238 2:222218948-222218970 GCAGCTGAAAAGTTCAAAGCCGG - Intronic
947336157 2:229086360-229086382 GCAGCAGTTTATTATAAAGCAGG - Intronic
1170761865 20:19258131-19258153 TCAGCTGTTTACATGAAAACAGG - Intronic
1171475167 20:25403023-25403045 TCAGCTGTTTGGTTCACAGCAGG + Intergenic
1172226815 20:33310823-33310845 GCAGCTGTTTGGCTGGGAGCTGG - Intergenic
1172785655 20:37466638-37466660 TCAGATGTGTAGTTGAGAGCGGG - Intergenic
1177081984 21:16651143-16651165 GCAGCAGTTTAGTTGGAAGGAGG - Intergenic
1178030861 21:28523988-28524010 GCAGATCTTTAGATGGAAGCGGG - Intergenic
1178057477 21:28815452-28815474 GCAGCTGTTTAGTAGGATGTGGG - Intergenic
1181757120 22:25031937-25031959 GCACGTGTTTAGTTCAAAGCTGG - Intronic
1182818375 22:33189518-33189540 GCTGCTTTCTAGTTGAAAGAAGG + Intronic
1182949220 22:34356004-34356026 GCAGATGTTTGGTTTACAGCAGG - Intergenic
1185160941 22:49229472-49229494 GTAGGTGTTGAGTTGAGAGCAGG - Intergenic
1185177187 22:49334562-49334584 CCAGCTGTTTAGTTTTAAGCTGG + Intergenic
953036034 3:39211725-39211747 GGAGCTGTTTACTTGCCAGCTGG - Intergenic
953228207 3:41040330-41040352 GCAGCTGTTTTATTGACAGAGGG - Intergenic
954160530 3:48718370-48718392 GCAGATGTCTAGTTGACAGTGGG - Intronic
956422072 3:69095851-69095873 GCAGCTGTCTACATGAAAGATGG + Intronic
962309500 3:134315069-134315091 TCAGCTGATTAGCTGAAAGGTGG + Intergenic
962776916 3:138669844-138669866 CCAGCTGTTTAGGTTAAAGTGGG - Intronic
963358722 3:144243146-144243168 TCAGCCTTTTAGCTGAAAGCAGG - Intergenic
965952536 3:174328000-174328022 GCTGCTATTTAATTGACAGCGGG - Intergenic
973564816 4:52173869-52173891 GCAGCTGCTTAGTGGCAAACTGG + Intergenic
973711271 4:53632406-53632428 GCAGCTATTTAGCAGAAGGCAGG - Intronic
976967664 4:91064639-91064661 GCAGCTGTTTACTATAAATCAGG + Intronic
978349533 4:107807120-107807142 CCAGCTGCTTAGTTGAAGCCTGG + Intergenic
979533140 4:121790437-121790459 TCAGCTGTTTTGCTGAATGCAGG - Intergenic
980401037 4:132286246-132286268 GCAGCAATTTACCTGAAAGCAGG + Intergenic
981199388 4:141962295-141962317 GCAGATATTTAGTAGTAAGCAGG - Intergenic
983918124 4:173314307-173314329 ATAGCTGTTTAGTGGAAAGGTGG - Intronic
988965814 5:36416631-36416653 GCAGCTGATTAGATTAAGGCTGG + Intergenic
989351473 5:40492329-40492351 GGAGTTGTCTAGTTAAAAGCAGG + Intergenic
995313852 5:110744225-110744247 ACACATGTATAGTTGAAAGCAGG + Intronic
999683179 5:154078738-154078760 GCAGCAGTTAAGATGATAGCAGG + Intronic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1004073865 6:12327576-12327598 ACAGCTATTTATTTGAAAGAGGG - Intergenic
1005698020 6:28369625-28369647 CCATCTGATTAGTTGAAGGCAGG - Intergenic
1008319239 6:50087074-50087096 GCAGCTGAATATTTGAAATCTGG - Intergenic
1013633481 6:112007554-112007576 GCAGCTGGTTAGGGAAAAGCTGG - Intergenic
1013948500 6:115751432-115751454 ACAGCTATTTAGTTGGAAGCTGG + Intergenic
1018972172 6:168537196-168537218 GCACTTGCTTAGCTGAAAGCCGG + Intronic
1022665074 7:32403078-32403100 GCAGCTGATGATTTAAAAGCTGG - Intergenic
1024141304 7:46465804-46465826 GCAACTGTTTGGAGGAAAGCTGG + Intergenic
1024726745 7:52206448-52206470 ACAGATGTGTAGTTGAAAGGGGG + Intergenic
1025041327 7:55648516-55648538 GCAGCTGTTTATTTGACTTCAGG + Intergenic
1026545388 7:71317603-71317625 GCAGGTGTTTATTCTAAAGCTGG + Intronic
1027881531 7:83844884-83844906 GCATCTGTGCAGATGAAAGCAGG + Intergenic
1032043139 7:128578428-128578450 GCAGTTGTTTAGTTGAATATTGG + Intergenic
1042960577 8:74299553-74299575 GCAGCTGTGTAGTTGAAGAAGGG - Intronic
1044038104 8:87332049-87332071 GAAGCTCTTTAGTTTAAGGCTGG + Intronic
1046487528 8:114907218-114907240 GCAGCTGTTTAAATAAGAGCAGG + Intergenic
1047302437 8:123625362-123625384 GCTATTGTTTGGTTGAAAGCAGG + Intergenic
1052043185 9:23764389-23764411 GCAGCTGTTCACTTGAATGTTGG - Intronic
1061977101 9:134074743-134074765 GTAGCTTTTTTGTTGAAAACTGG - Intergenic
1189734449 X:44055449-44055471 GCTGCTCTTGAGCTGAAAGCAGG - Intergenic
1190722246 X:53159305-53159327 TCAGCTGTTTGGTTCACAGCAGG + Intergenic
1193795550 X:85868649-85868671 GTAGTTGTCTAGTTGAAAGATGG - Intronic
1194280467 X:91946837-91946859 GCAGGTGTTCAAATGAAAGCAGG + Intronic
1200597942 Y:5170333-5170355 GCAGGTGTTCAAATGAAAGCAGG + Intronic