ID: 1080322202

View in Genome Browser
Species Human (GRCh38)
Location 11:31023404-31023426
Sequence ATTCCATCCTGGGCAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 939}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080322202 Original CRISPR ATTCCATCCTGGGCAATCAA AGG Intronic
900718239 1:4158683-4158705 ACTCCAGCCTGGGCTATAAAGGG + Intergenic
900810949 1:4800999-4801021 ATTCCAGCCTGACCAAGCAAAGG + Intergenic
901517657 1:9760099-9760121 ATTCCAGCCTGGGCAACAGAGGG - Intronic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
901885300 1:12218475-12218497 ATACCATCCTGGGCAACATAGGG + Intergenic
902103225 1:14011147-14011169 ATTCCATCCTGGGACACCAAGGG - Intergenic
902341318 1:15785295-15785317 ATTCCAGCCTGGGCAACAAGAGG + Intronic
902358265 1:15924491-15924513 ACTCCAGCCTGGGCAACGAAAGG - Intronic
903077023 1:20778820-20778842 ATTCCAGCCTGGGCAACAGAGGG - Intronic
903148986 1:21391865-21391887 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
903209025 1:21805370-21805392 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
903454218 1:23475918-23475940 ATTCCAGCCTGGGCAAAAGAAGG + Intronic
903662303 1:24985532-24985554 ATTCCATCCTGGCCAGTATAAGG - Intergenic
903699421 1:25235485-25235507 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
903906471 1:26691295-26691317 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
903956984 1:27032467-27032489 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
903964509 1:27078604-27078626 ACTCCAGCCTGGGCAATAAGGGG - Intergenic
903973103 1:27131886-27131908 ATTCTAGCCTGGGCAATAGAGGG + Intronic
903984741 1:27218401-27218423 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
903991554 1:27274255-27274277 ACTCCAGCCTGGGCAATGGAAGG + Intronic
904131571 1:28279576-28279598 ACTCCAGCCTGGGCAACAAAGGG - Intronic
904289109 1:29472174-29472196 AGGCCATCCTGGGTAATGAATGG - Intergenic
904526496 1:31137534-31137556 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
905052861 1:35067318-35067340 ATTCCAGCCTGGGCAACAGAAGG - Intronic
905063531 1:35159996-35160018 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
905073206 1:35246252-35246274 ACTCCAGCCTGGGCAACCAGAGG - Intergenic
905138291 1:35818589-35818611 ATTCCAGCCTGGGCAACAGAGGG + Intronic
905460707 1:38121156-38121178 CTTCCAACTTGGGCAATCAGAGG + Intergenic
905505618 1:38476708-38476730 ATTCCTCCCTCCGCAATCAAGGG + Intergenic
905567201 1:38975086-38975108 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
905661684 1:39732124-39732146 ACTCCAGCCTGGGCAATAGAGGG - Intronic
906070930 1:43015867-43015889 AGACCATCCTGGGCAATACAGGG + Intergenic
906160691 1:43646989-43647011 TCTCCAGCCTGGGCAATAAAAGG + Intergenic
906400983 1:45504511-45504533 ATCCCATCCTGGGCAACATAGGG + Intronic
906466932 1:46090362-46090384 ACTCCATCCTGAGCAATAGAGGG - Intronic
907095124 1:51771429-51771451 AGTCCATCCTGGGCAACATAAGG + Intronic
907404306 1:54244443-54244465 AGACCAGCCTGGGCAATGAAGGG - Intronic
908147967 1:61267474-61267496 ACTCCAGCCTGGGCAACAAAGGG + Intronic
908343500 1:63207286-63207308 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
908821800 1:68094605-68094627 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
908983497 1:69987210-69987232 ACTCCAGCCTGGGCAATAGAGGG + Intronic
909524306 1:76605830-76605852 ACTCCATCCTGGGTAATAGAGGG + Intronic
910586437 1:88885405-88885427 ACTCCAGCCTGGGCAACAAAAGG + Intronic
910824853 1:91395879-91395901 ACTCTATCCTGGGCAATAGAGGG - Intronic
910967533 1:92822796-92822818 AGACCATCCTGGGCAATATAGGG - Intergenic
911127447 1:94353636-94353658 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
911349596 1:96737010-96737032 ACTCCAGCCTGGGCAACAAAGGG - Intronic
911589174 1:99726737-99726759 ATTCCAGCCTGGGCAACTAAGGG - Intronic
911991840 1:104707907-104707929 AGACCATCCTGGGCAACAAAGGG - Intergenic
912356185 1:109055875-109055897 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
912399392 1:109376296-109376318 ATTCCAGCCTGGGCAACAGAGGG + Intronic
912572359 1:110633819-110633841 ATTCCCTCCTCAGCCATCAAAGG - Intergenic
912672323 1:111642210-111642232 ACTCCAGCCTGGGCAATAAGAGG + Intronic
913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG + Intronic
913675130 1:121133125-121133147 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
914026969 1:143920745-143920767 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
914693245 1:150050159-150050181 ACTCTAGCCTGGGCAATCCAGGG + Intergenic
914715314 1:150249494-150249516 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
914821725 1:151109706-151109728 ATTCTAGCCTGGGCAACAAAGGG - Intronic
915186773 1:154112655-154112677 AGTCCACCCTGGGCAATATAGGG + Intronic
915617890 1:157055244-157055266 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
917196338 1:172469727-172469749 AGACCAGCCTGGGCAATAAAGGG + Intergenic
917254395 1:173098856-173098878 AGACCATCCTGGGCAATGGAGGG - Intergenic
917357597 1:174143164-174143186 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
917636082 1:176938050-176938072 ATTTTATCTTAGGCAATCAAAGG + Intronic
917855795 1:179098329-179098351 ACTCCATCCTGGGCAACAGAGGG + Intergenic
918289511 1:183093109-183093131 ACTCCATCCTGGGCGATTTAGGG + Intronic
918552446 1:185758601-185758623 ATTCCAGCCTGGGCAACAGAGGG + Intronic
919395551 1:197042786-197042808 ACTCCAGCCTGGGCAACAAAAGG + Intronic
919680596 1:200431039-200431061 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
920462493 1:206151963-206151985 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
920687219 1:208118536-208118558 TGTCCTGCCTGGGCAATCAACGG + Intronic
920793672 1:209117276-209117298 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
921770111 1:219026704-219026726 ACTCCAGCCTGGACAATAAAGGG - Intergenic
921867624 1:220103071-220103093 ACTCCAGCCTGGGCAACAAAAGG - Intronic
921895190 1:220392508-220392530 AGTCCAGCCTGGGCAATAGAGGG - Intergenic
921987748 1:221330601-221330623 ACTCCAGCCTGGGCAACCAAGGG - Intergenic
922302372 1:224312957-224312979 ATTCTAGCCTGGGCAACTAAGGG + Intronic
922653193 1:227358502-227358524 ACTCCATCCTGGGCAAAAGAGGG + Intergenic
922815323 1:228445069-228445091 AGGCCATCCTGGGCAATATAGGG + Intergenic
923314107 1:232762700-232762722 ACTCCAGCCTGGGCAATACAGGG + Intergenic
923451341 1:234120504-234120526 TGGCCATACTGGGCAATCAAAGG - Intronic
924025681 1:239830669-239830691 ACTCCAGCCTGGGCAATAGAGGG + Intronic
924252090 1:242143058-242143080 ACTCCAGCCTGGGCAACCAAGGG - Intronic
924616936 1:245619571-245619593 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1063314065 10:4984520-4984542 ATCACATCCTGGCCAATCAGAGG - Intronic
1063461616 10:6218459-6218481 ATTCCAGCCTGGGCAACAGAAGG - Intronic
1063650017 10:7925764-7925786 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1063694453 10:8319939-8319961 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1063903223 10:10757107-10757129 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1063996120 10:11621438-11621460 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG + Intronic
1064345003 10:14524072-14524094 ACTCCATCCTGGGCAACAAGAGG - Intronic
1064451436 10:15445558-15445580 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1064838801 10:19566159-19566181 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1065152156 10:22833051-22833073 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1065202360 10:23325303-23325325 ATTCCACCCTGGGCAACAGAGGG + Intronic
1065577452 10:27136553-27136575 AGGCCAGCCTGGGCAATAAAAGG - Intronic
1065824271 10:29555628-29555650 ATTTCATCTAGGGGAATCAAGGG + Intronic
1066132477 10:32408111-32408133 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1066794256 10:39101529-39101551 TTTCCATCCTGCTGAATCAAAGG - Intergenic
1066928781 10:41730817-41730839 ATTCCAACCTGCTAAATCAAAGG - Intergenic
1067371470 10:45687548-45687570 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1067388313 10:45838602-45838624 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1067391942 10:45871634-45871656 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1067417756 10:46118356-46118378 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1067445953 10:46345971-46345993 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1067503168 10:46825243-46825265 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1067591429 10:47514773-47514795 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1067638547 10:48022868-48022890 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1067871355 10:49964514-49964536 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1067874942 10:49997463-49997485 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1068259580 10:54562021-54562043 ATTCCAGCCTGGGCAATAGAGGG - Intronic
1069333452 10:67320572-67320594 ATTTCATGCTGGGTACTCAAAGG + Intronic
1069452855 10:68531197-68531219 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
1069487392 10:68832629-68832651 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1069696343 10:70388331-70388353 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
1069846619 10:71376794-71376816 ATTCCAGTCTGGGCAACGAAGGG - Intergenic
1069881145 10:71594404-71594426 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1069957079 10:72058726-72058748 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1070072781 10:73105609-73105631 ACTCCATCCTGGGCGATAGAGGG - Intergenic
1070135145 10:73687285-73687307 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1071744702 10:88403834-88403856 AGACCATCCTGGGCAATATAGGG + Intronic
1072124803 10:92436222-92436244 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1072690367 10:97568854-97568876 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1072873412 10:99145421-99145443 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1074175887 10:111002011-111002033 AGTCCAGCCTGGGCAACAAAGGG + Intronic
1074560766 10:114533306-114533328 ACTCCAGCCTGGGCAATGGAGGG + Intronic
1074756615 10:116628339-116628361 ACTCCACCCTGGGTAATAAAGGG + Intronic
1075034610 10:119053951-119053973 ACTCCACCCTGGGCAACCATGGG - Intronic
1075036890 10:119076901-119076923 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1075050641 10:119180978-119181000 ACTCCATCCTGGGCAACAGAGGG - Intergenic
1075109396 10:119565760-119565782 AGTCCAGCCTGGGCAACAAAGGG + Intergenic
1075792075 10:125092212-125092234 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1076052075 10:127343210-127343232 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1076929035 10:133515545-133515567 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1077133170 11:985014-985036 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1077149201 11:1061323-1061345 AGACCAGCCTGGGCAATCTAGGG - Intergenic
1077237804 11:1490380-1490402 AGACCAGCCTGGGCAATAAAGGG + Intronic
1077502526 11:2915893-2915915 ATTCCTTCCAGGGGAATCACAGG + Intronic
1078162650 11:8855110-8855132 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1078694016 11:13611457-13611479 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1079057307 11:17217357-17217379 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1079395840 11:20062725-20062747 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1080276030 11:30504407-30504429 ATTCCTTCCTTGGCAATTACTGG + Intronic
1080322202 11:31023404-31023426 ATTCCATCCTGGGCAATCAAAGG + Intronic
1080438526 11:32268845-32268867 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1080511771 11:32981923-32981945 ACTCCAGCCTGGGCAATGGAGGG - Intronic
1080572120 11:33565976-33565998 ATTCCAGCCTGGGCAATAGAGGG + Intronic
1080652282 11:34232415-34232437 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1080826482 11:35853191-35853213 ACTCCATCCTGGGCAATAGAGGG - Intergenic
1082070214 11:47933548-47933570 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
1082149694 11:48721235-48721257 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1082149823 11:48723830-48723852 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1082316610 11:50733381-50733403 TTTCCAAACTGGTCAATCAAAGG - Intergenic
1082598640 11:55118808-55118830 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1082598775 11:55121578-55121600 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1082881982 11:58046828-58046850 ATTCCAGCCTGGGCAACAAGAGG + Intronic
1083056474 11:59825924-59825946 ACTCCAGCCTGTGCAATAAAAGG - Intergenic
1083338228 11:61940406-61940428 ATTCCAGCCTGGGCAACCAAGGG + Intergenic
1083598680 11:63932829-63932851 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1083608640 11:63994283-63994305 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1083830814 11:65232340-65232362 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1084835294 11:71797486-71797508 ACTCCAGCCTGGGCAATACAAGG - Intronic
1084976916 11:72805943-72805965 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1085074818 11:73581749-73581771 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1085095179 11:73754854-73754876 ACTCCATCCTGGGCAACAGAGGG + Intronic
1085118151 11:73948670-73948692 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1085210372 11:74771503-74771525 ATACCAGCCTGGGCAATATAAGG + Intronic
1085489829 11:76904883-76904905 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1086162087 11:83733206-83733228 ACTCCAGCCTGGGCAATGGAGGG + Intronic
1086898190 11:92337462-92337484 ACTCCAGCCTGGGCAATGAGAGG - Intergenic
1087244120 11:95814391-95814413 TCTCCAGCCTGGGCAATAAAAGG - Intronic
1088482234 11:110305371-110305393 ACTTCAGCCTGGGCAATAAAGGG + Intergenic
1089262816 11:117233759-117233781 ATGCAATACTGGGCAATCCAGGG - Intronic
1089521141 11:119064482-119064504 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
1089580385 11:119478012-119478034 ATTCCAACCTGGGCAACAGAAGG - Intergenic
1089794376 11:120968230-120968252 ATACCATCCTGGGCAAACTAGGG - Intronic
1090817302 11:130309861-130309883 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1091610099 12:1999691-1999713 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1092271459 12:7027180-7027202 ACTCCATCCTGGGCAACAAGAGG - Intronic
1092274579 12:7049500-7049522 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1092468400 12:8755808-8755830 AAACCAGCCTGGGCAATCGAGGG + Intronic
1093009937 12:14096068-14096090 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1093192387 12:16090444-16090466 AAACAATGCTGGGCAATCAAAGG - Intergenic
1093322933 12:17736719-17736741 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
1093779458 12:23118575-23118597 AAGCCATCTTAGGCAATCAATGG + Intergenic
1094021071 12:25915125-25915147 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1094232230 12:28119862-28119884 ATTCCAGCCTGGGCAATAGAGGG - Intergenic
1094584560 12:31765693-31765715 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1094820569 12:34220924-34220946 GTTCCAGCCTGGGCAATAGAAGG - Intergenic
1094875508 12:34638057-34638079 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1095063997 12:37742807-37742829 TTTCCAATCTGGTCAATCAAAGG - Intergenic
1095070905 12:37844604-37844626 ATTCCAAACTGATCAATCAAAGG + Intergenic
1095094184 12:38136656-38136678 GTTCCAGCCTGGGCAATAGAAGG + Intergenic
1096075547 12:48801705-48801727 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1096271941 12:50172354-50172376 ACTCCAGCCTGGGCAACAAATGG + Intergenic
1096619341 12:52852984-52853006 ATTCCAGCCTGGGCAACACAGGG + Intergenic
1096732885 12:53628617-53628639 ACTCCAACCTGGGCAACAAAGGG - Intergenic
1097044196 12:56175042-56175064 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1097100205 12:56582699-56582721 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1097114227 12:56685807-56685829 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1097282699 12:57854517-57854539 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1097294785 12:57950555-57950577 ACTCCAGCCTGGGCAAGAAAGGG - Intronic
1097484283 12:60174881-60174903 ATTACCTCCAGTGCAATCAATGG + Intergenic
1097630773 12:62059282-62059304 ATTCCATCCTGGGCGACAGAAGG + Intronic
1097721751 12:63029456-63029478 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1098267620 12:68738416-68738438 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1098337102 12:69415526-69415548 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1098681836 12:73366073-73366095 ACTCCATCCTGGGCAACAAAGGG + Intergenic
1100146129 12:91680026-91680048 AGTCCAGCCTGGGCAATAAAGGG - Intergenic
1100317476 12:93458184-93458206 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1100346443 12:93736022-93736044 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1100407115 12:94281244-94281266 ACTCCAGCCTGGGCAATGGAGGG + Intronic
1100573438 12:95864866-95864888 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1100638592 12:96459515-96459537 ACTCCATCCTGGGCAATAGAGGG - Intergenic
1100638668 12:96460151-96460173 ACTCCAACCTGGGCAATAGAGGG - Intergenic
1101516764 12:105443496-105443518 ATTACATCCTCAGAAATCAATGG + Intergenic
1101638272 12:106565779-106565801 ACTCCAGCCTGGGCAATGGAGGG + Intronic
1101946129 12:109138818-109138840 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1102073781 12:110043820-110043842 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1102316365 12:111891124-111891146 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1102464099 12:113118189-113118211 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1103086607 12:118066211-118066233 ACTCCAGCCTGGGCAATAGAGGG + Exonic
1103108836 12:118256049-118256071 ACTCCAGCCTGGGCAATGAGAGG + Intronic
1103449973 12:121021776-121021798 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1103538586 12:121650796-121650818 ATTCCAGCCTGGGCAATAGAGGG + Intergenic
1103546566 12:121706318-121706340 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1103709657 12:122902537-122902559 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1103802169 12:123545417-123545439 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1104657776 12:130586417-130586439 ACTCGAGCCTGGGCAATAAAAGG + Intronic
1105006101 12:132721559-132721581 ACTCCAGCCTGGGCAAGCGAGGG + Exonic
1105080966 13:16117046-16117068 ATTCCACCATAGGCAATAAAGGG - Intergenic
1105081627 13:16127323-16127345 ATTCCACCATAGGCAATAAAGGG - Intergenic
1105082080 13:16134178-16134200 ATTCCACCATAGGCAATAAAGGG - Intergenic
1105083219 13:16151308-16151330 ATTCCACCATAGGCAATAAAGGG - Intergenic
1105083443 13:16154734-16154756 ATTCCACCATAGGCAATAAAGGG - Intergenic
1105342276 13:19538559-19538581 ACTCCATCCTGGGCAACAGAGGG - Intergenic
1105379030 13:19869753-19869775 ATTCCAGCCTAGGCAACAAAGGG + Intergenic
1105490693 13:20884994-20885016 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1105500626 13:20968330-20968352 ATTCCAGCCTGGGCAACAAGAGG + Intergenic
1105573209 13:21623690-21623712 ATTCCATTTTGGGCAACCATTGG - Intergenic
1105906491 13:24815925-24815947 ATTCCAGCCTGGGCAACTGAGGG - Intronic
1106062206 13:26304667-26304689 ATTCCAGCCTGGGCAAAAGAGGG - Intronic
1106194996 13:27485377-27485399 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1106268514 13:28131863-28131885 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1109116071 13:58387697-58387719 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1110838329 13:80110592-80110614 ATTCCTTCCTGGAGAATCTATGG - Intergenic
1111935507 13:94553183-94553205 AGACCAGCCTGGGCAATAAATGG - Intergenic
1112156678 13:96824896-96824918 TATACATCCTGGGGAATCAAAGG + Intronic
1112264685 13:97912602-97912624 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1112497223 13:99914881-99914903 ACTCCATCCTGGGCAATAGAGGG - Intergenic
1112595937 13:100806900-100806922 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1114129883 14:19778892-19778914 AGTCCATACTGGGCAATTTATGG + Intronic
1114442063 14:22756880-22756902 ACTCCAGCCTGGGCAATACAGGG - Intergenic
1114443766 14:22772063-22772085 ACTCCAGCCTGGGCAATAGAGGG + Exonic
1115262083 14:31464433-31464455 ACTCCAACCTGGGCAACCGAGGG + Intergenic
1115566328 14:34628594-34628616 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1115616323 14:35098383-35098405 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1115653727 14:35422963-35422985 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1115673957 14:35648262-35648284 ATGCCAGCCTGGGCAATAGAGGG + Intronic
1115798926 14:36970276-36970298 ATACCATCCTGGACAACCACAGG - Intronic
1116000944 14:39242353-39242375 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1116019712 14:39445270-39445292 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
1116191272 14:41671647-41671669 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1116456581 14:45126846-45126868 ACTCCAGCCTGGGCAATAGAAGG - Intronic
1116465485 14:45227510-45227532 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1116716215 14:48430558-48430580 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1116830230 14:49712532-49712554 ACTTCATCCTGGGCAATAGAGGG - Intronic
1116887660 14:50236568-50236590 ACTCCAGCCTGGGCAAAAAAGGG + Intergenic
1117122740 14:52585800-52585822 ATTCCAACCTGGGCGATAGAGGG + Intronic
1117350545 14:54877524-54877546 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1117659960 14:57993102-57993124 AGTCCAGCCTGGGCAATGTAGGG - Intergenic
1117964526 14:61193065-61193087 AAGCCATCCTAGGCAATCATGGG + Intronic
1118026444 14:61773730-61773752 ATTCCAGCCTGGGCAATAAAAGG - Intronic
1118977813 14:70692682-70692704 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1119065575 14:71522724-71522746 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1120004371 14:79340496-79340518 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1120309089 14:82807639-82807661 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1120474184 14:84966854-84966876 AGGCCAGCCTGGGCAATGAAAGG + Intergenic
1120652464 14:87151005-87151027 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1121040807 14:90745261-90745283 ACTCCAGCCTGGGCAATAGATGG + Intronic
1121135261 14:91491907-91491929 AGACCAGCCTGGGCAATAAAGGG - Intronic
1121270684 14:92635818-92635840 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1121672005 14:95717456-95717478 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1122223848 14:100260992-100261014 AGACCAGCCTGGGCAATAAAGGG - Intronic
1122473015 14:101984898-101984920 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1123228165 15:17070047-17070069 TTTCCAAACTGGTCAATCAAAGG + Intergenic
1123386553 15:19815736-19815758 ATTCCAAACTGCTCAATCAAAGG + Intergenic
1123668576 15:22630001-22630023 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1124337280 15:28866808-28866830 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1124431877 15:29615186-29615208 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1124524554 15:30436473-30436495 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1124774099 15:32571237-32571259 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1124903759 15:33848866-33848888 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1125257114 15:37777787-37777809 ATTCCAGCCTGGGCAACAGAAGG + Intergenic
1125339295 15:38658994-38659016 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1125363076 15:38885137-38885159 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1125613499 15:40989262-40989284 ATTCCATCCTGGGAATTCATGGG - Intronic
1125980770 15:43999098-43999120 ACTCCAGCCTGGGCAATAGATGG - Intronic
1126215860 15:46154358-46154380 ATTCCAGCATGGGCAATAAAGGG - Intergenic
1126618975 15:50617468-50617490 ACTCCAGCCTGGGCAAGAAAGGG + Intronic
1126647509 15:50889824-50889846 ACTCCAGCCTGGGCAATGAAAGG + Intergenic
1126739595 15:51764282-51764304 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1126788127 15:52195829-52195851 ACCCCAGCCTGGGCAATAAAGGG - Intronic
1127054746 15:55120113-55120135 ACTCCATCCTGGGCAACAGAAGG + Intergenic
1127080562 15:55374661-55374683 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1127086651 15:55429782-55429804 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1127459592 15:59185675-59185697 AGACCAGCCTGGGCAACCAAGGG + Intronic
1128515582 15:68339837-68339859 ATTCCATCCTTGGCACAAAATGG + Intronic
1128964361 15:72043034-72043056 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1128977515 15:72164436-72164458 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1129764644 15:78154705-78154727 ACTCCATCCTGGGCAACCTAGGG + Intronic
1130449859 15:84040559-84040581 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1130711048 15:86281348-86281370 ATTCCATCGTGGGCAACCAAGGG + Intronic
1130771398 15:86927388-86927410 ACACCAGCCTGGGCAATAAAGGG + Intronic
1131025235 15:89135957-89135979 ACTCCAGCCTGGGCAACAAAAGG - Intronic
1131310153 15:91283466-91283488 ATTCCAGCCTGGGCAAAAGAGGG - Intronic
1131436632 15:92427948-92427970 ACTCCAGCCTGGGCAATGAAGGG + Intronic
1131763651 15:95651734-95651756 ATCACATCCTAGTCAATCAAGGG - Intergenic
1132296559 15:100738921-100738943 ATTGAATCCTGGGTACTCAAGGG + Intergenic
1132491276 16:232832-232854 ACTCCAGCCTGGGCGATAAAGGG + Intergenic
1132493917 16:250987-251009 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1132593854 16:739264-739286 ACTCCAGCCTGGGCCATCGAGGG + Intronic
1132794343 16:1711908-1711930 ACTCCAGCCTGGGCAATTGAGGG + Intronic
1132819541 16:1856794-1856816 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1132918660 16:2370104-2370126 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1133369382 16:5236373-5236395 TTTCCATCCTGGACAAGTAAAGG - Intergenic
1133628076 16:7590824-7590846 ATTCCAGCCTGGGCAAGAAGAGG + Intronic
1133680723 16:8117631-8117653 ATCCCAACCTGGGGAACCAAAGG + Intergenic
1133744939 16:8679149-8679171 ACTCCAACCTGGGCAACAAAGGG + Intronic
1133770553 16:8865139-8865161 ACTCCATCCTGGGCAACAGAGGG - Intronic
1133784899 16:8965823-8965845 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1133831807 16:9330242-9330264 ATTTCCTCATGGGCAATCAAGGG + Intergenic
1133940664 16:10306543-10306565 AGACCAGCCTGGGCAATCTAGGG + Intergenic
1134129820 16:11641657-11641679 ACTCCATCCTGGGCGACAAAGGG - Intergenic
1134203346 16:12217059-12217081 ACTCCAGCCTGGGCAATGAAGGG - Intronic
1134282679 16:12831730-12831752 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1134591244 16:15455289-15455311 ACTCCAGCCTGGGCAACAAATGG + Intronic
1134742634 16:16561400-16561422 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1134924926 16:18151056-18151078 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1135029356 16:19025584-19025606 ATTCCAGCCTGGGCAATGAGAGG + Intronic
1135282982 16:21169338-21169360 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1135391290 16:22095588-22095610 ACTCAATCCTGGGCAATAGAGGG - Intronic
1135651645 16:24211589-24211611 ACTCCAGCCTGGGCAACAAAAGG - Intronic
1135672821 16:24389750-24389772 ATTCCATCCTGGGCAACAGAGGG - Intergenic
1135767563 16:25191075-25191097 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1136331796 16:29584291-29584313 ACTCCATCCTGGGCAACAAGAGG - Intergenic
1136358901 16:29765047-29765069 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1136407910 16:30059593-30059615 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1136452916 16:30364406-30364428 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1136493652 16:30627586-30627608 ATTCCAGCCTGGGCAACTAAGGG + Intergenic
1136626290 16:31464255-31464277 ATTCCAGCCTGGGCTATAGAGGG + Intronic
1137073424 16:35930727-35930749 TTTCCAACCTGGTGAATCAAAGG + Intergenic
1137077031 16:35980579-35980601 TTTCCATACTGCTCAATCAAAGG + Intergenic
1137245421 16:46699440-46699462 ACTCCAGCCTGGGCAATACAGGG + Intergenic
1137309811 16:47243996-47244018 ACTCCAGCCTGGGCGATAAAGGG + Intronic
1137409959 16:48219946-48219968 ATTCCAGCCTGGGCAACAATAGG + Intronic
1137653696 16:50142054-50142076 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1137654340 16:50147378-50147400 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1137698919 16:50481874-50481896 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1138047977 16:53745901-53745923 TTACCAGCCTGGGCAATCTAAGG + Intronic
1138274161 16:55719200-55719222 ATGCCATCCTGTGAAACCAAGGG + Intergenic
1138638675 16:58364842-58364864 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1138648882 16:58445834-58445856 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1138718451 16:59051220-59051242 ATTCTAGCCTGGGCAATAGAGGG - Intergenic
1138798337 16:59996265-59996287 AGTCCATCTTGGGGAATCCAGGG + Intergenic
1139235670 16:65335990-65336012 CTTCCAGCCTGGGCAACAAAGGG + Intergenic
1139336145 16:66232729-66232751 ACTCCAGCCTGGGCAAACAGAGG - Intergenic
1139436064 16:66937142-66937164 ATTCCAGCCTGGGCAACAGATGG + Intronic
1139699244 16:68697289-68697311 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1140152927 16:72390455-72390477 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1140310938 16:73847768-73847790 ACTCCACCCTGGGCAATAGAGGG - Intergenic
1140909964 16:79442402-79442424 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1141116355 16:81313299-81313321 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1141560089 16:84862233-84862255 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1141719658 16:85749316-85749338 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1142026097 16:87814601-87814623 ATTCCATCCTGGGCAACAAGAGG - Intergenic
1143437715 17:6941666-6941688 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1143552233 17:7637469-7637491 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1143663153 17:8339719-8339741 ATCCCAGCCTGGGCAATAGAGGG + Intergenic
1143752882 17:9043607-9043629 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1144423072 17:15115569-15115591 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
1144559221 17:16307929-16307951 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1144559342 17:16308824-16308846 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1145003132 17:19319678-19319700 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1145179576 17:20734899-20734921 ACTCCAGCCTGGGCAATATAGGG + Intergenic
1145183556 17:20774238-20774260 ACTCCATCCTGGGCAACAGAGGG + Intergenic
1145837649 17:27966789-27966811 ATTCCAGCCTGGGCAACATAGGG - Intergenic
1146044609 17:29493459-29493481 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1146217484 17:30989324-30989346 ATTGCATCCTGGGCAACAGAGGG + Intronic
1146614027 17:34337249-34337271 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1146898163 17:36561154-36561176 ACTCCAGCCTGGGAAATAAAGGG - Intronic
1147209311 17:38862613-38862635 ATTCCAGCCTGGGCAACAAGTGG - Intergenic
1147222053 17:38940875-38940897 AGACCATCCTGGGCAATATAGGG - Intronic
1147296474 17:39486973-39486995 ACTCCAACCTGGGCAATAGAGGG + Intronic
1147296626 17:39488781-39488803 ACTCCACCCTGGGCAACAAAGGG - Intronic
1147379739 17:40046855-40046877 ATACCAGCCTGGGCAACAAAGGG + Intronic
1147724500 17:42558196-42558218 ATTCCAGCCTGGGCAAGAGAGGG + Intergenic
1147756656 17:42772982-42773004 ATTCCAGCCTGGGCAACAAAGGG + Intergenic
1148133779 17:45278709-45278731 ACTCCAGCCTGGCCAACCAAGGG - Intronic
1148162306 17:45457525-45457547 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1148162333 17:45457690-45457712 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1148608777 17:48949950-48949972 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1148613998 17:48985077-48985099 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1148727267 17:49802631-49802653 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1148762909 17:50017345-50017367 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1149464109 17:56860920-56860942 ATTTCATCATGGGCATTGAAGGG + Intronic
1149717472 17:58806730-58806752 ACTCCAACCTGGGCAATAGAGGG - Intronic
1149723830 17:58871782-58871804 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1149839285 17:59944550-59944572 ACTCCAGCCTGGGCAATATAGGG + Intronic
1150393543 17:64804174-64804196 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
1150508367 17:65722279-65722301 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1150726383 17:67654663-67654685 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1151164753 17:72193989-72194011 ATTCCAACCTGGGCAACAAGAGG - Intergenic
1151257720 17:72892046-72892068 ATTTCATCCTGTGCAATCCTTGG - Intronic
1151446159 17:74165508-74165530 AGTCCAGCCTGGGCAACAAAAGG + Intergenic
1151644014 17:75417178-75417200 ACTCCATCCTGGGCAACAGAAGG + Intergenic
1151792875 17:76320455-76320477 ACTCCAACCTGGGCAACAAAGGG - Intronic
1151837499 17:76592887-76592909 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1152187517 17:78867220-78867242 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1152207541 17:78982371-78982393 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152648024 17:81479139-81479161 ATTCCACCCTGGGGAATAGAGGG - Intergenic
1153718401 18:7875354-7875376 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1153817258 18:8801229-8801251 TTTTCATCTTGGGCAAGCAAAGG - Intronic
1153864143 18:9247444-9247466 ACTCCAGCCTGGGCAATGGACGG + Intronic
1154274122 18:12945210-12945232 ACTCCATCCTGGGCAACGCAGGG - Intergenic
1154305118 18:13224859-13224881 ACTCCAGCCTGGGTAATAAAGGG - Intronic
1155008280 18:21749671-21749693 ACTCCAGCCTGGGCAATAAAAGG - Intronic
1155968150 18:32055264-32055286 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1156129219 18:33949322-33949344 AGTTCGTCCTGGGCAATCATGGG + Intronic
1156281284 18:35641409-35641431 ATTCCAACCTGGGCAACAGAGGG + Intronic
1158627320 18:59082637-59082659 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1159034602 18:63264742-63264764 ATTCCTTCCTGTGTAATCAATGG + Intronic
1159386500 18:67732102-67732124 ATTCCATCATGGTCAATAAAAGG - Intergenic
1159402905 18:67960070-67960092 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1159482832 18:69012743-69012765 ATTCCATCTTGGGTCAGCAAAGG - Intronic
1159531222 18:69657982-69658004 ATTCCAGCCTGGGCAATAGAGGG - Intronic
1159727704 18:71983214-71983236 ACTCCAGCTTGGGCAACCAAGGG - Intergenic
1159858635 18:73618999-73619021 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1160885180 19:1342922-1342944 ATTCCATCCTGGGCAACAAGAGG + Intergenic
1161096339 19:2393863-2393885 ACTCCAACCTGGGCAACAAAGGG + Intronic
1161107284 19:2450641-2450663 ATTCCAGCCTGGGCGAGCACAGG + Intronic
1161111190 19:2471158-2471180 ACTCCAGCCTGGGCAATACAGGG + Intergenic
1161146298 19:2680606-2680628 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1161392021 19:4026039-4026061 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1161792841 19:6370992-6371014 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1161921060 19:7266416-7266438 ACTCCACCCTGGGCAACCAGAGG - Intronic
1162103748 19:8356978-8357000 ATTCCAGCCTGGGCAAAAGAGGG + Intronic
1162221984 19:9185614-9185636 ACTCCAGCCTGGGCAATAGAGGG - Exonic
1162241714 19:9360481-9360503 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1162405364 19:10469862-10469884 ACTCCATCCTGGGCAACAAGAGG - Intergenic
1162413451 19:10519728-10519750 ACTCCAGCCTGGGCAATAAAGGG - Intergenic
1162517608 19:11158447-11158469 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
1162647643 19:12061556-12061578 AATCCAGCCTGGGCAATAGAGGG + Intergenic
1162833415 19:13300978-13301000 ACTCCAGGCTGGGCAACCAAGGG - Intronic
1163030934 19:14543769-14543791 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1163063221 19:14775033-14775055 ATTCCAGCCTGGGCAACAAAGGG - Intronic
1163276625 19:16288555-16288577 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1163438003 19:17306886-17306908 ACTCCAACCTGGGCAACAAAAGG - Intronic
1163497169 19:17653378-17653400 ACTCCAGCCTGGGCAACAAAAGG - Intronic
1163567936 19:18062737-18062759 ATTCCAGCCTCGGCAATAAGAGG + Intronic
1163704865 19:18806484-18806506 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1163818448 19:19482369-19482391 ACTCCATCCTGGGCAATAGAGGG + Intronic
1164195938 19:22958767-22958789 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1164356153 19:27433103-27433125 TTTCCATACTGCTCAATCAAAGG - Intergenic
1164366508 19:27588827-27588849 TTTCCAACCTGCTCAATCAAAGG - Intergenic
1164536804 19:29092173-29092195 ACTCCAACCTGGGCAACCAAGGG - Intergenic
1165086428 19:33351247-33351269 ATTCCAGCCTGGGCAGCAAAGGG + Intergenic
1165338107 19:35187397-35187419 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1165525281 19:36349196-36349218 ATTCCAGCCTGGGCTATAAGAGG + Intronic
1165589465 19:36954910-36954932 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1165811585 19:38614887-38614909 ACTCCAGCCTGGGCAATAGAAGG + Intronic
1166035645 19:40166187-40166209 ATTCCAGCCTGGGCGATGGAGGG + Intergenic
1166525240 19:43506556-43506578 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
1166713583 19:44952452-44952474 ACTCCAGCCTGGGCAAGAAAAGG - Intronic
1166868884 19:45858546-45858568 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1167238277 19:48327838-48327860 ACTCCAGCCTGGGCAACCAGAGG - Intronic
1167247235 19:48380877-48380899 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1167328595 19:48840073-48840095 ACTCCATCATGGGCAACAAAGGG + Intronic
1167329123 19:48843511-48843533 ACTCCATCCTGGGCAACAGAGGG - Intronic
1167436834 19:49483832-49483854 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1167445942 19:49537537-49537559 TTTCCAGCCTGGGCAACCGAGGG - Intronic
1167459650 19:49618063-49618085 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1167905914 19:52660583-52660605 ACTCCAGCCTGGGCAATAAAGGG + Intronic
1168671541 19:58244606-58244628 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1202632559 1_KI270706v1_random:14114-14136 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
925587416 2:5477024-5477046 ACTCCAGCCTGGGCGATAAAGGG - Intergenic
925989494 2:9242653-9242675 AATCCATCCTGAGGAAGCAAAGG - Intronic
926195641 2:10762176-10762198 ACTCCAGCCTGGGCAACGAAGGG - Intronic
926998994 2:18772504-18772526 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
927404019 2:22747364-22747386 CTTCCATCCTGAGCAAACCAGGG - Intergenic
927793204 2:26027061-26027083 ATTCCAGCCTGGGCAAAAAGAGG - Intergenic
927938886 2:27091285-27091307 AGACCAGCCTGGGCAACCAAAGG - Intronic
927950091 2:27161840-27161862 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
928419231 2:31124651-31124673 ACTCCATCCTGGGCAATAGAGGG - Intronic
928445003 2:31326014-31326036 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
928741789 2:34363043-34363065 TTTACAGCCTTGGCAATCAAAGG + Intergenic
929137627 2:38639635-38639657 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
929239067 2:39634994-39635016 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
929413317 2:41721716-41721738 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
929508976 2:42552054-42552076 ATACCAGCCTGGGCAATATAGGG - Intronic
929696519 2:44121281-44121303 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
930072255 2:47376287-47376309 ACTCCAGCCTGGGCAACAAAAGG - Intronic
930120240 2:47754958-47754980 ACTCCAACCTGGGCAACCGAGGG - Intronic
930662944 2:54073326-54073348 AGTCCAGCCTGGGCAATGTAGGG + Intronic
930778990 2:55204249-55204271 ATTCCAGCCTGGGCAACAAGAGG + Intronic
930876581 2:56225391-56225413 ATTCCATCCTGTGCAATAGAAGG + Intronic
930895507 2:56441094-56441116 ATTCCAGCCTGGGCAGCCAAGGG - Intergenic
931263522 2:60640335-60640357 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
931357930 2:61553373-61553395 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
931363330 2:61597233-61597255 ACTCTAGCCTGGGCAATAAATGG + Intergenic
931552927 2:63467437-63467459 ACTCCATCCTGGGCAACAGAGGG + Intronic
931714295 2:65016842-65016864 AGACCAGCCTGGGCAATCACGGG - Intronic
932024351 2:68118534-68118556 ATTCCAGCCTGGGCAAAGAAGGG + Intergenic
932345354 2:70991757-70991779 TCTCCATCCTGGGCACTAAAGGG - Intronic
932381745 2:71290430-71290452 ATTCCAGCCTGGGCAACAGAGGG - Intronic
932585367 2:73024452-73024474 AGTCCACCCTGGGCAACAAAGGG + Intronic
932667742 2:73710575-73710597 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
932676481 2:73786011-73786033 ACTCCAGCCTGGGCAATAAGAGG + Intronic
932741684 2:74295599-74295621 ACTCCAGCCTGGGCAATAGAGGG + Intronic
932811104 2:74827022-74827044 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
933004426 2:76972448-76972470 ACTCCATCCTGGGCAATAGAGGG - Intronic
934749100 2:96780768-96780790 ACTCCAGCCTGGGCAATAGAGGG - Intronic
935615601 2:105077210-105077232 ACTCCAGCCTGGGCAATAGAGGG + Intronic
935696182 2:105772922-105772944 ACTCCAGCCTGGGCAACAAAGGG - Intronic
936889388 2:117351194-117351216 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
939153402 2:138498296-138498318 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
939253903 2:139718400-139718422 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
939829055 2:147050798-147050820 ATTCCAACCTGGGTGATGAAGGG - Intergenic
940065780 2:149627005-149627027 ATTCCAGCCTGGGCAACACAGGG + Intergenic
940347537 2:152642974-152642996 ACTCCAGCCTGGGCAATAGAGGG + Intronic
940588415 2:155686668-155686690 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
940884218 2:158974763-158974785 AGTCCAGCCTGGGCAACAAATGG - Intronic
940928893 2:159402415-159402437 ATTCCAGCCTGGGCAACAGAGGG + Intronic
940971724 2:159903715-159903737 ACTGCATCATGGGCACTCAATGG - Intronic
942268956 2:174254940-174254962 ATTCCAGCCTGGGCAACATAGGG - Intergenic
942344605 2:174989341-174989363 ATTCCAGCCTGGGCAACAAGAGG + Intronic
943562310 2:189478347-189478369 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
943917621 2:193657150-193657172 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
944105893 2:196078853-196078875 ACTCCAGCCTGGGCAACCGAAGG + Intergenic
944140203 2:196448024-196448046 ACTCCATCCTCGGCAATAGAGGG + Intronic
944405071 2:199374929-199374951 ACTCCAGCCTGGGCAACCCAGGG + Intronic
944583566 2:201154122-201154144 ACTCCAACCTGGGCAACAAAAGG - Intronic
944651869 2:201838437-201838459 ACTCCAGCCTGGGCAACCAAGGG - Intronic
944848486 2:203692535-203692557 ATTCCCTACTGTGCAATCAGTGG - Intergenic
945743978 2:213698292-213698314 ACTCCAGCCTGGGCAATAGAGGG - Intronic
945813083 2:214571817-214571839 ACTCCAGCCTGGGCAATACAGGG - Intronic
945887330 2:215389755-215389777 ACTCCATCCTGGGCAACAGAGGG + Intronic
946217204 2:218193665-218193687 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
946639726 2:221770930-221770952 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
947729110 2:232418451-232418473 AGCCCATCCTGGTCAATCTAGGG + Intergenic
948355363 2:237373247-237373269 AGTCCATCCTCGGCAATCTGGGG + Intronic
948425537 2:237884848-237884870 ACCCCATGCTGGGCAATCATGGG + Intronic
1169002002 20:2174623-2174645 ATTTCTTCCTGGGCAATTGAAGG + Intronic
1169097610 20:2916988-2917010 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1169365784 20:4991138-4991160 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1169524368 20:6407534-6407556 ATTCTAGCCTGGGCAATGGAGGG - Intergenic
1169625419 20:7562699-7562721 ATTCCAGCCTGGGCAACCGAGGG + Intergenic
1170585621 20:17732031-17732053 ACTCCATCCTGGGCAACAGAGGG + Intronic
1170640001 20:18143658-18143680 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1171043828 20:21791807-21791829 ACTACATCCTGGGTCATCAAGGG - Intergenic
1171191919 20:23164892-23164914 ACTCCAGCCTGGGCAATGAGAGG - Intergenic
1171472035 20:25379886-25379908 AGACCAGCCTGGGCAATGAAGGG - Intronic
1171821079 20:29840504-29840526 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1171941120 20:31330904-31330926 AGTCCAGCTTGGGCAATGAAAGG + Intergenic
1172044766 20:32072526-32072548 ACTCCAGCCTGGGCAATACAGGG + Intronic
1172052537 20:32129629-32129651 ACTCCATCCTGGGCGACAAAGGG - Intronic
1172253710 20:33498277-33498299 ACTCCAGCCTGGGCAACAAAAGG - Intronic
1172371723 20:34398429-34398451 ACTCCAGCCTGGGCAACGAAAGG - Intronic
1172582262 20:36057733-36057755 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1172881210 20:38201040-38201062 ATTCCAGCCTGGGCAAACAGAGG - Intergenic
1173523995 20:43718291-43718313 ACTCCAGCCTGGGCAACCAGAGG + Intergenic
1173527084 20:43741354-43741376 ACTCCAGCCTGGGCAACGAAGGG - Intergenic
1174013743 20:47471399-47471421 ATTCCAGCCTGGGCGACAAAGGG + Intergenic
1174820996 20:53726452-53726474 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1175616530 20:60404694-60404716 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1175883712 20:62275940-62275962 CCTCCAGCCTGGGCAACCAATGG - Intronic
1176026427 20:62988024-62988046 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1176251688 20:64124903-64124925 ACTCCATCCTGGGCAATAGAGGG - Intergenic
1176516524 21:7788542-7788564 AGTCCAGCCTGGGCAACCTAGGG - Intergenic
1177040999 21:16111309-16111331 ATTTCATCCTGTGAAATGAATGG + Intergenic
1177555298 21:22680883-22680905 ACTCCAGCCTGGGCAACCCAGGG - Intergenic
1177726496 21:24974654-24974676 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1177803844 21:25854962-25854984 ACTCCAACCTGGGCAATGAAGGG - Intergenic
1178313932 21:31553805-31553827 CTTCCCTCCTGAGCAAGCAATGG + Intronic
1178335790 21:31741965-31741987 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1178456971 21:32763952-32763974 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1178476484 21:32941706-32941728 ATTCCAGCCTGGGCACTGGAAGG + Intergenic
1178650552 21:34418554-34418576 AGTCCAGCCTGGGCAACCTAGGG - Intergenic
1179222730 21:39424043-39424065 ACTCCAGCCTGGGCAATGGAGGG - Intronic
1179875414 21:44264628-44264650 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1180325038 22:11363566-11363588 ATTCAATACTGCTCAATCAAAGG - Intergenic
1180401730 22:12437754-12437776 TTTCCAACCTGCTCAATCAAAGG + Intergenic
1180513292 22:16114863-16114885 ACTCCAGCCTGGGCAACAAATGG + Intergenic
1180622778 22:17172730-17172752 ATACTATCCTGGGCAACAAAAGG + Intergenic
1180641525 22:17303242-17303264 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
1180679669 22:17616313-17616335 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1180710222 22:17834515-17834537 AGACCATCCTGGGCAACCATGGG + Intronic
1180837411 22:18936995-18937017 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
1180902082 22:19381029-19381051 ATGCCATCCTAGCTAATCAATGG + Intronic
1180930310 22:19586167-19586189 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1181013978 22:20057767-20057789 ATTCTCTCCTGGGCAGTCACAGG - Intronic
1181063608 22:20294301-20294323 ACTCCAGCCTGGGCAATGGAAGG - Intergenic
1181116985 22:20637825-20637847 AGTCCAGCCTGGGCAATATAGGG - Intergenic
1181377436 22:22471179-22471201 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1181868956 22:25882927-25882949 ATTCCAGCCTGGGCAAAAGAGGG - Intronic
1182232649 22:28850252-28850274 ATTCCAGCCTGGGCAACAAAGGG - Intergenic
1182363751 22:29764105-29764127 ACTCCAGCCTGGGCAATGGAGGG + Intronic
1182671497 22:31999725-31999747 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1183150655 22:36034556-36034578 ATTCCAGCCTGGGCAACAAGAGG + Intergenic
1183377811 22:37475254-37475276 ACTCCAGCCTGGGCAATGAAGGG - Intronic
1183607673 22:38875548-38875570 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1183802829 22:40182210-40182232 ACTCCATCCTGGGCAGTACAGGG + Intronic
1183815080 22:40293226-40293248 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1183849985 22:40577643-40577665 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1184050584 22:42000958-42000980 ACTCCACCCTGGGCAATAGAGGG + Intronic
1184315594 22:43686011-43686033 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1184537574 22:45097801-45097823 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1184574663 22:45353227-45353249 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1184619974 22:45669909-45669931 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1184637463 22:45845392-45845414 AATCCATCCGAGGGAATCAAAGG - Intergenic
1184788606 22:46685097-46685119 ACTCCAGCCTGGGCAAACAGAGG - Exonic
1185167981 22:49273641-49273663 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1203287504 22_KI270734v1_random:162294-162316 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
949299756 3:2570204-2570226 ATTCCAGCCTGGGCAACAGAGGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949976673 3:9467165-9467187 ATTCCAGCCTGGGCAACAGAGGG + Intronic
950280571 3:11704348-11704370 ACTCCAGCCTGGGCAACAAAAGG + Intronic
950325949 3:12110153-12110175 ATTCCATCCTGGGCAACAGAGGG + Intronic
951027628 3:17846364-17846386 CTTCCCTCCTGGGCTCTCAAAGG - Intronic
951780665 3:26359893-26359915 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
953239091 3:41132399-41132421 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
953291556 3:41669276-41669298 ACTCCAGCCTGGGCAACAAAGGG - Intronic
953314235 3:41910928-41910950 ACTCCAGCCTGGGCAATAGACGG + Intronic
953441580 3:42923386-42923408 ACTCCAGCCTGGGCAATAAGAGG - Intronic
953560861 3:43991738-43991760 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
953959055 3:47253186-47253208 ACTCCAGCCTGGGCAATAGAGGG - Intronic
953961075 3:47266033-47266055 ATTCCATCTTGGGCTAATAATGG + Intronic
954394382 3:50285605-50285627 ACTCCAGCCTGGGCAATACAGGG + Intronic
954649936 3:52154811-52154833 ATTCCAGCCTGGGCAACAAGAGG + Intergenic
954800543 3:53184640-53184662 ACTCCAGCCTGGGCAATAAGAGG + Intronic
954803566 3:53201782-53201804 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
954818153 3:53300678-53300700 ACTCCAGCCTGGGCGACCAAGGG - Intronic
955311583 3:57893228-57893250 ATTCCAGCCTGGGCAACATAGGG + Intronic
955630604 3:60969895-60969917 ACTCCAGCCTGGGCAATAGAGGG - Intronic
958418201 3:93902263-93902285 ACTCCATCCTGGGCAACAGAGGG + Intronic
958847502 3:99282430-99282452 ACTCCAGCCTGGGCAATAAAGGG + Intergenic
959696744 3:109256398-109256420 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
960223378 3:115143467-115143489 AGTACAGCCTGGGCAATAAAAGG + Intronic
960708301 3:120502703-120502725 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
961003614 3:123390303-123390325 ACACCAAACTGGGCAATCAAGGG - Intronic
961838938 3:129691348-129691370 AGACCAGCCTGGGCAATGAAAGG + Intronic
962150334 3:132885954-132885976 ACTCCAGCCTGGGCAAAAAAAGG + Intergenic
962523158 3:136215363-136215385 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
962559356 3:136589602-136589624 ACTCCAGCCTGGGCAACAAAGGG + Intronic
962736765 3:138332337-138332359 AGACCATCCTGGCCAACCAACGG - Intergenic
963115577 3:141726371-141726393 ATACCAGCCTGGGCAACCTAGGG + Intergenic
963168457 3:142227814-142227836 ACTCCAGCCTGGGCAAACAAGGG - Intergenic
963669876 3:148237442-148237464 ACTCCAGCCTGGGCAATGGAGGG + Intergenic
963731215 3:148974758-148974780 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
964772434 3:160238546-160238568 ATTCCAGCCTGGGCAACAGAAGG + Intronic
965239082 3:166170890-166170912 TTTCTAGCCAGGGCAATCAATGG - Intergenic
965488065 3:169302829-169302851 ACTCCAGCCTGGGCAATAGAGGG + Intronic
965822793 3:172701480-172701502 ACTCCAGCCTGGGCAATAGAGGG - Intronic
965926320 3:173985007-173985029 ACTCCAGCCTGGGCAATAGAGGG + Intronic
966165463 3:177011335-177011357 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
966175739 3:177136303-177136325 ACTCCAGCCTGGGCAATAAGAGG - Intronic
966459072 3:180154902-180154924 ATTCCTTCCTGCTCAATGAAAGG + Intergenic
966793592 3:183694542-183694564 ACTCCAGTCTGGGCAATAAAAGG - Intergenic
966843742 3:184110067-184110089 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
967132464 3:186485197-186485219 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
967477886 3:189941969-189941991 ACTCATTCCTGGGCAATCACTGG - Intergenic
967536780 3:190613798-190613820 ACTCCAGCCTGGGCAATGGAGGG + Intronic
967935155 3:194721505-194721527 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
968129745 3:196185888-196185910 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
968239983 3:197070598-197070620 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1202742118 3_GL000221v1_random:65074-65096 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
968533834 4:1112008-1112030 AGACCATCCTGGGCAACAAAGGG + Intronic
968694136 4:2013299-2013321 ACTCCAGCCTGGGCGACCAAAGG + Intronic
968736474 4:2299572-2299594 ACTCCAGCCTGGGCAACCAAGGG + Intronic
968847969 4:3057666-3057688 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
969917347 4:10503813-10503835 ATTCCAGCCTGGGCAACAGAGGG - Intronic
971109005 4:23561732-23561754 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
971321279 4:25607940-25607962 ACTCCATCCTGGGCAGTAAGAGG - Intergenic
971505818 4:27365423-27365445 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
971921064 4:32940278-32940300 ACTCCAACCTGGGCAATAGAAGG - Intergenic
972152515 4:36111717-36111739 ATTTTATCTTGAGCAATCAAGGG - Intronic
972320866 4:37972446-37972468 ACTCCAGCCTGGGCAACAAAAGG + Intronic
972504930 4:39712006-39712028 ATTCCATCCTGGGCAAGAGAGGG + Intronic
972536826 4:40006895-40006917 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
973776869 4:54251030-54251052 ATTCCAGCCTGGGCAACAAGAGG + Intronic
974044208 4:56883949-56883971 ACTCCATCCTGGGCAGTGGAGGG + Intergenic
975102158 4:70525865-70525887 ACTCCATCCTGGGTGATGAAGGG + Intronic
975346784 4:73301122-73301144 ATTCCAGCCTGGGCAACAGAAGG - Intergenic
975429701 4:74274301-74274323 ATTCAAATCTGGTCAATCAAAGG + Intronic
975587876 4:75968996-75969018 ACTCCAGCCTGGGCAATAGAGGG + Intronic
976288921 4:83397418-83397440 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
976634910 4:87277873-87277895 ACTCCAGCCTGGGCAATGAAAGG - Intergenic
977121415 4:93106377-93106399 ATTCCAGCCTGGGCAACAGAGGG - Intronic
978379775 4:108114880-108114902 ATTCCATCCTGGGCAAATGCAGG - Intronic
978447189 4:108790877-108790899 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
978731594 4:112033297-112033319 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
979020136 4:115487399-115487421 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
979467784 4:121060377-121060399 AAACCAGCCTGGGCAACCAATGG - Intronic
980217078 4:129866560-129866582 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
980579094 4:134725938-134725960 ATTCCAGCCTGAGCAATGAGAGG + Intergenic
980909715 4:138983035-138983057 ATTCCAGCCTGATCAATCATCGG + Intergenic
981541757 4:145853545-145853567 ACTCCAGCCTGGGCAATAGAAGG + Intronic
982001288 4:151023820-151023842 ACTCCAGCCTGGGCAACCAAGGG - Intergenic
982004826 4:151053549-151053571 ATTCCAGCCTGGGAGACCAAGGG + Intergenic
982212399 4:153049064-153049086 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
982212499 4:153050275-153050297 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
982861109 4:160450138-160450160 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
983611374 4:169648992-169649014 ATTCCAGCCTGGGTGATAAAGGG + Intronic
983687143 4:170424016-170424038 ACTCCATCCTGGGCAATAGAAGG - Intergenic
984259594 4:177428392-177428414 ATTCCATTCTGGGCAACAGAGGG + Intergenic
984587680 4:181581763-181581785 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
984734174 4:183095765-183095787 ATTCCAGCCTGGGCAACATAAGG - Intergenic
984771467 4:183440378-183440400 ACTCCAGCCTGGGCGATAAAGGG - Intergenic
985220248 4:187696601-187696623 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
985262619 4:188128823-188128845 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
985604662 5:852021-852043 ATTCCAGCCTGGGCAACAGAGGG + Intronic
985676404 5:1233614-1233636 ACTCCAGCCTGGGCAATAGAGGG - Intronic
986697238 5:10368610-10368632 ACTCAAGCCTGGGCAACCAACGG - Intronic
986815901 5:11410902-11410924 ACTCCATCCTGGGCAACAGAAGG - Intronic
987106801 5:14647574-14647596 ACTCCAGCCTGGGCAATACAGGG - Intergenic
987113034 5:14704295-14704317 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
987317668 5:16738856-16738878 ACTCCAGCCTGGGCAACAAAGGG + Intronic
987715276 5:21560534-21560556 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
988315672 5:29623678-29623700 ACTCCAGCCTGGGGAATGAAGGG - Intergenic
988524666 5:31976748-31976770 ACTCCAGCCTGGGCAACCGAGGG - Intronic
988588292 5:32526713-32526735 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
988802006 5:34704990-34705012 AGTCCAGCCTGGGCAACAAAGGG - Intronic
989502859 5:42189271-42189293 ATTCCAGCCTGGGCCATAGAAGG + Intergenic
989943452 5:50184706-50184728 TTTCCAAACTGTGCAATCAAGGG + Intergenic
989986393 5:50703710-50703732 TTTCCAACCTGGGCAATGCAGGG + Intronic
990101928 5:52201765-52201787 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
990198660 5:53346691-53346713 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
990956176 5:61341910-61341932 ACTCCAGCCTGGGCAACAAAGGG - Intronic
992567309 5:78011074-78011096 ACTCCATCCTGGGCAACAGAGGG - Intronic
992675748 5:79104245-79104267 AGTCCATCCTGGGCAATGCAGGG + Intronic
992792331 5:80224657-80224679 ATTCCAGCCTGGGCAACAAGAGG - Intronic
992940717 5:81758615-81758637 ATTCCAGCCTGGACAACAAAGGG + Intergenic
993025735 5:82643911-82643933 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
993273899 5:85831555-85831577 ACTCCATCCTGGGCAATAGAGGG + Intergenic
994257279 5:97613767-97613789 ATTCCTTCCTGGGGGATCAGCGG + Intergenic
994628676 5:102253770-102253792 ACTCCAGCCTGGGCGACCAAAGG + Intronic
995066172 5:107865449-107865471 ATTGCATTTTGGGAAATCAAAGG - Intronic
995373891 5:111451864-111451886 ATTCCAGCCTGGGCAATAAAAGG + Intronic
995885072 5:116885223-116885245 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
996846475 5:127904533-127904555 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
997047871 5:130341673-130341695 ACTCCAGCCTGGTCAATAAACGG - Intergenic
997308086 5:132855470-132855492 ACTCCAGCCTGGGCAATGGATGG - Intergenic
997450008 5:133974920-133974942 ACTCCAGCCTGGGCAACAAAGGG + Intronic
997641883 5:135454751-135454773 ATTGCATCCTGGACAATGCAAGG - Intergenic
997724764 5:136111374-136111396 AGACCATCCTGGGCAATGTAGGG + Intergenic
997938702 5:138137348-138137370 ACTCCAGCCTGGGCAATAGAGGG - Intronic
997959009 5:138304536-138304558 ATTCCAGCCTGGGCAACAAAGGG - Intronic
998238382 5:140420026-140420048 ATTCCAGCCTGGGCAACAGAGGG - Intronic
998330646 5:141323387-141323409 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
998876982 5:146609927-146609949 AAGCAAGCCTGGGCAATCAATGG - Intronic
999162138 5:149510508-149510530 ACTCCAGCCTGGGCAACCGAGGG - Intronic
999212912 5:149905888-149905910 ATTCCAGCCTGGGCAACAGAGGG - Intronic
999751787 5:154632950-154632972 TCTCCAGCCTGGGCAATAAAAGG - Intergenic
1000064581 5:157683589-157683611 ACTCCAGCCTGGGCAATGAGAGG - Intergenic
1000122744 5:158212798-158212820 ATTCTCTCCTTGGCAATGAAGGG + Intergenic
1000485687 5:161840713-161840735 ACTCCATCCTGGGCCACAAAAGG - Intergenic
1001048501 5:168394691-168394713 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1001278153 5:170365966-170365988 ATTGCATCCTAGGCAAACCAGGG + Intronic
1001392969 5:171395145-171395167 GTTCCATCCTGGGCAACAGAGGG + Intronic
1001804837 5:174574739-174574761 ATTCCAGCCTCAGCACTCAAGGG - Intergenic
1001887028 5:175302029-175302051 ACTCCATCCTGGGCAACAGAGGG - Intergenic
1001995067 5:176150842-176150864 ACTCCATCCTGGGCAACAAGAGG + Intergenic
1002087112 5:176782907-176782929 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1002118819 5:176985421-176985443 ATTCCAGCCTGGGCAACAAGAGG + Intronic
1003090946 6:3102631-3102653 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1003313760 6:4992334-4992356 AGTCCATCCTGGGCAACAGAGGG + Intergenic
1004154767 6:13157913-13157935 ACTCCAGCCTGGGCAACCCACGG - Intronic
1004202426 6:13561522-13561544 ACTCCAGCCTGGGCAACAAAAGG + Intergenic
1005091961 6:22066574-22066596 ATTCCAGCCTGAACCATCAAGGG + Intergenic
1005569359 6:27129980-27130002 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1005731396 6:28700265-28700287 ATTCCAGCCTGGGCAACAAAAGG + Intergenic
1005939216 6:30548141-30548163 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1005974118 6:30784315-30784337 ATTCCAGCCTGGGCAACAGAAGG - Intergenic
1006318799 6:33306943-33306965 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1006536355 6:34702193-34702215 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1006544033 6:34764441-34764463 ATTCCAGCCTGGGCAACAAGAGG + Intronic
1006669581 6:35721486-35721508 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1006700169 6:35965966-35965988 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1006701722 6:35980003-35980025 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1006848615 6:37081061-37081083 ATTCCAGCCTGGGCAACAAGAGG + Intergenic
1007770615 6:44189025-44189047 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1008037950 6:46765930-46765952 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1008373840 6:50768933-50768955 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1008376352 6:50796084-50796106 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1009001442 6:57721511-57721533 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1009306249 6:62092987-62093009 ATTTAATACTGGGAAATCAATGG + Intronic
1009578036 6:65492947-65492969 ACTCCAGCCTGGGCGATGAAGGG - Intronic
1010167470 6:72934025-72934047 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1011094832 6:83649612-83649634 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1011413405 6:87090668-87090690 ATTCCATCCTGGACAATAGAGGG - Intronic
1011962848 6:93113160-93113182 ACTCCAGCCTGGGCAACCAAAGG - Intergenic
1012844221 6:104368972-104368994 ACTCCAGCCTGGGCAACCAAGGG + Intergenic
1012894456 6:104932866-104932888 ACTCCAGCCTGGGCAACCAGGGG - Intergenic
1013044441 6:106470290-106470312 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1013129248 6:107216102-107216124 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1013524286 6:110959922-110959944 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1013556648 6:111262968-111262990 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1014179731 6:118371734-118371756 ATTCCATCCTGGCCCTTCCAGGG + Intergenic
1014678528 6:124398957-124398979 ACTCCATCCTGGGCAAGAGAGGG - Intronic
1014748042 6:125222842-125222864 ATTCCATCTTAGACAATCTAAGG - Intronic
1015178741 6:130339077-130339099 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1015635849 6:135273410-135273432 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1015973059 6:138762025-138762047 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1016056857 6:139587303-139587325 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1016298270 6:142599778-142599800 ATTCCAGCCTGGGCTACAAAGGG + Intergenic
1016582490 6:145645337-145645359 ACTCCAGCCTGAGCAATAAAGGG - Intronic
1016926701 6:149357381-149357403 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1017118229 6:150998954-150998976 ACTCCAGCCTGGGCAAACAGAGG + Intronic
1017734597 6:157349468-157349490 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
1018255053 6:161910285-161910307 ACTCCACCCTGGGCAATAGAGGG - Intronic
1019491752 7:1317394-1317416 ACTCCAGCCTGGGCAATAGAAGG + Intergenic
1019680013 7:2342144-2342166 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1019703161 7:2484183-2484205 ATTCCAACCTGGGCAACAGAAGG - Intergenic
1020128235 7:5545139-5545161 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1020190961 7:5997575-5997597 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1020522028 7:9203266-9203288 ACTCCAGCCTGGGCGATCGAGGG - Intergenic
1021153764 7:17183574-17183596 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1021640661 7:22733309-22733331 ACTCCATCCTGGGCAACAGAGGG + Intergenic
1021900212 7:25277855-25277877 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1022290572 7:28998766-28998788 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1022326183 7:29334082-29334104 ACTCCAGCCTGGGCAATGGAGGG - Intronic
1023359353 7:39399815-39399837 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1023920507 7:44625938-44625960 ACTCCATCCTGGGCAACAGAGGG + Intronic
1024253258 7:47521918-47521940 ATCCCAGCCTGGGCAGACAAAGG + Intronic
1025065279 7:55849290-55849312 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1025204948 7:56987099-56987121 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1025518209 7:61682801-61682823 TTTCCATACTGCTCAATCAAAGG + Intergenic
1025534608 7:61932398-61932420 ATTCCAACCTGTTGAATCAAAGG - Intergenic
1025542535 7:62111449-62111471 TTTCCATACTGCTCAATCAAAGG + Intergenic
1025666990 7:63589836-63589858 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1025865387 7:65375943-65375965 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1025927867 7:65973722-65973744 ACTCCATCCTGGGCAATAGAGGG + Intronic
1026093290 7:67318969-67318991 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1026170157 7:67946906-67946928 ACTCCAACCTGGGCAATAAGAGG - Intergenic
1026557946 7:71423887-71423909 ACTCCAGCCTGGGCAATAGAAGG + Intronic
1027035323 7:74921149-74921171 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1027365858 7:77457187-77457209 AGACCAGCCTGGGCAATAAAGGG - Intergenic
1027416296 7:77978313-77978335 ACTCCAGCCTGGGCAACCACAGG - Intergenic
1027488375 7:78790464-78790486 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1027690360 7:81337476-81337498 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1028563135 7:92197320-92197342 ATTTGATCCTGAGAAATCAATGG - Intergenic
1028854028 7:95569315-95569337 AGTCCTTCCTGGGCATACAATGG + Intergenic
1028855750 7:95591132-95591154 AGACCAGCCTGGGCAATAAAGGG - Intronic
1028883783 7:95909523-95909545 ATTGGATCCTGGGCCATGAAAGG + Intronic
1029411527 7:100415114-100415136 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1029529104 7:101113681-101113703 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1029633093 7:101765470-101765492 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1029900832 7:104037233-104037255 ACTCCATTCTGGGCAATAGAGGG + Intergenic
1030393517 7:108956709-108956731 ATTTCTTCCTGGACAATTAATGG - Intergenic
1030562781 7:111111805-111111827 ACTCCATCCTGGGCGACAAAAGG + Intronic
1030836619 7:114294806-114294828 ATTCCAGCCTGGGCAACAGAAGG + Intronic
1032015561 7:128378371-128378393 ACTCCAGCCTGGGCAATTGAGGG - Intergenic
1032247056 7:130222188-130222210 ATTCCAGCCTGGGCAACAAGAGG - Intergenic
1032832104 7:135638380-135638402 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1033126865 7:138714201-138714223 ACTCCATCCTGGGCAACAGAGGG + Intronic
1033169036 7:139067179-139067201 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1033202198 7:139382956-139382978 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1034156100 7:148957213-148957235 ATTCCAGCCTGGGCAAAAGAGGG + Intergenic
1034504661 7:151478666-151478688 ATTCCAGCCTGGGCAACAAGAGG - Intronic
1034506929 7:151499839-151499861 ACTCCAGCCTGGGCAACCGAGGG - Intronic
1034658033 7:152744849-152744871 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1035707850 8:1690669-1690691 ACTCCAGCCTGGGCGATAAAGGG + Intronic
1035715377 8:1750273-1750295 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
1035793680 8:2333192-2333214 ACTCCAGCCTGGGCCACCAAAGG - Intergenic
1035799123 8:2388513-2388535 ACTCCAGCCTGGGCCACCAAAGG + Intergenic
1036152616 8:6312775-6312797 ACTCCAACCTGGGCAATAGAGGG + Intergenic
1036387974 8:8298237-8298259 ATTCCAGCCTGGGCAATAGAGGG + Intergenic
1036446419 8:8825203-8825225 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1036461137 8:8953902-8953924 ACTCCATCCTGGGCAACAGAGGG - Intergenic
1036822995 8:11954823-11954845 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1036964691 8:13283711-13283733 AGGCCATCCTGGGCAATATAGGG - Intronic
1037031450 8:14111019-14111041 ATTCTAGCCTGGGCAACAAACGG + Intronic
1037107394 8:15126111-15126133 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1037623282 8:20586026-20586048 ACTCCAGCCTGGGCAATAGATGG - Intergenic
1038016189 8:23517364-23517386 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1038142214 8:24858548-24858570 ATTCCAGCCTGGGCAACAGAAGG - Intergenic
1038223796 8:25635977-25635999 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1038265333 8:26035173-26035195 ATTCCAGCCTGAGCAACAAAGGG - Intronic
1038817329 8:30918231-30918253 ACTCCAGCATGGGCAATCAATGG + Intergenic
1038907665 8:31924316-31924338 ACTCCAGCCTGGGCAATACAGGG + Intronic
1039258881 8:35749100-35749122 TTTCCATCCTGGGGATTCTAAGG + Intronic
1039501038 8:38017669-38017691 ATTCCACCCTGGACAACAAAGGG - Intergenic
1039773591 8:40713874-40713896 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1039824134 8:41158465-41158487 ATTCCAGCCAGGTCAATAAAGGG + Intergenic
1039879254 8:41613881-41613903 ATTCCAGCCTGGGCAACACAGGG + Intronic
1039952509 8:42183035-42183057 ACTCCAGCCTGGGCAACAAAAGG - Intronic
1040127788 8:43758049-43758071 TTTCCATCCTGATCAATCAAAGG - Intergenic
1040134160 8:43833169-43833191 TTTCCAACCTGCTCAATCAATGG - Intergenic
1040348187 8:46532095-46532117 ATTCCAACCTGCTGAATCAAAGG - Intergenic
1040348288 8:46533636-46533658 TTTCCATCCTGCTGAATCAAAGG - Intergenic
1040750628 8:50701881-50701903 ATTCCAGCGTGGGCAACCAGAGG - Intronic
1041510932 8:58654515-58654537 ACTCCAGCCTGGGCAACAAAAGG + Intronic
1042238371 8:66638285-66638307 GTTCCAGCCTGGGCAACCTAAGG + Intronic
1042300204 8:67270989-67271011 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1042750907 8:72156413-72156435 ATACCAGCCTGGGCAACAAAGGG - Intergenic
1042823375 8:72955992-72956014 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1042863366 8:73335354-73335376 ACTCCAGCCTGGGCAAAAAAGGG - Intergenic
1043539134 8:81239686-81239708 ACTCCAGCCTGGGCCACCAAGGG - Intergenic
1043658492 8:82704511-82704533 ATTCCATCATGGAGAATGAATGG - Intergenic
1043979954 8:86626440-86626462 ATTCCAGCCTTAGCATTCAAGGG + Intronic
1044210354 8:89542749-89542771 ATTCCAGCCTGGGCAACAAGAGG + Intergenic
1044256720 8:90071933-90071955 ATACCATGCTGGGCATTCAGGGG - Intronic
1044328662 8:90890786-90890808 ATTCCATTCTAGGAAATGAAAGG + Intronic
1044666159 8:94636550-94636572 ACTCCAGCCTGGGCAACAAAGGG - Intergenic
1044970702 8:97616642-97616664 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
1044984413 8:97745136-97745158 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1045405682 8:101864625-101864647 ACTCCAGCCTGGGCAAGAAAAGG - Intronic
1045411233 8:101921974-101921996 ATTCCAGCCTGGGCAATAGAGGG - Intronic
1046609082 8:116404281-116404303 ACTACAGCCTGGGCAATAAAGGG - Intergenic
1047123495 8:121932482-121932504 ACTCCAGCCTGGACAATCAAGGG + Intergenic
1047354647 8:124108843-124108865 ATTCCAGCCTGGGCAACATAGGG + Intronic
1047359431 8:124154031-124154053 ATGCCAGCCTGGGCAATATAGGG + Intergenic
1048276276 8:133068316-133068338 ATCCCCTCCTGGGCACTCAAGGG - Intronic
1048425806 8:134322412-134322434 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1048546011 8:135387813-135387835 AGACCAGCCTGGGCAATAAATGG + Intergenic
1048847776 8:138616441-138616463 CTTCCATTCTGGGCATTCAGAGG + Intronic
1049088213 8:140494167-140494189 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1049677897 8:143901114-143901136 ATTCCAGCCTGGGCAACAGATGG - Intergenic
1049952385 9:657913-657935 ATTCCAGCCTGGGCAATTTAGGG - Intronic
1050840917 9:10147845-10147867 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1051278658 9:15420384-15420406 ACTCCAGCCTGGGCAATAAGAGG + Intergenic
1051636293 9:19183539-19183561 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1052193067 9:25680009-25680031 ACTCCATCCTGGGCGACAAAAGG + Intergenic
1052316186 9:27118434-27118456 AGACCATCCTGGGCAATATAGGG + Intronic
1052400921 9:27998756-27998778 ATTCCATCCTGGGTGATAGAGGG + Intronic
1052512715 9:29441800-29441822 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1052544557 9:29858397-29858419 ACTCCATCCTGGGCAACAAGAGG + Intergenic
1052702041 9:31949396-31949418 ACTCCATCCTGGGCATCAAAGGG + Intergenic
1052868369 9:33480506-33480528 ATTCCAGCCTGGGCTATAGAGGG - Intergenic
1052912853 9:33899405-33899427 ACTCCATCCTGGGCAACAGAGGG - Intronic
1053118137 9:35523780-35523802 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1053172367 9:35897966-35897988 ACTCCAGCCTGGGCAACAAAGGG + Intergenic
1053327181 9:37164612-37164634 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1053431166 9:38042730-38042752 ATTCCAGCCTGGCCAAGCATGGG + Intronic
1053492575 9:38520802-38520824 ACTCCAGCCTGGGCAATGGAGGG - Intergenic
1054742555 9:68822927-68822949 ATTCCTTCCTGGACACTCCAGGG + Intronic
1054849091 9:69827936-69827958 AAACCATCCTGGGCAAACCATGG - Intronic
1054934241 9:70669774-70669796 ATTCCAGCTTGGGCAACAAAGGG - Intronic
1055773305 9:79740493-79740515 ATTCCAGCCTGGGCAACAGAGGG - Intergenic
1055952469 9:81743271-81743293 ATTCCAGCCTGGGCTACCCAGGG - Intergenic
1056165674 9:83938774-83938796 ATTCTATCCTGGGCAACAGATGG - Exonic
1056213444 9:84386349-84386371 ATTCCAGCCTGGGCAACAAAGGG + Intergenic
1056963812 9:91149581-91149603 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1056966790 9:91169419-91169441 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1057006166 9:91562143-91562165 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1057143130 9:92739389-92739411 CTCCCATCCTGGGGAATCACAGG + Intronic
1057352149 9:94308017-94308039 ATTCCAGCCTGGGCAACAAAGGG + Intergenic
1057614960 9:96581195-96581217 ACTCCAGCCTGGGCAATAAGAGG + Intronic
1057655493 9:96948073-96948095 ATTCCAGCCTGGGCAACAAAGGG - Intronic
1057752748 9:97805208-97805230 ACTCCAACCTGGGCAATAGAGGG + Intergenic
1057909996 9:99012742-99012764 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1058223320 9:102329051-102329073 ATTCTAGCCTGGGCAATGCAGGG + Intergenic
1058374655 9:104308502-104308524 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1058432480 9:104930949-104930971 ACTCCAGCCTGGGCAACAAAAGG - Intergenic
1058682304 9:107450682-107450704 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
1058683994 9:107465025-107465047 AGACCAACCTGGGCAATAAAGGG + Intergenic
1058990577 9:110252189-110252211 ACTCCATCCTGGGCAATAGACGG + Intronic
1059729469 9:117042901-117042923 ACTCCAGCCTGGGCAACAAAGGG - Intronic
1059829308 9:118075564-118075586 AATCCAGCCTGGGCAACAAAAGG + Intergenic
1060083658 9:120677159-120677181 ACTCCATCCTGGGCGACCGAGGG - Intronic
1060470194 9:123942241-123942263 ACTCCAGCCTGGGCAATAAAGGG + Intergenic
1060617956 9:125036115-125036137 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1060868671 9:127021463-127021485 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1062155834 9:135047977-135047999 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1186058326 X:5675035-5675057 ATTCCAGCCTGGGCAACAGAAGG + Intergenic
1186313351 X:8343612-8343634 ATTCCAGCCTGGGGAATAGAGGG - Intergenic
1186433987 X:9527981-9528003 ATGCCAGCCTGGGCAACCTAAGG - Intronic
1187329821 X:18327335-18327357 ACTCCAGCCTGGGCAACCAGGGG + Intronic
1187330879 X:18338409-18338431 ACTCCAGCCTGGGCAACAAAGGG + Intronic
1187335989 X:18382234-18382256 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1187714878 X:22092780-22092802 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1187911568 X:24116177-24116199 ACTCCAGCCTGGGCAATAAGAGG - Intergenic
1187929226 X:24278867-24278889 GTTCCAGCCTGGGCAACAAATGG - Intergenic
1188361836 X:29264943-29264965 ACTCCAGCCTGGGCAATAAGAGG - Intronic
1188684000 X:33046569-33046591 ATGTTATCCTGGGCAATCAATGG - Intronic
1189102314 X:38203744-38203766 ATTCCAGCCTGCGCAACAAAAGG + Intronic
1189344842 X:40233047-40233069 ACTCCAGCCTGGGCAATAAAGGG + Intergenic
1189523188 X:41791688-41791710 ATTCCAGCCAGGGCAACAAAGGG + Intronic
1189720778 X:43914719-43914741 GTTCCAGCCTGGGCAGGCAACGG - Intergenic
1189935374 X:46062629-46062651 ATTCCGTTTTGGGAAATCAATGG - Intergenic
1190069968 X:47271651-47271673 ACTCCAGCCTGGGCAACCGAGGG + Intergenic
1190078008 X:47332897-47332919 ACTCCAGCCTGGGCAACCGACGG - Intergenic
1190568934 X:51762417-51762439 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1190813716 X:53909412-53909434 ACTCCAGCCTGGGCAATAGAGGG + Intergenic
1190869185 X:54410969-54410991 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1191152379 X:57233670-57233692 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1191574216 X:62677627-62677649 ATTCCAAACTGCTCAATCAAAGG - Intergenic
1191578057 X:62728779-62728801 TTTCCAACCTGGTTAATCAAAGG + Intergenic
1191578657 X:62735696-62735718 ATTCCATCCAGCAGAATCAAAGG + Intergenic
1192281232 X:69688431-69688453 ACTCCAGCCTGGGCGATCAAGGG - Intronic
1192296257 X:69852160-69852182 ACTCCATCCTGGGCAACAAGAGG - Intronic
1192798326 X:74442922-74442944 ACTCCATCCTGGGCAATAGAGGG + Intronic
1193029540 X:76882652-76882674 AATCAAGCCTGGGCAATCACAGG - Intergenic
1193778009 X:85667871-85667893 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1193828853 X:86262253-86262275 ACTCCAGCCTGGGCAATAGAGGG + Intronic
1195003522 X:100665184-100665206 ATTCCCTCCAGGGAAAGCAAGGG + Intronic
1195041028 X:101014565-101014587 ACTCCAGCCTGGGCAATAGAGGG - Intronic
1196270627 X:113706486-113706508 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1196361453 X:114865846-114865868 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1196661559 X:118276287-118276309 ACTCCAGCCTGGGCAATAGAGGG - Intergenic
1196689784 X:118546955-118546977 ATTCCAGCCTGGGCAACAGAGGG + Intronic
1196833326 X:119793114-119793136 ACTCTAGCCTGGGCAATAAAGGG - Intergenic
1197725852 X:129775896-129775918 ATTCCAGCCTGGGCAACAGAGGG + Intergenic
1198049636 X:132938127-132938149 ACTCCACCCTGGGCAACAAAGGG + Intronic
1198124774 X:133632130-133632152 ATTCCAGCCTGGGCAACAGAGGG - Intronic
1199287853 X:146073824-146073846 ATTCCTTCCTGGGGACTCCAGGG - Intergenic
1199907469 X:152248127-152248149 ATTCCTTCCTGGACTATGAAAGG + Intronic
1200311869 X:155086379-155086401 ACTCCAGCCTGGGCAAGGAAGGG - Intronic
1201010974 Y:9548014-9548036 CTTCCCTCATGGCCAATCAATGG - Intergenic
1201318762 Y:12674474-12674496 ACTCCATCCTGGGCGACCCAGGG - Intergenic
1202590044 Y:26473084-26473106 ACTCCATCCTGGGCAACAGAGGG + Intergenic