ID: 1080322352

View in Genome Browser
Species Human (GRCh38)
Location 11:31026313-31026335
Sequence ACATAGCAGAAACTACATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080322350_1080322352 3 Left 1080322350 11:31026287-31026309 CCGTACCTTTACATAATGAAGAC 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1080322352 11:31026313-31026335 ACATAGCAGAAACTACATAATGG 0: 1
1: 0
2: 1
3: 58
4: 276
1080322351_1080322352 -2 Left 1080322351 11:31026292-31026314 CCTTTACATAATGAAGACTAAAC 0: 1
1: 0
2: 2
3: 22
4: 175
Right 1080322352 11:31026313-31026335 ACATAGCAGAAACTACATAATGG 0: 1
1: 0
2: 1
3: 58
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080322352 Original CRISPR ACATAGCAGAAACTACATAA TGG Intronic
901122511 1:6907147-6907169 ACACAGCAGAAACCACACACCGG - Intronic
902109446 1:14065941-14065963 ACAAAACAAAAACTACATATTGG - Intergenic
903373696 1:22852796-22852818 ACAGAGCAGATGCTCCATAACGG - Intronic
905111790 1:35600421-35600443 ACATTACAGAAACTGAATAAGGG + Intronic
905714458 1:40136113-40136135 AACTAGTAGAAACTACATCATGG - Intergenic
906878576 1:49565051-49565073 ACAAAGAAGACATTACATAATGG - Intronic
907762364 1:57373871-57373893 ACATATCAGAAGATACTTAAAGG + Intronic
910868589 1:91810497-91810519 ACTTACCAGAAACTCCATGAGGG + Intronic
913940506 1:125099622-125099644 AGATAGCTGAAACTACAAAATGG + Intergenic
913944114 1:125141253-125141275 AGATAGCTGAAACTACAAAATGG - Intergenic
913955083 1:143282496-143282518 AGATAGCTGAAACTACAAAATGG + Intergenic
913982355 1:143532945-143532967 AGATAGCTGAAACTACAAAATGG - Intergenic
916336717 1:163679665-163679687 ACAAAGAAGAAACTTTATAAAGG + Intergenic
917658325 1:177151031-177151053 TCATAGCAGAAAATACAGAGGGG + Intronic
918522889 1:185434158-185434180 ACATAGCAGTCACTTAATAAAGG + Intergenic
919026641 1:192180243-192180265 ACATATTAAAAACTCCATAAGGG - Intronic
920943567 1:210506873-210506895 ACAGACCAAAAACTTCATAAGGG - Intronic
921936001 1:220797672-220797694 AGATAGCAGAAACTGCATGGTGG - Intronic
1063766292 10:9144758-9144780 TCATAGCAGACACTTCATATTGG - Intergenic
1066779644 10:38930232-38930254 AGATAGCCTAAACTACAAAATGG - Intergenic
1066812048 10:39352586-39352608 CCTTTGCAGAAACTACAAAAAGG + Intergenic
1066951576 10:42123406-42123428 AGATAGTTGAAACTACAAAATGG + Intergenic
1067513823 10:46919440-46919462 AAAAAGCAGAAGCAACATAAGGG - Intronic
1067648431 10:48132394-48132416 AAAAAGCAGAAGCAACATAAGGG + Intergenic
1067743203 10:48912675-48912697 TCATAGGAGAAACGAAATAATGG - Intronic
1068748894 10:60568593-60568615 ACTTAGCAGATGCTACATAGGGG - Intronic
1069069627 10:63979859-63979881 ACATGGCAGAAAGAACAGAAAGG + Intergenic
1069078930 10:64067307-64067329 AGATATCAGTAACTACAAAAGGG - Intergenic
1069525987 10:69171998-69172020 ACATTGCAGAAAACACACAACGG - Exonic
1069830786 10:71281119-71281141 ACAAAACAGAAACTAAAGAAGGG - Intronic
1071723415 10:88170302-88170324 ACATAGATCAAACTACAAAAAGG - Intergenic
1071865523 10:89726106-89726128 ATACAGCAGAAAATAAATAATGG + Intronic
1071995087 10:91140023-91140045 AGATAGCAGAAGCGACAGAAGGG - Intergenic
1073091253 10:100941714-100941736 ACACAGCAAACACTATATAAGGG - Intronic
1073276899 10:102319672-102319694 ACATAGCATAAACAAGAAAAAGG - Intronic
1073763611 10:106657479-106657501 ACAGAGAAAAAACTACATATTGG + Intronic
1077719519 11:4613643-4613665 ACATGGCAGAAAATGCAGAAGGG + Intergenic
1080239698 11:30112487-30112509 AAATAGGAGAGACTTCATAAGGG - Intergenic
1080322352 11:31026313-31026335 ACATAGCAGAAACTACATAATGG + Intronic
1084555913 11:69875705-69875727 AAATTGCAGAAACTGCCTAAAGG - Intergenic
1084855359 11:71981483-71981505 AGATAGCAAATAATACATAATGG - Intronic
1085495272 11:76963282-76963304 ACATACCCACAACTACATAAAGG + Intronic
1086240808 11:84688228-84688250 ACATAGCAGAAAATAGCTATTGG + Intronic
1089224127 11:116901273-116901295 ACATAGCAGAGACTCAAGAAAGG + Intronic
1091047961 11:132342046-132342068 ACAAAGCCGACACCACATAAAGG - Intergenic
1091188362 11:133667734-133667756 AAAGTGCAGAAAGTACATAAAGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1095995212 12:48076626-48076648 AAAAAGCAAAAACTACATATTGG - Intronic
1096006447 12:48176936-48176958 ATATAACAAAAAATACATAAAGG - Intronic
1096363081 12:51005109-51005131 ACAAAGGAGAAACTACATATAGG - Intronic
1099499015 12:83388605-83388627 ACATAGTACAAGCTACAAAATGG + Intergenic
1099538870 12:83879972-83879994 ACATAGTAGGAACTCAATAATGG - Intergenic
1102946196 12:116990684-116990706 ACATTTGAGAAACTACTTAAAGG + Intronic
1102980805 12:117239420-117239442 ACACAGAAGAGACAACATAATGG - Intronic
1103206788 12:119136002-119136024 ACAGAGCATAAGCTACATGAGGG - Intronic
1105233714 13:18525652-18525674 AGATAGCTTAAACTACAAAAAGG - Intergenic
1106990201 13:35409749-35409771 AGGTAGCAGAAACTACAAAGGGG + Intronic
1107082707 13:36391859-36391881 ACATAGAAAAAAAAACATAAGGG - Intergenic
1107496481 13:40930471-40930493 CCATAGCATACAGTACATAATGG - Intergenic
1107865633 13:44700632-44700654 AAACAGCAGAAACTACATTAAGG - Intergenic
1108555856 13:51591775-51591797 AGAAAACTGAAACTACATAACGG - Intronic
1108781163 13:53836111-53836133 ATATAGGAGTAAATACATAATGG - Intergenic
1109292316 13:60491540-60491562 ACAATGCAGAAAATACATTATGG + Intronic
1109633526 13:65084622-65084644 ATTTAGCAGAAACTTCAGAAAGG + Intergenic
1109969438 13:69747208-69747230 AGATAGCAGATACTCCATCAGGG + Intronic
1111794982 13:92907829-92907851 AAATAGCAAAAAATAAATAAAGG + Intergenic
1113649104 13:112022317-112022339 ACATTGCTGAAATTACACAAAGG + Intergenic
1115207701 14:30928755-30928777 AGAAAGCAGAAACTACAGAAAGG + Intronic
1115797063 14:36949974-36949996 ACATATCAGAGACTTTATAACGG + Intronic
1116121332 14:40724958-40724980 AAATAGCTTAAAATACATAATGG + Intergenic
1117605445 14:57423935-57423957 ACATAGCAGCAACTAAATACTGG + Intergenic
1118524518 14:66623934-66623956 AAATATCAGAAGCTACATGAGGG + Intronic
1120015887 14:79472924-79472946 ACTCAGCATTAACTACATAAAGG - Intronic
1120315758 14:82890588-82890610 ACATAGCAAAAATTATATAGAGG - Intergenic
1120401022 14:84031741-84031763 ACATAGTATTAATTACATAAAGG + Intergenic
1121959262 14:98243600-98243622 CCATAGCAGAAGCTCCATAAAGG - Intergenic
1122526847 14:102392319-102392341 ACATAGAAGAGAGAACATAAAGG - Intronic
1122711463 14:103661577-103661599 TAAAATCAGAAACTACATAATGG - Intronic
1122806096 14:104258529-104258551 ACATAGAAAAAACTACACCAAGG + Intergenic
1202937616 14_KI270725v1_random:106023-106045 AGATAGCCTAAACTACAAAATGG + Intergenic
1123395599 15:19931864-19931886 AGAGAGCTGAAACTACAAAATGG - Intergenic
1124029189 15:25994176-25994198 ACAGAGCAGGAACTGCATCAGGG - Intergenic
1125413807 15:39431683-39431705 ACATAACATACACTACATGAAGG - Intergenic
1126290203 15:47066716-47066738 ACGTAGTAGAATCAACATAAAGG - Intergenic
1129788322 15:78323667-78323689 ACCTAGCAGGCACTCCATAAAGG - Intergenic
1132176827 15:99722426-99722448 ACAAAGCACAAACTATTTAAAGG + Intronic
1133871958 16:9697166-9697188 ACACAGAGGAAACTACATAGAGG - Intergenic
1134881963 16:17752803-17752825 AAAGAGCAGCAACTACAAAATGG + Intergenic
1136698047 16:32104041-32104063 AGATAGCTGAAACTACAAAATGG - Intergenic
1136769553 16:32823822-32823844 AGATAGCTGAAACTACAAAATGG + Intergenic
1136798544 16:33047327-33047349 AGATAGCTGAAACTACAAAATGG - Intergenic
1136900935 16:34037151-34037173 AGATAGCTTAAACTACAAAATGG - Intergenic
1136935772 16:34462757-34462779 AGATAGCTGAAACTACAAAATGG + Intergenic
1136939822 16:34512598-34512620 AGATAGCTGAAACTACAAAATGG + Intergenic
1136945939 16:34651190-34651212 AGATACCTGAAACTACAAAATGG - Intergenic
1136948783 16:34689756-34689778 AGATACCTGAAACTACAAAATGG - Intergenic
1136956261 16:34790218-34790240 AGATAGCTGAAACTACAAAATGG - Intergenic
1136959997 16:34835968-34835990 AGATAGCTGAAACTACAAAATGG - Intergenic
1136964046 16:34885813-34885835 AGATAGCTGAAACTACAAAATGG - Intergenic
1136968183 16:34940401-34940423 AGATAGCTGAAACTACAAAATGG - Intergenic
1137088675 16:36161052-36161074 AGATAGCTTAAACTACAAAATGG - Intergenic
1137093193 16:36220278-36220300 AGATAGCTGAAACTACAAAATGG - Intergenic
1139204219 16:65010551-65010573 ACACAGCAGAGACTGCAAAAAGG + Intronic
1140917707 16:79508669-79508691 ATATAGCACAGACTACATAAAGG + Intergenic
1140940899 16:79720985-79721007 ACTTAGCACAGACTACATATGGG - Intergenic
1203071970 16_KI270728v1_random:1085927-1085949 AGATAGCTGAAACTACAAAATGG + Intergenic
1142523579 17:521909-521931 ACCTAGGAGAAACAACATCAAGG + Intronic
1144161331 17:12562339-12562361 ACATAAAAGGACCTACATAATGG - Intergenic
1144285024 17:13765724-13765746 AAATAGCAGAAACTGGCTAAGGG + Intergenic
1145692220 17:26754282-26754304 AGATAGCTGAAACTACAAAATGG - Intergenic
1145708956 17:26950901-26950923 AGATAGCCTAAACTACAAAATGG - Intergenic
1148321191 17:46754812-46754834 ACAAAGAAGAAACTATATGACGG + Intronic
1149073196 17:52568259-52568281 ACATAGCACTCCCTACATAAAGG + Intergenic
1150260953 17:63790288-63790310 ACATAACAGTTACTATATAAAGG + Intronic
1151739077 17:75966927-75966949 ACAAACCAGAAAGGACATAATGG + Intronic
1203183741 17_KI270729v1_random:91827-91849 AGATAGCTGAAACTACAAAATGG - Intergenic
1154166722 18:12020763-12020785 ACTTAGGAAAAATTACATAAAGG - Intronic
1154519305 18:15209808-15209830 AGATAGCTTAAACTACAAAATGG + Intergenic
1155288082 18:24312361-24312383 ACATTACAGAAATTAAATAATGG + Intronic
1155631488 18:27898815-27898837 ACATAGTAGAGGCTCCATAAAGG - Intergenic
1158718877 18:59905766-59905788 ACGGAGCAGAAACCACCTAAAGG + Intergenic
1159317152 18:66790658-66790680 TCAGAACAGAAACTACAGAATGG - Intergenic
1160546742 18:79662285-79662307 ACTTAGCAGAAAAGACAAAAAGG - Intergenic
1165125262 19:33590954-33590976 ACATTGTTGAAACGACATAAAGG + Intergenic
1202671869 1_KI270709v1_random:62367-62389 AGATAGCTGAAACTACAAAATGG - Intergenic
1202682208 1_KI270712v1_random:17139-17161 AGATAGCTGAAACTACAAAATGG - Intergenic
927093435 2:19729511-19729533 ACATAGCAGACAATAAATAGGGG - Intergenic
928859436 2:35839108-35839130 TCAAAGCAGAAACTTCAGAAAGG + Intergenic
929541126 2:42823093-42823115 ACATAACAGAAACTGCAGATGGG - Intergenic
929943425 2:46352438-46352460 ACACAGTAGAAACTTAATAATGG + Intronic
930217477 2:48711330-48711352 ATAGAACAGAAACTACATAAGGG + Intronic
930322264 2:49870944-49870966 ACATCTCAGAAACTCCATAAGGG - Intergenic
930433112 2:51305679-51305701 ACATTTGAGAAACTAAATAAAGG - Intergenic
934249562 2:90337944-90337966 AGATAGCTGAAACTACAAAATGG + Intergenic
934260015 2:91465508-91465530 AGATAGCTGAAACTACAAAATGG - Intergenic
934303318 2:91797427-91797449 AGATAGCTGAAACTACAAAATGG - Intergenic
934329942 2:92055328-92055350 AGATAGCTGAAACTACAAAATGG + Intergenic
934468165 2:94285242-94285264 AGATAGCTGAAACTACAAAATGG + Intergenic
935799950 2:106685857-106685879 ACAAAGGAGTAACTACATCAAGG + Intergenic
937797291 2:126038762-126038784 ACATAGCAGAAGGGAGATAAGGG + Intergenic
939065692 2:137481004-137481026 ACATGGCAGAAAAGACAAAAGGG - Intronic
940094755 2:149962179-149962201 ACAAAGTAGGAATTACATAATGG - Intergenic
940161476 2:150718344-150718366 TCATAGCCTAAACTACATAGTGG - Intergenic
940476937 2:154174652-154174674 ACATAGAAGAAAGGAAATAAAGG - Intronic
940630989 2:156238346-156238368 ACATAGAAGCATCTACCTAACGG - Intergenic
940702380 2:157061743-157061765 ATATAGCACAAACTAGGTAAGGG + Intergenic
940731316 2:157396032-157396054 AGATAAGAGAAAGTACATAAAGG - Intergenic
941118166 2:161495936-161495958 AACTAGCAGAAACTAAATATTGG - Intronic
941634972 2:167926699-167926721 ACATACCAGATACTGCAGAAAGG + Intergenic
941909537 2:170750040-170750062 ACTTGGAAGAAACTACATCAAGG + Intergenic
942819428 2:180094099-180094121 AGATAGCAGAACCTACTTGAAGG - Intergenic
943156961 2:184192908-184192930 CTAGAGCAGAAACTATATAAAGG - Intergenic
943257481 2:185614377-185614399 ACATAGAAAAAACTTCATTATGG - Intergenic
943682138 2:190779532-190779554 ACATAGCAGACACTGAACAAAGG + Intergenic
944526168 2:200622165-200622187 ACAAGGTAGAAAGTACATAAAGG - Intronic
944974721 2:205035728-205035750 ACATAGTAGAATATATATAATGG - Intronic
945526962 2:210900022-210900044 ACACAGGAGATACTACATCAGGG - Intergenic
947553180 2:231062976-231062998 ACAATGCAGATACTAAATAATGG - Intronic
948187484 2:236032877-236032899 ACATAGAAGATACTAGACAAGGG + Intronic
948363032 2:237436123-237436145 AAAGAGCAGAAACTAGATAAAGG - Intergenic
1169567651 20:6872983-6873005 ACAGAGGAGAAACTCCAAAATGG - Intergenic
1170076172 20:12421634-12421656 CCATAGGAGAAAGAACATAATGG - Intergenic
1171132060 20:22663175-22663197 ACAGAGAAGAAACTAGAGAAAGG - Intergenic
1171812637 20:29757594-29757616 AAATAGCAGACACTCCAAAAGGG + Intergenic
1171992232 20:31705550-31705572 ACACAGCAGAGACTTTATAAAGG + Intronic
1174560832 20:51429506-51429528 ACTTGGCAGAAATAACATAAAGG - Intronic
1175045933 20:56105834-56105856 ACAAAGCAGAGACTAAAGAAAGG - Intergenic
1175284147 20:57826513-57826535 ACATAGCAAAGACTACATCTTGG + Intergenic
1176585709 21:8583107-8583129 AGATAGCTGAAACTACAAAATGG - Intergenic
1176777698 21:13153927-13153949 AGATAGCTTAAACTACAAAAAGG - Intergenic
1178104330 21:29300672-29300694 ACGTAACAGAAACCACAAAAAGG - Intronic
1178779128 21:35583477-35583499 ACATAGCAGACACTGAACAAAGG - Intronic
1179238104 21:39565093-39565115 ACAAAGTAGAAACTATATCAAGG - Intronic
1179628841 21:42664488-42664510 ACAAAGCAGAAAGGGCATAAAGG + Intronic
1180268518 22:10560006-10560028 AGATAGCTGAAACTACAAAATGG - Intergenic
1180525292 22:16253281-16253303 AGATAGCTGAAACTACAAAATGG - Intergenic
1181865674 22:25852893-25852915 ACAATGCAGAAAATACATAGGGG + Intronic
1182172137 22:28242074-28242096 ACATAGCAGAAACTATTTCGGGG + Intronic
1203237576 22_KI270732v1_random:20448-20470 AGATAGCTTAAACTACAAAATGG - Intergenic
1203290224 22_KI270735v1_random:29630-29652 AGATAGCCTAAACTACAAAATGG + Intergenic
1203323073 22_KI270737v1_random:87637-87659 AGATAGCTGAAACTACAAAATGG + Intergenic
949101405 3:150294-150316 ACATAGTAGATACTCAATAAAGG - Intergenic
950971135 3:17189156-17189178 ACAGAGCAGACACTCAATAAAGG + Intronic
952730264 3:36631072-36631094 ACACAGCAGAAGCTACTTGAAGG - Intergenic
954213383 3:49110921-49110943 ACAGAGCAGCAAGTAGATAAGGG - Intronic
955887384 3:63615019-63615041 ACATGTCAGGCACTACATAAAGG - Intronic
956645216 3:71448458-71448480 ACATAGCAAAGACTACACAGTGG + Intronic
956876627 3:73470383-73470405 ACATAGCACAGACTTCATGAAGG - Intronic
957215150 3:77310868-77310890 AAAGAACAGAAACTCCATAATGG + Intronic
957416893 3:79917220-79917242 ACATAGCAGATATTTCTTAATGG - Intergenic
957431348 3:80112214-80112236 ATATAGCAGAAACGTCATGACGG + Intergenic
957580852 3:82071147-82071169 ACATAATTTAAACTACATAAAGG - Intergenic
958889333 3:99766145-99766167 AATTAGCAGAAACTCAATAAAGG - Intronic
959164613 3:102760296-102760318 ACATAGCAGAAAGGACAACAGGG - Intergenic
959658312 3:108835776-108835798 AAATAGAAGCAACTATATAAAGG - Intronic
959786640 3:110306805-110306827 ACAAAGCAGAAAGTAAATCACGG + Intergenic
961088230 3:124088557-124088579 ACATAGTGGATACTTCATAAAGG - Intronic
962716758 3:138133180-138133202 ACATAGCAGGTCCTACATGAAGG + Intergenic
962927820 3:140011595-140011617 ACATAGCATATACTTAATAAGGG + Intronic
963795084 3:149623879-149623901 ACATTGCCAAAACTACATGAAGG - Intronic
964404332 3:156332799-156332821 ACATAGCACTAAGTACTTAAGGG - Intronic
966006415 3:175018861-175018883 ACATAGAAAAAACAGCATAAAGG + Intronic
968379289 4:75672-75694 ACAAAACAGAAACTACTAAATGG - Intronic
969137448 4:5041944-5041966 ATATAGCAGACTCTACAAAATGG + Intergenic
970258623 4:14198707-14198729 ACATGGCAGAGACGAGATAAAGG - Intergenic
970745734 4:19293073-19293095 ACAAAGAAGATATTACATAATGG - Intergenic
971956237 4:33422846-33422868 ACATTGCAGAAACTCGATACGGG - Intergenic
972589709 4:40472845-40472867 ACATGGCAAAAACTATAAAAGGG - Intronic
972787127 4:42336786-42336808 TCTGAGCAGAAACTACATAGCGG + Intergenic
974870967 4:67641243-67641265 ATATGGCTGAAATTACATAATGG + Intronic
976396174 4:84557987-84558009 AAAGAGCAGAACCTACAAAAAGG + Intergenic
977139964 4:93357508-93357530 CCAGAGCAGAAACTATAAAAAGG - Intronic
977611347 4:99035454-99035476 ACATAGCAGAGCTTACCTAAGGG - Exonic
977827532 4:101551557-101551579 ACATAACAGATCCTCCATAATGG - Intronic
978275409 4:106943226-106943248 ACAGAGCATAATCTACATCATGG - Intronic
978827797 4:113045811-113045833 AGATATCAGAAAGTACATAAAGG + Intronic
979597806 4:122554060-122554082 ACAGAGCAGAGATAACATAATGG - Intergenic
980169556 4:129272737-129272759 AAATATGTGAAACTACATAAAGG - Intergenic
983329045 4:166301042-166301064 ACAAAGCAAAAATTAAATAAAGG + Intergenic
983679518 4:170336550-170336572 ACACAGAACAATCTACATAACGG - Intergenic
984287025 4:177743807-177743829 ACATAACACAAACTAAATAATGG + Intronic
986416937 5:7538125-7538147 ACATAGCAGATACTGCTTACTGG + Intronic
987812649 5:22857927-22857949 ACATAGCAGAAAATAGAGATTGG + Intergenic
988980820 5:36566996-36567018 AGACAACAGAAACTACAGAAAGG - Intergenic
989331463 5:40264173-40264195 ACATATTACAAACTACATAATGG - Intergenic
989896866 5:47100980-47101002 ACGCATCAGAAACTAGATAAGGG + Intergenic
990055159 5:51566505-51566527 GAGTAGCAAAAACTACATAATGG + Intergenic
990761068 5:59129942-59129964 ACATAGGAGAAACTCAATCAAGG + Intronic
991022224 5:61991662-61991684 ACATAACAGCACCTACATCACGG + Intergenic
992345510 5:75872437-75872459 AAACAGCAGAAACAACATAGCGG + Intergenic
995343118 5:111082497-111082519 ACATAGCAGAAATGACAGAAAGG - Intergenic
995629500 5:114117956-114117978 ACATATCACAAAGTTCATAAGGG + Intergenic
997244136 5:132331829-132331851 CCATAGCAGCAAAGACATAATGG - Exonic
997581750 5:135021924-135021946 ACATAGTAGACGCTAGATAAAGG + Intergenic
998209250 5:140181795-140181817 ACATAGCAAAAAATACAGACGGG - Intronic
998673765 5:144383796-144383818 ACATAACTGAAACCAAATAAAGG - Intronic
998932332 5:147194948-147194970 ACATGGCAGAAAGGACAGAAGGG + Intergenic
1001920779 5:175597698-175597720 ACATGGCAAATACTACATGATGG + Intergenic
1002665354 5:180819777-180819799 ACATAGCAGAACTTAAATACTGG + Intergenic
1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG + Intergenic
1005129438 6:22488328-22488350 ATATAGAAGAAAGTAGATAATGG - Intergenic
1005214868 6:23513524-23513546 ACATAGCACTAACTACATAGTGG - Intergenic
1005281474 6:24279139-24279161 ACATAGCAGCCACTACATTGGGG + Intronic
1005598615 6:27404404-27404426 TCATAGCAGAAAGTCCAGAAAGG + Intergenic
1005646592 6:27845218-27845240 TCATTGCAGAAACTACATAGAGG + Intronic
1006235071 6:32622886-32622908 ACATATTAGAAACTACATTGTGG - Intergenic
1006348252 6:33501000-33501022 ACAGAGCAGAAACTGCAAAAGGG + Intergenic
1008307506 6:49921531-49921553 AAATAGCAAAGACTAAATAATGG + Intergenic
1010009179 6:71030347-71030369 ACATTGCTGAAACCACCTAAGGG - Intergenic
1010493847 6:76508439-76508461 ACATAGTAAAATCTACAAAATGG + Intergenic
1011503397 6:88014905-88014927 ATATAACTGAAACTAAATAATGG - Intergenic
1014624578 6:123710102-123710124 ACATGGCAGAAACTGAATACTGG + Intergenic
1014757510 6:125318061-125318083 GTATAGCAGAACCTTCATAATGG + Intergenic
1014797327 6:125740925-125740947 ACATAGCAAGCACTAGATAAAGG + Intergenic
1015985399 6:138879590-138879612 ACATAGCACACACAACATCAGGG + Intronic
1016063107 6:139650711-139650733 ACATACCAGAAACTGTCTAAGGG - Intergenic
1016140274 6:140600041-140600063 ACATTGCAGAGCCTACAGAATGG - Intergenic
1016603808 6:145894473-145894495 AAACAGTAGAAAATACATAATGG + Intronic
1016676759 6:146779339-146779361 ACATACCAGCATGTACATAATGG + Intronic
1017697646 6:157033853-157033875 ACAAAGTAGAAACTTCCTAAAGG - Intronic
1020982738 7:15092020-15092042 CCATAGCAGAAACTAATTTAGGG + Intergenic
1021586505 7:22214481-22214503 ACAAAGCATAAACTACATTTCGG + Intronic
1023311221 7:38888423-38888445 ACAAAGCAGGTATTACATAATGG + Intronic
1024245715 7:47468483-47468505 AAATAGCAGTAACTACTGAAGGG - Intronic
1024805407 7:53133534-53133556 AGATAGCTTAAACTACAAAATGG + Intergenic
1025321487 7:58098905-58098927 AGACAGCTGAAACTACAAAATGG - Intergenic
1025488258 7:61078812-61078834 AGATAGCTGACACTACAAAATGG + Intergenic
1025551310 7:62253312-62253334 AGATAGCTGACACTACAAAATGG + Intergenic
1025556931 7:62320761-62320783 AGATAGCTGACACTACAAAATGG + Intergenic
1026448803 7:70509251-70509273 CCATAGCAGAAGCTCCATGAGGG - Intronic
1027743276 7:82040100-82040122 ACCTAGCTGAAAATACATAGTGG + Intronic
1027817652 7:82997387-82997409 ACATAGCAGAAAGATTATAATGG - Intronic
1028620796 7:92826289-92826311 ACATAACAGAAATAATATAAGGG + Intronic
1029289825 7:99493821-99493843 AGACATCAGAGACTACATAAAGG - Exonic
1030509167 7:110462459-110462481 AAATAGGATAAACTACTTAAAGG - Intergenic
1032565917 7:132943148-132943170 ACATTCCAGATACTGCATAAAGG + Intronic
1033605704 7:142926954-142926976 ACAAAACAGAAACTACATCTTGG + Intronic
1033782665 7:144691447-144691469 ACATACCAGAACCTACTTGAGGG + Intronic
1033942552 7:146673972-146673994 TCATAACAGTAAGTACATAAAGG - Intronic
1033983030 7:147189501-147189523 ACATATCAGAAACAACTAAATGG + Intronic
1034328347 7:150258600-150258622 ACATTGCAGAAACCCAATAAGGG - Intronic
1034764867 7:153710864-153710886 ACATTGCAGAAACCCAATAAGGG + Intergenic
1035812318 8:2503210-2503232 ACAGAGTAGAAACTCCATAAAGG - Intergenic
1036686535 8:10915174-10915196 ACAAAGCAGAAGCTCCACAAGGG + Intronic
1037086394 8:14856232-14856254 AAATAGAAGAATCTACATACTGG + Intronic
1037728231 8:21501768-21501790 CCATAGCAGAAACTACGAAGAGG - Intergenic
1037897554 8:22668301-22668323 TCATAGTAGACACTTCATAATGG - Intronic
1038166522 8:25090229-25090251 ACATAGCAAAAAATAAATTAAGG + Intergenic
1038235657 8:25751524-25751546 ACATAGAAGGAACTGCTTAAAGG + Intergenic
1038252218 8:25915795-25915817 ACAGAGCAGGATCTCCATAATGG + Intronic
1038748950 8:30278619-30278641 AAATAGCAGAAAAAACAAAAAGG - Intergenic
1038930084 8:32183938-32183960 ACACAACTGAAACTACACAAGGG - Intronic
1040770505 8:50969826-50969848 ACATAGCAGTAACCACTTACAGG - Intergenic
1041007255 8:53507726-53507748 ACAGAGAAGAAACTGCACAAGGG - Intergenic
1041300209 8:56403711-56403733 ACATGGCAGAAAAGACAGAAAGG - Intergenic
1042030568 8:64471395-64471417 ATATAGCAGTAACTCAATAAGGG - Intergenic
1042512152 8:69623505-69623527 ACATAGCAAAAGCTCAATAAAGG + Intronic
1042548189 8:69969926-69969948 ACATTGTTGAAACAACATAAAGG + Intergenic
1044374092 8:91448891-91448913 AAATAACACAAATTACATAAGGG - Intergenic
1045162458 8:99563733-99563755 ACATAACAGATACCAAATAAAGG + Intronic
1045827077 8:106410959-106410981 ACCTAGCAGAAACTCAATAATGG - Intronic
1046210004 8:111059661-111059683 ACTTAGCAGAAATTATATAATGG + Intergenic
1048099897 8:131339633-131339655 AGAGAGAAGAAACTAAATAAGGG + Intergenic
1049196162 8:141316823-141316845 ACATAGCAATAAATACATAGTGG + Intergenic
1050494634 9:6228123-6228145 ACATAGTAAACACTATATAAGGG + Intronic
1053291511 9:36882483-36882505 ACATAGCAGAAACAACAGTGTGG - Intronic
1053698576 9:40663266-40663288 AGATAGCTGAAACTACAAAATGG + Intergenic
1053944578 9:43293502-43293524 AGATACCTGAAACTACAAAATGG + Intergenic
1054309865 9:63462667-63462689 AGATAGCTGAAACTACAAAATGG + Intergenic
1054408653 9:64786819-64786841 AGATAGCTGAAACTACAAAATGG + Intergenic
1054441809 9:65270633-65270655 AGATAGCTGAAACTACAAAATGG + Intergenic
1054488475 9:65750864-65750886 AGATAGCTGAAACTACAAAATGG - Intergenic
1056733895 9:89188644-89188666 AGATAGCAGACACTCCAGAAAGG + Intergenic
1060862976 9:126971068-126971090 ACATAACAGAAAATGCCTAAGGG + Intronic
1061703697 9:132435895-132435917 ACTTAGCAGAATCTACATAAAGG - Intronic
1202780940 9_KI270717v1_random:36473-36495 AGATAGCTGAAACTACAAAATGG + Intergenic
1203363617 Un_KI270442v1:238600-238622 AAATAGCAGACACTCCAAAAGGG + Intergenic
1203581595 Un_KI270746v1:11611-11633 AGATAGCTGAAACTACAAAATGG - Intergenic
1203587713 Un_KI270747v1:22080-22102 AGATACCTGAAACTACAAAATGG + Intergenic
1203615611 Un_KI270749v1:60629-60651 AGATAGCTGAAACTACAAAATGG - Intergenic
1186870878 X:13770612-13770634 GCAAAGCAGAAACAAAATAAGGG - Intergenic
1187578748 X:20586132-20586154 ACAGAGCAGATAATAGATAAAGG + Intergenic
1188187839 X:27137534-27137556 ACATCACAGAAACCAAATAACGG - Intergenic
1188249907 X:27880019-27880041 ACATAGCAGAAGGGACAGAAGGG + Intergenic
1192425775 X:71074949-71074971 ACACTGTAGAAACTCCATAAAGG - Intergenic
1194974015 X:100375029-100375051 ACATAGCAGGAGCTCCAGAAAGG + Intronic
1194981508 X:100445783-100445805 AAATACAAGCAACTACATAAAGG + Intergenic
1195437608 X:104863404-104863426 ACATAGCAGATATAACATAATGG - Intronic
1195529747 X:105940385-105940407 ATATAGCTGAAGCTATATAAAGG - Intronic
1196356394 X:114798682-114798704 ACATTGCAGAGAAAACATAATGG - Intronic
1197251147 X:124217653-124217675 CCACAGCAGAAACCACACAATGG - Intronic
1198023886 X:132685899-132685921 ACATAGCAGAACTGACATAATGG - Intronic
1198093901 X:133359183-133359205 ATATAGCAAAAACTATGTAATGG - Intronic
1200873780 Y:8130394-8130416 ACATAGCAGAAAGTACATTTTGG + Intergenic
1201849372 Y:18461173-18461195 AAATAGCATAAATTACACAAGGG - Intergenic
1201883946 Y:18859202-18859224 AAATAGCATAAATTACACAAGGG + Intergenic