ID: 1080325427

View in Genome Browser
Species Human (GRCh38)
Location 11:31066525-31066547
Sequence CTAAGGTACTTACATTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080325427 Original CRISPR CTAAGGTACTTACATTGTTC TGG Intronic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
907089174 1:51708865-51708887 TTAAGTTTCTTACATTGTTTGGG - Intronic
907315126 1:53564229-53564251 CTAAGGTTCTTGTATTGTTGGGG + Intronic
907395219 1:54185057-54185079 TTAAGTTACTTCCATGGTTCAGG - Intronic
908314729 1:62921564-62921586 CTAATGTCCATACTTTGTTCAGG + Intergenic
916821902 1:168407653-168407675 CTAAGGTCTTTACATTGTCTAGG + Intergenic
921975065 1:221193067-221193089 CTAAGATACTTTCATGTTTCAGG + Intergenic
922407013 1:225324872-225324894 CTGAGATAATTACATTGTCCTGG - Intronic
923067761 1:230535477-230535499 CTAAGGTCTTTGCATTGTCCAGG + Intergenic
924316012 1:242797411-242797433 CTCAGGTTCCTACATTGTTGAGG - Intergenic
1068603669 10:58981629-58981651 CTATTGTTCTTACAATGTTCAGG - Intergenic
1068815672 10:61308622-61308644 CTAAGATCCTTACATTACTCAGG - Intergenic
1070151354 10:73807159-73807181 CTAAGGTCCTGAGTTTGTTCTGG + Exonic
1072030565 10:91518009-91518031 CTAGGCTACTTACAGTATTCAGG - Intergenic
1072401278 10:95104624-95104646 CTCATGTAGTTACATTCTTCTGG + Intergenic
1079326494 11:19497283-19497305 ATACGGCACTTACAATGTTCTGG - Intronic
1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG + Intronic
1080325427 11:31066525-31066547 CTAAGGTACTTACATTGTTCTGG + Intronic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1087979044 11:104587911-104587933 GTAAGGTCCTTGCATTGTCCAGG + Intergenic
1088252806 11:107876190-107876212 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1093285839 12:17261479-17261501 CTTAGGTATTAAAATTGTTCTGG - Intergenic
1095381530 12:41599974-41599996 CTAAGTTCCTTTCATTGTTTGGG - Intergenic
1097283030 12:57857110-57857132 CTAAAGTACATAAATTGTTTTGG - Intergenic
1099674593 12:85742590-85742612 CTACTGTACCTACGTTGTTCTGG - Intergenic
1101047706 12:100827327-100827349 CTAATGTCCTTACTTTCTTCAGG + Intronic
1105402375 13:20106856-20106878 CTGAGGCACTTTCATTGTGCTGG - Intergenic
1109685637 13:65816136-65816158 ATAAGATTTTTACATTGTTCAGG - Intergenic
1110539454 13:76691365-76691387 CTAAAGTTCTAACAATGTTCAGG + Intergenic
1110602620 13:77393045-77393067 CTGATGTCCTGACATTGTTCAGG - Intergenic
1111394532 13:87648176-87648198 CTAAGAATCTTACATTCTTCTGG + Intergenic
1113294123 13:108939026-108939048 CTGAGGTACTTTCACAGTTCTGG + Intronic
1114472350 14:22972564-22972586 CTCAGGAACTTACATGGGTCTGG - Exonic
1114704678 14:24713259-24713281 CTAGAGGACTTACATTCTTCTGG + Intergenic
1121995777 14:98601908-98601930 CTCAGGCAGTTACATTGTGCAGG - Intergenic
1123662896 15:22580796-22580818 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1124261389 15:28195126-28195148 CTAAGGTTTTTGCATTGTTTAGG + Intronic
1124316697 15:28675100-28675122 CTAAGGTCTTTGCATTGTTTAGG - Intergenic
1127721446 15:61704672-61704694 CTTAAGTTCTTATATTGTTCTGG + Intergenic
1129497755 15:76002218-76002240 AGAAGATACTTGCATTGTTCAGG + Intronic
1129662947 15:77563297-77563319 CTAAGGTTCTTGCATTCTTGAGG + Intergenic
1132124995 15:99215343-99215365 CAAAGGTCCTTGCATTGTTCAGG + Intronic
1141837858 16:86554627-86554649 TTAAGGTACTGACATATTTCTGG - Exonic
1143394622 17:6582837-6582859 CTAAGGTTCTTGCATTGTATGGG - Intronic
1149025298 17:52020244-52020266 CTAAGAAGCTTGCATTGTTCAGG - Intronic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1158958044 18:62560970-62560992 CTAAGGTCCTCAAATTGTTTGGG - Intronic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
925168133 2:1731819-1731841 CTGAGGTTCTGCCATTGTTCAGG + Intronic
927659544 2:24981205-24981227 CTAAGGTTCTTACATTGCTTAGG - Intergenic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
937020384 2:118645431-118645453 CTCAGGTAATTCCATTGTTTAGG - Intergenic
941077709 2:161024823-161024845 TTAAGGTATGTACATTTTTCAGG + Intergenic
942435215 2:175964359-175964381 CTAAGTTATTTACCTTGTCCAGG + Exonic
942480203 2:176378805-176378827 GTAAGGTCCTTACATTATTCAGG - Intergenic
943334641 2:186599121-186599143 CTAAGTCACTTAAATTATTCTGG - Intronic
946004780 2:216514552-216514574 CGAAGGTTCTTGCATTGTTCTGG + Intronic
948666961 2:239541897-239541919 CTCAGCTCCTTAAATTGTTCAGG - Intergenic
1169168602 20:3445275-3445297 CTAAGGTCCTTGCATTGCCCAGG + Intergenic
1182017565 22:27053412-27053434 TTAAGATACTTACATTGTAGTGG - Intergenic
1182975265 22:34618131-34618153 CTAAGGTCCTTACGATTTTCAGG + Intergenic
1183042014 22:35188415-35188437 CTAAGGCTCTTGCTTTGTTCAGG + Intergenic
1183595760 22:38809512-38809534 CTAATGTCCTTACATTGTCCTGG - Intergenic
1183651198 22:39154202-39154224 CTAAGATCCTTATATTCTTCAGG + Intergenic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
950797737 3:15523964-15523986 CAAAGTAACTTACATTGTTGAGG - Intergenic
953541925 3:43828031-43828053 CTAAGGTCCTTCTGTTGTTCTGG + Intergenic
955164279 3:56495398-56495420 TTAAGGTATGTACATTTTTCCGG - Intergenic
955480489 3:59384939-59384961 CTCAGGTACTTACAATGTAGAGG + Intergenic
955845485 3:63158564-63158586 ATATGATACTTACATTTTTCAGG + Intergenic
960633403 3:119756637-119756659 CTAAGGCACTTGCATTGTTTAGG + Intronic
962459956 3:135601872-135601894 CTAAGGTCCTTGCATTATTTTGG + Intergenic
963081239 3:141395888-141395910 CTAAGGTATATACATTTTTAAGG - Intronic
970583739 4:17495630-17495652 CTGTGGAACTTACATTCTTCTGG - Intronic
971086655 4:23285029-23285051 CTAAGGTCCTTATGTTATTCAGG - Intergenic
972360420 4:38321284-38321306 ATAAGGAACTTACAATCTTCTGG + Intergenic
974650925 4:64753407-64753429 CTATGGTACTGACATTGATACGG - Intergenic
979265511 4:118697866-118697888 CTAATCTATTTATATTGTTCAGG - Intronic
981593587 4:146393018-146393040 CTTAGGAAATTCCATTGTTCAGG + Intronic
982390206 4:154855632-154855654 CTAAAGTACCTTCATTGTTCAGG + Intergenic
982587559 4:157261739-157261761 TTTGGGTATTTACATTGTTCTGG + Intronic
983707089 4:170675248-170675270 TTCAGGTACTCACATTGGTCAGG + Intergenic
984138456 4:175971759-175971781 CTATCGTACTTTCATTTTTCTGG - Intronic
988247199 5:28701985-28702007 CTAAGGTACTTCCTTTCTTCTGG + Intergenic
990002903 5:50915387-50915409 TTAAGGTACATACATTTTTTAGG - Intergenic
991340713 5:65605476-65605498 CTGGGGTACTGACAATGTTCTGG + Intronic
992344854 5:75866353-75866375 ATTGGGTACTTACAGTGTTCTGG + Intergenic
993468302 5:88274522-88274544 CGCAGGTCCTTACATTGTCCTGG - Intergenic
993486272 5:88490565-88490587 CTAATATATTTCCATTGTTCAGG - Intergenic
994572978 5:101537444-101537466 CTATGGTACTTACATTATTGTGG + Intergenic
995172819 5:109137451-109137473 CTAAGGCACTAACCTTGGTCTGG + Intronic
995739431 5:115339594-115339616 CTAAGGGAATGACATTCTTCTGG + Intergenic
996588061 5:125113309-125113331 CTAGAGTACTTCCATTGATCAGG - Intergenic
997165947 5:131660306-131660328 CTAAGGCACAGACATTATTCTGG + Intronic
997641882 5:135454744-135454766 CCAAGGTCCTTGCATTGTCCAGG + Intergenic
1001152131 5:169240960-169240982 CTAAGATCCTTAAATTATTCAGG - Intronic
1001302456 5:170544796-170544818 GTAAAGTTCTTGCATTGTTCAGG - Intronic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1005603462 6:27450853-27450875 CTAATGCATTTACATTGTTTAGG - Exonic
1008134046 6:47752637-47752659 CCAAGGTACTAACATCCTTCAGG - Intergenic
1008905846 6:56677038-56677060 CTTCAGTACTTACATTTTTCAGG - Intronic
1009315868 6:62220572-62220594 CTAAGGTACTTATATTGATCAGG + Intronic
1010747083 6:79576080-79576102 TTAAGGTCCTTGCATTGTTTAGG - Intergenic
1016153734 6:140777545-140777567 CTAAGTTGCTTACATTGCCCAGG + Intergenic
1016950504 6:149574919-149574941 CTAAGGTTCTTGCATTGTTTGGG - Intronic
1019864551 7:3694534-3694556 CTCTGGCACTTACATTGGTCTGG + Intronic
1022264356 7:28739578-28739600 CTAAAGAACTTACATTTTTATGG + Intronic
1023170855 7:37389031-37389053 CTGAAGTGCTTACATTTTTCCGG + Intronic
1023912651 7:44566669-44566691 CTAAGGTGCTCACATTCTCCTGG - Intronic
1023948924 7:44825702-44825724 CGATGGCACTTACATTCTTCTGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1029288332 7:99482273-99482295 CAAAGGTATGAACATTGTTCAGG + Intronic
1029288524 7:99483849-99483871 CAAAGGTATGAACATTGTTCAGG + Intronic
1029796458 7:102899696-102899718 CAAATGTACTTACATTGTACTGG - Intronic
1031461437 7:122054029-122054051 CTAAGGGACTTACCATGTTTTGG - Exonic
1031815147 7:126424275-126424297 TTAAGTTACGTACATTGTTTTGG - Intergenic
1032009181 7:128330989-128331011 CTAACTCACTTACATTGTCCTGG - Intronic
1032223573 7:130012186-130012208 ATAAGTTAATTACTTTGTTCAGG - Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1036196318 8:6718894-6718916 CTAAGGTACTTGCTGTGTTTAGG - Intronic
1036816198 8:11904807-11904829 CTATGGGACTTACATTTTACTGG + Intergenic
1038031187 8:23642234-23642256 CTAAGGTTCTTATATTGATGTGG - Intergenic
1040433727 8:47369138-47369160 CTAAGATTCTCACATTGTGCAGG + Intronic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045588894 8:103570566-103570588 CTAAGGTACTCTCAGTGTGCTGG - Intronic
1047116770 8:121851257-121851279 TTAAGGTATTAACATTGTTTGGG + Intergenic
1048081933 8:131138008-131138030 CTGAGGTACTGACATTGTCCTGG + Intergenic
1049245674 8:141561048-141561070 CTCAGCTTCTTTCATTGTTCTGG + Intergenic
1050129482 9:2396602-2396624 CTCAGCTACTGGCATTGTTCAGG - Intergenic
1051189458 9:14496053-14496075 CTAAAGTGCTTACTTAGTTCAGG + Intergenic
1055158531 9:73095628-73095650 CTATGGTAGCTCCATTGTTCTGG + Intergenic
1055644655 9:78351528-78351550 TTAAGGTTGTTGCATTGTTCTGG + Intergenic
1055773290 9:79740294-79740316 GTAAGGGATTTACATTGTTTGGG - Intergenic
1060958879 9:127664795-127664817 CAAAGGTTCTCACATTGTTCTGG + Intronic
1185839675 X:3376904-3376926 CTAAGGTCCTTAAAATGTTGCGG - Intergenic
1186587155 X:10887444-10887466 CTAAGGTGCTAATATTGTGCTGG - Intergenic
1187609494 X:20926425-20926447 CTAAGGTCCTTACATTATTTGGG + Intergenic
1187754438 X:22506172-22506194 ATAAGGTCCTTCCATTATTCAGG - Intergenic
1188314027 X:28651811-28651833 CTAAAGTACTTACATTGCAGAGG - Intronic
1189521310 X:41771575-41771597 CTACAGTACTTGCACTGTTCAGG + Intronic
1193798438 X:85905996-85906018 CTAAGGAACTTACAGTCTACTGG - Intronic
1195109087 X:101627663-101627685 GCAAAGTACTTACAATGTTCTGG + Exonic
1195481181 X:105347328-105347350 GAAAGTTAATTACATTGTTCAGG - Intronic
1196032664 X:111108020-111108042 CTAAGGTACTTTCATTTGTGTGG + Intronic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic