ID: 1080325658

View in Genome Browser
Species Human (GRCh38)
Location 11:31069882-31069904
Sequence CAGAATGTTCAGCCACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080325658 Original CRISPR CAGAATGTTCAGCCACATCA TGG (reversed) Intronic
901548729 1:9979175-9979197 CAAAATGTTCAGGCTGATCATGG + Intronic
902107084 1:14046884-14046906 CAGAATTTTCATCCCTATCAGGG + Intergenic
902822526 1:18951886-18951908 CAGAAAGATCAGCCACAACACGG + Intronic
904135476 1:28308975-28308997 CACCATGTTCAGCCACTGCATGG - Intergenic
908497130 1:64705783-64705805 CTGAATGGCCAGCCACACCAAGG + Intergenic
910713560 1:90206033-90206055 CTGTAGGTACAGCCACATCATGG + Intergenic
915097579 1:153474290-153474312 CTGCATTTTCAGCCACACCAAGG + Intergenic
915217218 1:154348435-154348457 CACAATGGTCAGCCACACCGTGG - Exonic
916681997 1:167113398-167113420 AAGAAAGTGAAGCCACATCAGGG + Intronic
918101135 1:181375805-181375827 CAGAAAACTCAGCCTCATCAAGG - Intergenic
918324337 1:183395313-183395335 CTTGATGTGCAGCCACATCAAGG + Intronic
921568662 1:216751864-216751886 CAGAGAGCTCAGCCACAGCATGG - Intronic
922578679 1:226680848-226680870 GAAAATGTTCAGCCCCATCCTGG + Intronic
923001736 1:230011764-230011786 CAGAATACTCAGCCTCATCTGGG - Intergenic
924113912 1:240726989-240727011 CAGGAAGATCAGCCAAATCAAGG - Intergenic
1065781177 10:29169223-29169245 CAGAGGGTTCAGCCACACAAAGG - Intergenic
1066157512 10:32693839-32693861 CAGAATGCTATGCCATATCAGGG - Intronic
1068062992 10:52092826-52092848 CAGAATGTTGAGCCAAATTGTGG + Intronic
1068589372 10:58837949-58837971 CAGATGGTTCTGCCGCATCATGG + Intergenic
1069541644 10:69298717-69298739 CAGACTATTCAGCTACATCATGG + Intronic
1072822763 10:98574550-98574572 CAGATTCTTCAGCAGCATCAGGG - Intronic
1073668196 10:105556998-105557020 CAGAATATTTAACCAAATCAGGG - Intergenic
1074062141 10:109976342-109976364 TGGAATGTACAGCCAAATCATGG + Intergenic
1076716500 10:132366877-132366899 CAGGATGTGGAGCCACTTCATGG + Intronic
1077916527 11:6615227-6615249 CAGAAAGTGCAGCCACATCTGGG + Exonic
1080325658 11:31069882-31069904 CAGAATGTTCAGCCACATCATGG - Intronic
1080325817 11:31071632-31071654 CAGAGTATTCAGTCACATCATGG + Intronic
1080636177 11:34125637-34125659 CAGAATGTACATCCTCAACAGGG - Intronic
1082240104 11:49860327-49860349 CAGACTGTACAACCACAACATGG + Intergenic
1085113219 11:73907311-73907333 AAGAATGTTCAGCCACCTACTGG + Intronic
1086124319 11:83334311-83334333 GATAGTGTTCACCCACATCATGG - Intergenic
1087216518 11:95501235-95501257 CAGCATGTTCACCCTCATTATGG - Intergenic
1090164363 11:124531754-124531776 CTGAGAGTTCAGCCAAATCAGGG - Intergenic
1090497733 11:127231003-127231025 CTGAATATTGAGCAACATCATGG + Intergenic
1091951499 12:4596603-4596625 CAGGATCTTCAGCTCCATCAGGG - Exonic
1101406752 12:104435441-104435463 CAGGGGGTTCAGCCACATTACGG + Intergenic
1102245652 12:111354009-111354031 CAGAATGACCAACCACATCAAGG - Intergenic
1102886829 12:116528521-116528543 CAGAATCCTCAGCCACTGCATGG - Intergenic
1104211316 12:126691517-126691539 CAGAATTTATAGCCACAACAGGG - Intergenic
1108082845 13:46755172-46755194 CTGAATGCTAAGTCACATCAAGG + Intergenic
1108756953 13:53514573-53514595 CTGAATGTACAAACACATCAGGG - Intergenic
1114874929 14:26704654-26704676 CAGAATTTTGAGCCCTATCAAGG + Intergenic
1115483770 14:33888476-33888498 CTGAATGTTGAGCCACAGAATGG - Intergenic
1116760572 14:49007894-49007916 CATAATGATCTGCCACATCCAGG - Intergenic
1126536759 15:49774698-49774720 AAGAATGTTCAGTAACGTCATGG - Intergenic
1129750440 15:78059114-78059136 CAAAATGTACACCCAGATCAGGG - Intronic
1130801611 15:87269826-87269848 CAGATTGCTAAGCTACATCATGG + Intergenic
1131902355 15:97102231-97102253 CAAAATATTCAGTTACATCATGG + Intergenic
1134050033 16:11131090-11131112 CAGAATGTTCAGCTTCACGAGGG + Intronic
1137496478 16:48973033-48973055 CAGAAGGCTCTGCCACATCCAGG - Intergenic
1138067109 16:53953791-53953813 CAGCATTTTCTGCCACATAATGG - Intronic
1203012032 16_KI270728v1_random:303249-303271 CAAAATGTTCATTCACAGCATGG - Intergenic
1203030367 16_KI270728v1_random:576408-576430 CAAAATGTTCATTCACAGCATGG - Intergenic
1203041354 16_KI270728v1_random:758023-758045 CAAAATGTTCATTCACAGCATGG + Intergenic
1144083195 17:11783330-11783352 GAGAGTGGTCAACCACATCAAGG - Intronic
1146840789 17:36152781-36152803 CAGTGTGTTCAGCCACAAGAGGG + Intergenic
1149726811 17:58903342-58903364 AAAAATGTTCAGCAACACCAGGG - Intronic
1149858737 17:60108187-60108209 CAGTGTGTTCAGCCACAAGAGGG - Intergenic
1150103103 17:62441290-62441312 CCCAATGTTGAGCCACAACAAGG - Intronic
1151147711 17:72056914-72056936 TAGAAAGTTCATCCACATGAAGG - Intergenic
1153656214 18:7284817-7284839 CAGCATGAACAGTCACATCATGG + Intergenic
1153762247 18:8342524-8342546 AAAAATGTTCAGGCACATCCAGG - Intronic
1157159906 18:45304530-45304552 CAGACTTTTCTGCCACTTCATGG + Intronic
1160630631 18:80244929-80244951 CAGCAAGTTCAGCCCCATCACGG + Intronic
1164969162 19:32516128-32516150 CATAGGGGTCAGCCACATCAGGG - Intergenic
1165043564 19:33086076-33086098 CAGGATGTTCAGCAGCATCCTGG - Intronic
925152727 2:1626418-1626440 CAGAGTGTGCGGCCACAACACGG + Intergenic
925465719 2:4106022-4106044 CAGTGGGCTCAGCCACATCAAGG - Intergenic
926307887 2:11652585-11652607 CAGAATCTTAAGCCAGATCTAGG - Intergenic
927476021 2:23414657-23414679 CAGAATGAGAAGCCCCATCATGG - Intronic
928868849 2:35950849-35950871 CTGACTGTTCAGTCACATTATGG - Intergenic
929127593 2:38535589-38535611 CAGAAGGTGCAGCCGCATCAGGG - Intergenic
931485966 2:62692058-62692080 CAGAAAGTTCAGGCACATGAAGG - Intronic
931744368 2:65279105-65279127 CTGGATGTTTAGACACATCAAGG + Intergenic
936618312 2:114070762-114070784 AATACTGTTCAGCCCCATCAAGG - Intergenic
937494475 2:122403196-122403218 CAGAATGTTTAGCAGCATCCTGG + Intergenic
939535294 2:143420582-143420604 CAGAGGCTTCAGCTACATCAAGG - Intronic
939857256 2:147374223-147374245 AAGAATGGTTAGCAACATCAGGG - Intergenic
942137532 2:172942642-172942664 CAGAATGCTCTGTCACAGCATGG + Intronic
943819199 2:192298675-192298697 CAGAATATTAAACCAAATCAGGG + Intergenic
946666015 2:222050542-222050564 CAGAAAGGTCAGCCACATCATGG - Intergenic
948672139 2:239575368-239575390 CAGACTCTTCAGCCACATCAGGG - Intergenic
948706651 2:239797916-239797938 GAGAAGTGTCAGCCACATCATGG - Intronic
1175806659 20:61833056-61833078 CAGAATGGTCACCCTCATAATGG + Intronic
1177088790 21:16740317-16740339 TAGAATCTTCAGTCAGATCAAGG - Intergenic
1178148426 21:29766374-29766396 CAGAATGTTTAGCAACACCCTGG - Intronic
1180211045 21:46295685-46295707 CAGAGTGTTCAGTAAAATCAGGG + Intronic
1181289063 22:21776848-21776870 CAAGATTTTCAGCCTCATCAAGG + Intronic
1184672847 22:46024552-46024574 CAGTGTGTCCTGCCACATCAAGG + Intergenic
950420703 3:12897385-12897407 CAGACTGTTCAGAGACTTCAAGG - Exonic
952809943 3:37392750-37392772 CACAATGTACAGACACATCTTGG + Intronic
955535684 3:59921153-59921175 CAGAATAACCAGCCACCTCACGG + Intronic
955810159 3:62779519-62779541 CAAAATGGGCAGCCACATGATGG - Intronic
955837391 3:63071435-63071457 CAAAATCATCAGACACATCAGGG + Intergenic
955946538 3:64199943-64199965 CAGAACGTTCAGGCACATCTGGG - Intronic
956077568 3:65522096-65522118 CAGTATTTTCTGCCACAACATGG + Intronic
957025750 3:75179681-75179703 AAGAATGGCAAGCCACATCAAGG + Intergenic
963641994 3:147872472-147872494 CAGAAGAGTCTGCCACATCAGGG + Intergenic
963926759 3:150959209-150959231 CAGAAGGCTTAGGCACATCATGG + Intronic
964227440 3:154423190-154423212 CAGAATGTTCTATCACATCATGG - Intronic
968373220 4:14281-14303 CAGAATGTTCATCTCCATCACGG + Intergenic
969973456 4:11072289-11072311 AAAAATGTTCAGCGACTTCAAGG - Intergenic
979409364 4:120357228-120357250 CAGAAAGTTGAGCCACAGAAAGG + Intergenic
980634719 4:135486083-135486105 CATAATATTCAGCAACATGAAGG - Intergenic
985462174 4:190118287-190118309 CAGAATGTTCATCTCCATCACGG - Intergenic
988685622 5:33522600-33522622 CAGAATGTTCAGCAACATTCTGG + Intergenic
989382861 5:40826402-40826424 TAGAATCCTCAGCCATATCAAGG + Exonic
991076753 5:62548290-62548312 CAATATGTTCAGACACATCAAGG + Intronic
992320980 5:75612649-75612671 CAGAATGTTCCACCAGAACAGGG - Intronic
993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG + Intergenic
993678949 5:90851423-90851445 CAGAATGTTCAGCATCTTTAGGG - Intronic
993777968 5:92025717-92025739 CAGTATGTTCAGACACACCCAGG + Intergenic
999793394 5:154964772-154964794 CACAATGATCAACCCCATCACGG - Intronic
1000738664 5:164936982-164937004 CAGAATTTTCAGCAAAATAATGG + Intergenic
1001580603 5:172795582-172795604 CAGAATGTTCCGCCAGATGCTGG - Intergenic
1002494101 5:179600043-179600065 CAGAAAGTCCCGCCTCATCACGG + Intronic
1002864870 6:1112272-1112294 AAGAATGCTCAGCCACAGAAAGG - Intergenic
1003534657 6:6966164-6966186 CAGTATGTTCAGAAACTTCAGGG - Intergenic
1003535757 6:6973962-6973984 CAGGATGTTTAGCAACATCCCGG - Intergenic
1003965885 6:11251690-11251712 CACAGTGTTCAACCACTTCAGGG + Intronic
1005788596 6:29273042-29273064 CAAAAACTTCAGCCAAATCATGG - Intergenic
1007062335 6:38953113-38953135 CAGAATGTTCAGCACCCTCAGGG + Intronic
1007173055 6:39878077-39878099 CAATCTGTCCAGCCACATCAAGG - Intronic
1008435044 6:51466348-51466370 CAGAAGCTTCTGCCACATAATGG - Intergenic
1008832818 6:55789025-55789047 CATAATTTTCAACCACATCAAGG - Intronic
1013308302 6:108870453-108870475 CTAACTCTTCAGCCACATCAGGG - Intronic
1013421818 6:109973955-109973977 CAGCATGTCCAGACACATCGGGG - Intergenic
1014456195 6:121637283-121637305 CAGAGTCTTCAGCTTCATCAGGG + Intergenic
1015117602 6:129666573-129666595 CACACCGTTCAGCCACATCCTGG + Intronic
1018002775 6:159594501-159594523 AAGAAGGGTCAGCCACCTCAAGG - Intergenic
1022633564 7:32109515-32109537 TAGGATGTTTAGCCACATCCTGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024412525 7:49061956-49061978 CATAATGTTCACCTACATTAGGG + Intergenic
1027596708 7:80183523-80183545 CAGGCTGTTCAGCTACAACATGG - Intronic
1027713480 7:81639212-81639234 CAAAATGTAAACCCACATCAAGG + Intergenic
1032032293 7:128494474-128494496 CCCAATGTTGAGCCACAACAAGG - Intronic
1035566661 8:645590-645612 CAGCATGGTCAGCCACACCCTGG - Intronic
1036063114 8:5347671-5347693 CAGAAAGTTTACCAACATCAAGG - Intergenic
1045830810 8:106458334-106458356 CAGCAGGTTGAGCCACATCTAGG - Intronic
1047839593 8:128736271-128736293 TAGAATGTTAATCCACCTCAAGG - Intergenic
1050705840 9:8395972-8395994 CTTAACTTTCAGCCACATCATGG + Intronic
1053056155 9:34994107-34994129 CAGAATTAGCAGCTACATCATGG - Intronic
1053574012 9:39339401-39339423 CAAAATGTTCAGGCACAGAATGG - Intergenic
1054095577 9:60898089-60898111 CAAAATGTTCAGGCACAGAATGG - Intergenic
1054117039 9:61174027-61174049 CAAAATGTTCAGGCACAGAATGG - Intergenic
1054590715 9:67008541-67008563 CAAAATGTTCAGGCACAGAATGG + Intergenic
1056345306 9:85688352-85688374 TAGAATGTTCAGCAACATCTCGG + Intronic
1058428408 9:104896604-104896626 CAGAATGTTCATCAAATTCAGGG + Intronic
1059516409 9:114900114-114900136 CAGAATCTCCAGTCACATAAAGG + Intronic
1061334895 9:129926514-129926536 CAGAATGTTTAGCAGCATCCTGG - Intronic
1061476348 9:130869532-130869554 CAGAATGTTCATCTGCATCTGGG + Intronic
1187932944 X:24310929-24310951 CAGATAGTGCAGCCACATCCAGG - Intergenic
1187939276 X:24365335-24365357 CAGATAGTGCAGCCACATCCAGG + Intergenic
1189411301 X:40774446-40774468 TAGAATGTTCAGAGACAGCAGGG + Intergenic
1189607315 X:42693601-42693623 CAGAATATTCAGCCACACAAAGG + Intergenic
1195860924 X:109381979-109382001 CAGAATCTTCAGCCCCATTTGGG - Intronic
1199487818 X:148367558-148367580 CATAATGTTGATGCACATCAGGG + Intergenic