ID: 1080327063

View in Genome Browser
Species Human (GRCh38)
Location 11:31087891-31087913
Sequence GTTCTGTTAATTATGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080327061_1080327063 -3 Left 1080327061 11:31087871-31087893 CCTTACAGATTTTTTCACTTGTT 0: 1
1: 0
2: 1
3: 46
4: 529
Right 1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG 0: 1
1: 0
2: 0
3: 36
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080327063 Original CRISPR GTTCTGTTAATTATGAAACA GGG Intronic
903739129 1:25548087-25548109 GTGCTGTCAATTATGAGCCATGG + Intronic
904321397 1:29699679-29699701 GTTCTGTTTCTTAAGAGACAAGG - Intergenic
904668786 1:32146168-32146190 GTTCTGTTCATTATTGAACGTGG + Intronic
905560354 1:38921801-38921823 GTTTTGTCAATTATGAGACGTGG - Intronic
907015485 1:51008308-51008330 GTTCTTTTAATTATGATATTAGG - Intergenic
907873188 1:58461812-58461834 GTTCTATTAGTTCTGAGACAGGG - Intronic
907981043 1:59481307-59481329 GTTATCTTACTTATGACACAGGG - Intronic
908062435 1:60366654-60366676 GTTTTGTTTATTTTGAAAGACGG - Intergenic
909957391 1:81796310-81796332 GTACTGTTAATGAGAAAACAAGG + Intronic
910717675 1:90250052-90250074 GTTCTCTTAATTGTGAAATTAGG - Intergenic
911898538 1:103470813-103470835 GTGCTGTAGATTATAAAACATGG + Intergenic
911963318 1:104335082-104335104 GTTCTTTTAATTATGAAGTTAGG + Intergenic
912571344 1:110625850-110625872 TTTCTCTTAATTATGAATGAAGG - Intronic
912969747 1:114269704-114269726 GTTTGGTGAATTTTGAAACAAGG - Intergenic
915055064 1:153121659-153121681 TTTTTTTTAATTATGAAACAAGG - Intergenic
915763513 1:158339138-158339160 GTTCTTTTAATTGTGAAATTAGG - Intergenic
917807160 1:178624343-178624365 CTGCTGTTAATTATGGAACGGGG - Intergenic
918246392 1:182663533-182663555 GTTTTGTTTTTTAAGAAACAGGG + Intronic
918733239 1:188024711-188024733 GTTGTTTTAAGTATTAAACATGG - Intergenic
918802504 1:188989665-188989687 GCTCTGTGAATGATGAAAGAAGG + Intergenic
919018580 1:192073430-192073452 GTTGTTTTAATTATGGAACTGGG + Intergenic
919240760 1:194913573-194913595 GTTCTGGTGATTATGTAACTAGG + Intergenic
919588709 1:199472062-199472084 GTTATGTTAATTATTTCACATGG - Intergenic
921568244 1:216747170-216747192 GTTTTATTGATTATGAAACAAGG + Intronic
922147786 1:222965638-222965660 GCTCTGTTAATTGTGAAAGAGGG - Intronic
922335000 1:224611980-224612002 GTTCTGTAACTAATAAAACAAGG + Intronic
1063716696 10:8534604-8534626 GTACAGTTTATCATGAAACACGG + Intergenic
1063776095 10:9266792-9266814 TTTCTTTGAATTATGAAAGAAGG + Intergenic
1065234438 10:23634636-23634658 GTTCTGTTCATTATTAAAAGTGG - Intergenic
1067025208 10:42838204-42838226 GTTCAGTTACATTTGAAACAAGG - Intergenic
1067246216 10:44548405-44548427 GTTCTGTAAATTATGATTGATGG - Intergenic
1067404907 10:46013024-46013046 CTTCTGTTAATCACAAAACAAGG + Exonic
1068435430 10:56984845-56984867 GTTCTTTTAATTGTGATACTAGG + Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068503264 10:57866710-57866732 GTTCTTTAAATTATGAAAGTTGG - Intergenic
1068639268 10:59383966-59383988 GTTCTAATAATTTTGAAATAGGG - Intergenic
1071014877 10:80984770-80984792 CTTCAGTTCATTTTGAAACATGG - Intergenic
1071380865 10:85058133-85058155 GCTGTTTGAATTATGAAACAAGG + Intergenic
1072059274 10:91793542-91793564 GTTTTGTTTTTTTTGAAACAGGG - Intergenic
1072468055 10:95685835-95685857 GTTCTATTAAATATAAAACAAGG + Intronic
1072729303 10:97834431-97834453 GTTCTGGTCAATATGATACAAGG + Intergenic
1073415638 10:103379439-103379461 GTTCTGTTAGTAAGGAAAAAGGG + Intronic
1074265942 10:111903447-111903469 GTTCTGGAAATTATAAAACTGGG - Intergenic
1077822366 11:5760373-5760395 TTTCTGTTAATTGTGTGACATGG + Intronic
1079537731 11:21535144-21535166 GTTCTGTTAAATACTGAACACGG + Intronic
1079547502 11:21651543-21651565 GTGCTGTTAATTATGCAACGAGG + Intergenic
1079994400 11:27280454-27280476 CATCTGTAAAGTATGAAACATGG - Intergenic
1080294737 11:30713636-30713658 GCTCTTTTCATTATGCAACAAGG - Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1080651214 11:34224037-34224059 TTTTTGTTAATTTTGAGACAGGG + Intronic
1084788090 11:71455365-71455387 GTTCTTTTAATTACTCAACATGG - Intronic
1086838731 11:91658267-91658289 GTTCTGTTCATTATCCAACTAGG + Intergenic
1086945855 11:92843366-92843388 GTTCTGTTCATTCTTACACATGG + Intronic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1088227597 11:107638621-107638643 GTTCTGTGAAGTAGGTAACAAGG - Intronic
1088757133 11:112894781-112894803 GTGCTGTTAAATAGGAAACAGGG - Intergenic
1089899611 11:121967025-121967047 GTTCTGTTAATTATGTCCCCAGG - Intergenic
1091029485 11:132172221-132172243 GTTCTGCTAATTCAGAAACTTGG + Intronic
1091328196 11:134708123-134708145 GTTCTGTCAATTATTAAAAGGGG - Intergenic
1091765297 12:3116412-3116434 GTTCTGATGAAGATGAAACACGG + Intronic
1093223611 12:16453520-16453542 TTTTAGTTAATTATGAAATAAGG + Intronic
1094708829 12:32941093-32941115 GTTTTTTTAATTTTGAGACAGGG + Intergenic
1095045109 12:37493722-37493744 CTTCTATTAATTATGAAGCCAGG - Intergenic
1095504803 12:42884022-42884044 GTTTTGTAAATCAAGAAACAGGG + Intergenic
1097152313 12:56987888-56987910 CTACTGTTAATTAAGCAACATGG + Intergenic
1097946944 12:65379307-65379329 GCTCTGTGAATTTGGAAACAAGG - Intronic
1098817075 12:75180808-75180830 GTTCTTTTAAATATCAAAGAAGG - Intronic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1102747782 12:115265058-115265080 GTTCTGTAAATAATTAAAGAAGG + Intergenic
1103313078 12:120027841-120027863 GATCTGTTAATTAGGAATGATGG - Intronic
1105048199 12:133024732-133024754 GTTCTGTTGCTTATGAGAGAGGG - Exonic
1106225694 13:27784979-27785001 GTTCTGTTACTAATGAAGAAGGG + Intergenic
1108195339 13:47988996-47989018 CTTCTATTAAATATGAAGCATGG + Intronic
1109014113 13:56986617-56986639 TTTCTGTGTCTTATGAAACATGG + Intergenic
1109134443 13:58628748-58628770 TTTCTTTTAATTTTTAAACATGG - Intergenic
1109360429 13:61288027-61288049 GTTCTGTTAATTATACTTCAAGG + Intergenic
1110382579 13:74871281-74871303 GTTCTGCTAATGATAAGACAAGG + Intergenic
1110631305 13:77711149-77711171 GTTCTGTTAATTGTGATATTAGG - Intronic
1110819220 13:79895123-79895145 GTTCTGATAAAGAAGAAACAAGG + Intergenic
1110989521 13:82021429-82021451 GTTTTGGTAATTATGAATAAAGG - Intergenic
1112454926 13:99551239-99551261 GATCTTTTCATTAAGAAACATGG - Intronic
1113317968 13:109204230-109204252 GTTGTGTCATTTAGGAAACATGG + Intronic
1113384948 13:109840064-109840086 GTTCTCTTAATTATAAAAATAGG - Intergenic
1117455787 14:55895657-55895679 ATTCTTTTAATTATGTAATAAGG - Intergenic
1117837509 14:59822435-59822457 GTTCTTTGAAATATTAAACAAGG - Intronic
1118359021 14:65040174-65040196 GATCTTTTATTTTTGAAACAGGG - Intronic
1118701973 14:68442272-68442294 GTTTTCTTATTTATGAAATATGG + Intronic
1119573508 14:75697439-75697461 ATTCTGTTAATTCTGCATCAAGG + Intronic
1119816019 14:77568499-77568521 CTTCTGTTAATTAAGAGAGAGGG + Intronic
1120125069 14:80732109-80732131 TTTCTGTTAAATATAAAACATGG + Intronic
1120432096 14:84432201-84432223 ATTCTCTTGATTATTAAACAAGG + Intergenic
1120614912 14:86691586-86691608 GTTCTGTTTGTTTTGAAACTTGG + Intergenic
1120645425 14:87068295-87068317 GTTCTTCCAATTATGAAATATGG + Intergenic
1121491215 14:94362319-94362341 ATTCTCTTTATTCTGAAACAAGG - Intergenic
1123425831 15:20169660-20169682 GTTCAGTTACATTTGAAACAAGG - Intergenic
1123535062 15:21176184-21176206 GTTCAGTTACATTTGAAACAAGG - Intergenic
1127253994 15:57272375-57272397 GTGGTGATAATTATAAAACATGG - Intronic
1127602838 15:60555516-60555538 GTGTTGGCAATTATGAAACAGGG - Intronic
1128555334 15:68627861-68627883 GTTATGTTAGCTATGATACAGGG - Intronic
1131635176 15:94225389-94225411 GGTCACTTAATGATGAAACATGG - Intergenic
1131708212 15:95021657-95021679 GTTCTGCCAATTATGTAGCAAGG + Intergenic
1132922395 16:2404647-2404669 GTTCTTTTAATGTTGAAAAAAGG + Intergenic
1134206878 16:12245687-12245709 GGTCAGTGAATTCTGAAACAAGG + Intronic
1135697275 16:24600607-24600629 GTTCTATTAATTATCAAAAGAGG + Intergenic
1136858419 16:33679860-33679882 GTTCAGTTACATTTGAAACAAGG + Intergenic
1137466794 16:48717155-48717177 GTTCTGGTTTTTATGACACATGG + Intergenic
1138722239 16:59096120-59096142 TCTCTGTTAATTCAGAAACATGG - Intergenic
1138867789 16:60844747-60844769 GTTCTTTTAATGATGGAATATGG + Intergenic
1139001456 16:62515457-62515479 TTTTTTTTAATTATGAAAAAAGG + Intergenic
1139030969 16:62879733-62879755 GTCCTGTTAATAAGGAAAAAAGG - Intergenic
1139326085 16:66153646-66153668 ATTCTGTTAAGTCTAAAACAGGG + Intergenic
1139770004 16:69266721-69266743 TTTATTTTATTTATGAAACAGGG + Intronic
1139860679 16:70018563-70018585 GTTCCCTCAATTATAAAACAGGG + Intergenic
1140645887 16:77029485-77029507 GTACAGTTGACTATGAAACAGGG + Intergenic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1203119987 16_KI270728v1_random:1528330-1528352 GTTCAGTTACATTTGAAACAAGG + Intergenic
1144120499 17:12148002-12148024 TTTCTGTTAAATGTGAAAAAAGG + Intergenic
1144175325 17:12699569-12699591 GTCCTGGTAAATATGAAATAAGG - Intronic
1144364849 17:14533193-14533215 GTTCTTTTAATTATGATGTAGGG + Intergenic
1145015467 17:19394257-19394279 GTTCTTTTATTTTTGAGACAGGG + Intergenic
1146090021 17:29867804-29867826 GTTCTCTTATTTATTAAAGAAGG - Intronic
1147494971 17:40906957-40906979 CTTATTTTAATTAAGAAACATGG - Intergenic
1148959163 17:51378882-51378904 GTTGTTTTCATTAAGAAACAGGG - Intergenic
1153561156 18:6373072-6373094 GTTATGTTAATATTTAAACATGG + Intronic
1155350820 18:24904175-24904197 GTTCTGTTAATTGTGATATTAGG - Intergenic
1158427997 18:57356308-57356330 GTCCTTTGAATAATGAAACAGGG - Intronic
1158652998 18:59304417-59304439 GGTGTTTTAATTATAAAACAAGG + Intronic
1158791622 18:60786503-60786525 ATTCTGTGAAGTATCAAACATGG - Intergenic
1159683308 18:71383466-71383488 GTTCTATTAATTTTGAATTATGG + Intergenic
1159704069 18:71665087-71665109 GTCCTGTCAATTATGAAAACTGG + Intergenic
1160585722 18:79912201-79912223 GCTCTGCAAATTATGAAACAGGG + Intronic
1160601172 18:80013746-80013768 CTTCTGTTAAATATTACACAAGG + Intronic
1160842645 19:1153145-1153167 GTTTTGTTATTTTTAAAACACGG - Intronic
1162999997 19:14361188-14361210 TTTCTTTTTATTTTGAAACAGGG - Intergenic
1164751194 19:30656030-30656052 GTTTTTTTTTTTATGAAACACGG - Intronic
1165884167 19:39065463-39065485 TTTTTGTTAATTTTGAGACAGGG - Intergenic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
927626956 2:24731799-24731821 GTTCTGTGAAAAATTAAACACGG - Intronic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
930384973 2:50682855-50682877 GCTGTATTAATTATGAGACATGG + Intronic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
932643080 2:73470677-73470699 GTTCTGTTCATTATTGAAAATGG + Intronic
932877856 2:75472350-75472372 GAGCAGATAATTATGAAACATGG + Intronic
933080762 2:77982281-77982303 TTTCTTTAAATTGTGAAACAGGG + Intergenic
933125347 2:78597827-78597849 ATTCTGTCAATTATAACACAGGG + Intergenic
934791309 2:97063737-97063759 TTTCTTTTAATTTTGAGACAAGG - Intergenic
935198698 2:100836896-100836918 GGTCTGTGAATTGTGAAACATGG + Intronic
935385523 2:102495843-102495865 GTTGTGTTAATTTTTAAATATGG - Intronic
937440842 2:121914435-121914457 GTTCTGGGAATTAGGACACATGG + Intergenic
938593726 2:132765733-132765755 GTTCTCTTAACTCTGAAAGAAGG - Intronic
941046841 2:160685770-160685792 GTCCTGTTAAATATAAAACAAGG - Intergenic
943064263 2:183070196-183070218 GTTCTATTCATTGTGATACATGG - Intergenic
945635865 2:212349872-212349894 GTTCTGTTAATAAGGAAGAAGGG + Intronic
946090638 2:217219699-217219721 GCTCCATTAATAATGAAACAAGG - Intergenic
946462487 2:219881485-219881507 GTTTTGTCTGTTATGAAACAGGG - Intergenic
946848750 2:223884799-223884821 GTTGTATTAATTTTGAAACATGG - Intronic
947553109 2:231061880-231061902 TTTCTGTTGATAATGAAACTGGG - Intronic
1169770389 20:9193453-9193475 GTTGTGTTCATTCTGACACAGGG - Intronic
1170079305 20:12454138-12454160 GTTCAGTCATTTATGTAACATGG - Intergenic
1173350205 20:42238105-42238127 TTTCTCTTAATTATAAAACGAGG - Intronic
1173598175 20:44273505-44273527 GTTCTCCTAATGATGAACCAGGG - Intronic
1174172969 20:48628473-48628495 ATACTATTAACTATGAAACAGGG + Intronic
1174734297 20:52950575-52950597 GTGTTATAAATTATGAAACAGGG + Intergenic
1178637644 21:34318839-34318861 GTTCTGTTAGTAGTGAAACAGGG + Intergenic
1180392329 22:12296180-12296202 GTTCTGTTATTAAACAAACAAGG - Intergenic
1180407417 22:12568590-12568612 GTTCTGTTATTAAACAAACAAGG + Intergenic
1181785584 22:25224387-25224409 ATTATGTTAATTAAGAAATATGG - Intronic
1182208253 22:28650808-28650830 GTTCTGTGAGGTATAAAACAAGG + Intronic
1182660923 22:31924618-31924640 TTTCTTTTATTTTTGAAACAGGG - Intergenic
1183215499 22:36476972-36476994 GGTGTGTTAATTTTTAAACATGG - Intronic
1183779729 22:39991378-39991400 GTTGGATTAATTATTAAACAAGG + Intergenic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
1185263899 22:49887399-49887421 GTCCTGTCAACTATGAAATATGG + Exonic
949781697 3:7696510-7696532 TTTCTGTTACTAAGGAAACATGG - Intronic
950269346 3:11601171-11601193 GTTTTGTTATTTGTGAAACACGG - Intronic
951580093 3:24153482-24153504 GTTTTGTTTATTAAGAAAAAAGG + Intronic
951743419 3:25949479-25949501 GTTCTTATAATTTTGAAGCAGGG + Intergenic
952672300 3:35984794-35984816 GTACTGTCAATTATGAAGCAAGG - Intergenic
952691116 3:36207709-36207731 GTTCCCTTCTTTATGAAACAGGG + Intergenic
952842310 3:37657765-37657787 GTTCTTTTAATTATGAAGTTAGG + Intronic
953654524 3:44839020-44839042 GTTTTGTTACTTGTGAAACTTGG + Intronic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956804959 3:72800409-72800431 GTTTTCTCATTTATGAAACAAGG - Intronic
956893041 3:73631277-73631299 GTTCTGTTAATAAGGAAGAAGGG + Intergenic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
958017430 3:87956662-87956684 GCTCTGAAAATTATGGAACATGG - Intergenic
958695135 3:97517900-97517922 ATTCTGTTACTTGTGCAACAGGG - Intronic
959093352 3:101927427-101927449 TTTTTTTTAATTATGAAATATGG + Intergenic
959557114 3:107733448-107733470 GTTTTGAAAATTAGGAAACATGG + Intronic
960300836 3:116000622-116000644 GTTCTATGAATTATAACACATGG + Intronic
960322127 3:116249246-116249268 GTGCTGTTAATTCTGAAATTAGG - Intronic
960562769 3:119103567-119103589 GTTATGTTTCTTATGACACAAGG + Intronic
961396636 3:126597763-126597785 CTTCAGTTAATAATGTAACATGG - Intronic
962643286 3:137410778-137410800 ATTATATTAATTATGAAGCATGG + Intergenic
963242530 3:143021943-143021965 GTGCTGTTAATTATGATATGGGG + Intronic
963400837 3:144796633-144796655 GTTTTGTTTCTTATGTAACATGG + Intergenic
963731411 3:148977208-148977230 GTTTTGGCAATTATGAAAAAAGG + Intergenic
964361331 3:155900041-155900063 GTTTTGGTAATTATGAATAAAGG + Intronic
964931085 3:162024071-162024093 GTTCTGTCTATGATGAAATATGG + Intergenic
966073235 3:175905110-175905132 GTTCTTTTAATTGTGAAGCTAGG - Intergenic
969907082 4:10407234-10407256 GTTCTGGAAATTAAGAATCATGG - Intergenic
970313365 4:14805924-14805946 GTTCTGTTTATTATGAATCCAGG + Intergenic
972042851 4:34625320-34625342 GTTCTTTTAATTGTGATACTAGG + Intergenic
973827916 4:54727537-54727559 GTTTTGGTCAGTATGAAACAGGG + Exonic
974164303 4:58181054-58181076 GTTGTGTTAATTATGAAGAAAGG + Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
974720154 4:65727719-65727741 GTTCTTTTAATTATCATATACGG - Intergenic
975060717 4:69994908-69994930 GTACTGTGAAGTTTGAAACAAGG - Intergenic
976425859 4:84902472-84902494 GGTCTGTTAATTATGCACAATGG - Intronic
976492119 4:85683192-85683214 GTTCTTATAAATATGAAACATGG + Intronic
977906249 4:102480966-102480988 GTTCTTTTAATTATGATGTAAGG - Intergenic
979012598 4:115390324-115390346 GTTCTTTTAATTATGATGCTAGG - Intergenic
979062921 4:116088678-116088700 TTTCTGATAATTATAATACAAGG - Intergenic
979254198 4:118594741-118594763 GCTATGTTATTTATGAAACATGG - Intergenic
979658155 4:123221160-123221182 GTTTTGTTTATTTTGAGACAGGG + Intronic
979769117 4:124500641-124500663 GTTCTGTTCTTTATGTTACATGG - Intergenic
980028991 4:127803389-127803411 ATTCTTTTAATTATGATATATGG + Intronic
980475715 4:133311899-133311921 GTTCTGCTCAATGTGAAACAGGG - Intergenic
980535264 4:134111968-134111990 GGTTTGAGAATTATGAAACAAGG + Intergenic
982032188 4:151311831-151311853 GTTCTTTTATTTTTGAGACAGGG - Intronic
982619249 4:157682269-157682291 ATTCTGTAAATTATCAAAGAAGG + Intergenic
982880123 4:160703586-160703608 TTTCTGTTAAGTATGTAATAAGG - Intergenic
984151908 4:176143670-176143692 TTTCTTTTAAATTTGAAACAGGG - Intronic
984380702 4:178988827-178988849 GTTCTTTTAATTGTGATACTAGG + Intergenic
984555124 4:181204405-181204427 ATTCTGTTAATTTTAAAAAATGG + Intergenic
985038581 4:185865889-185865911 TTTCTTTTAATGATAAAACAGGG + Intronic
986000932 5:3630014-3630036 TTTCTGTTAATAATGCAAGAAGG - Intergenic
986459315 5:7953642-7953664 TTTCTTTTAATTTTGAGACAAGG - Intergenic
988129409 5:27083026-27083048 ATTCTGTTAGTCATGAAACTAGG - Intronic
988607358 5:32690285-32690307 GTTCTGTTAATTAAGGACCAAGG + Intronic
989968902 5:50497652-50497674 GTTCTTTTAATTATGATATTAGG - Intergenic
994349534 5:98728662-98728684 GTTGTGTTAACTATGATAAATGG - Intergenic
995448004 5:112267924-112267946 GGTGTGTAAATTATGGAACAGGG - Intronic
996794347 5:127328091-127328113 TTTCTCTAAATTAGGAAACATGG - Intronic
997778788 5:136636411-136636433 GATCTGTTAATTAAGAAAAATGG - Intergenic
999695266 5:154183222-154183244 GTTTTGGTAATTATGAATAAAGG - Intronic
1000192963 5:158930300-158930322 GGTCTGTTAATTACTAAACATGG - Intronic
1000617836 5:163449369-163449391 GTTGTATTATTTTTGAAACATGG - Exonic
1000744476 5:165016087-165016109 GTTCTGTTCTTATTGAAACAAGG + Intergenic
1001570985 5:172730379-172730401 GTCCTGTAAAATCTGAAACACGG + Intergenic
1001791346 5:174460014-174460036 GTTCTGGTAAGAATGACACAAGG - Intergenic
1001976568 5:176005043-176005065 ATTCTGCTAAATTTGAAACAGGG - Intronic
1002240859 5:177838729-177838751 ATTCTGCTAAATTTGAAACAGGG + Intergenic
1002325969 5:178406187-178406209 GTTCTTTTAGTTATTAAAAATGG - Intronic
1003935687 6:10973000-10973022 CTTCTGTTAATAAGGAAACAGGG + Intronic
1004797855 6:19108873-19108895 GTTCTGCTTATTTTTAAACAGGG + Intergenic
1005383774 6:25264932-25264954 GTTCTGTCAGTTCTGAAACTAGG + Intergenic
1005631878 6:27716055-27716077 GTTTTGTTTATTTTGAGACAGGG - Intergenic
1005722802 6:28619513-28619535 GTTTTGTTATTTTTGAGACAAGG + Intergenic
1006570089 6:34995467-34995489 GTTCTGTGAATTTTGACAGATGG + Intronic
1007667215 6:43521913-43521935 TTTCTGTTGTTTTTGAAACAGGG - Intronic
1008361351 6:50622909-50622931 GTTCTTTTAATTATGACGCTAGG - Intergenic
1008939702 6:57033067-57033089 GTTTAGTTAATTATAAAATAGGG + Intergenic
1010013488 6:71077110-71077132 GTACTGTAAATTATAAAACAAGG - Intergenic
1011061427 6:83274093-83274115 GCTCTGCTAATAATGAAATATGG + Intronic
1011892654 6:92186126-92186148 GTTTTCTTATTTATGAAATAGGG + Intergenic
1012772312 6:103454373-103454395 TTTTTGTTAAATATAAAACATGG - Intergenic
1014610403 6:123536875-123536897 GTTCTATTTATTTTGAGACAGGG - Intronic
1015741608 6:136461155-136461177 ATTCTCTTAGTTATAAAACATGG - Intronic
1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG + Intergenic
1016999656 6:149987341-149987363 GTTATTTTATTTTTGAAACAGGG - Intergenic
1017437313 6:154428522-154428544 ATTATGTTAATAATGAGACATGG + Intronic
1017550775 6:155504791-155504813 GTTTTTTTATTTATGAAATATGG + Intergenic
1018434189 6:163746378-163746400 GTTTTGTCATTTATAAAACATGG + Intergenic
1018460381 6:163993095-163993117 GTTCTGTTAATAAGAGAACAAGG - Intergenic
1020671853 7:11125526-11125548 ATTCTTTTGATTATTAAACAAGG + Intronic
1020785102 7:12564073-12564095 CTTCTGTAAATAATCAAACATGG + Intergenic
1021548825 7:21847738-21847760 GATCTGTCAATTATGATATAAGG + Intronic
1023644511 7:42295601-42295623 TTTCTGTTAAATATTAATCAAGG + Intergenic
1024423008 7:49191828-49191850 CTTCCAATAATTATGAAACAGGG - Intergenic
1024436200 7:49357879-49357901 GTTCTGTTCATTCTGAATCTGGG - Intergenic
1025059159 7:55789324-55789346 GTTCTTTTATTTTTGAGACAGGG - Intergenic
1026030093 7:66784924-66784946 GTTCTGATAAAAATGAAAGATGG - Intronic
1026885354 7:73939049-73939071 GTTCTCTTTATTATTAAAAATGG + Intergenic
1027437142 7:78176010-78176032 GTTCTCTCTATTATAAAACAAGG + Intronic
1028170815 7:87593329-87593351 TTTCTGTAAATGTTGAAACAAGG + Intronic
1031684112 7:124710828-124710850 GTTTTGTTAGTTATGAAATGGGG + Intergenic
1031954110 7:127924564-127924586 ATTCTGTGAATTCTGGAACAGGG - Intronic
1032379970 7:131468687-131468709 TTTCTGTTAATTTAGGAACAGGG + Intronic
1032615519 7:133465471-133465493 GTTCTATTAATTATCAAAAAAGG - Intronic
1033402073 7:141035533-141035555 GTTCTTTTAATTATGAAGTTAGG - Intergenic
1033496658 7:141904778-141904800 TTTCCTTTAATTAGGAAACAGGG + Intergenic
1034007962 7:147495465-147495487 GTTTTATTAATAATGAAACAGGG - Intronic
1034092202 7:148374005-148374027 CTTGTGTTAATTATGTGACATGG + Intronic
1036441497 8:8785625-8785647 GTTCTGTTAAATGTGAAAGAGGG - Exonic
1037148119 8:15598868-15598890 GTTTTGGTAATTATGAATAAAGG + Intronic
1037310678 8:17552475-17552497 GTGCTTTTTATTGTGAAACATGG + Intronic
1040387259 8:46921896-46921918 GTCCTGTTATTTATCACACATGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040982608 8:53259436-53259458 GTTTTCTTAATTATAAAATAGGG - Intergenic
1041743369 8:61179908-61179930 GTTCTTTTAATTATGAAGTTAGG - Intronic
1043000164 8:74748967-74748989 TTTCTGTTAATTGTGAAACCTGG + Intronic
1043021169 8:75001782-75001804 GTTCTGTCAAGTGTGAATCATGG + Intronic
1043354231 8:79393636-79393658 GGTCTCTTACTGATGAAACAGGG - Intergenic
1044563977 8:93643371-93643393 GTTTTGTTTGTTTTGAAACAGGG + Intergenic
1045440908 8:102209575-102209597 GTTCTTCTAATGATTAAACATGG + Intronic
1049856444 8:144864967-144864989 CTTCTGTTAATTCTGAAATTTGG - Intergenic
1049858552 8:144880928-144880950 GTCCTGTTTTGTATGAAACAAGG - Exonic
1052450001 9:28617102-28617124 GTCCTATTAATTATGAAAAATGG + Intronic
1053569989 9:39294699-39294721 ATTCTGTTTATTATGAAAAATGG - Intergenic
1053835949 9:42135728-42135750 AATCTGTTTATTATGAAAAATGG - Intergenic
1054091618 9:60853702-60853724 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054113033 9:61129276-61129298 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054127160 9:61324311-61324333 ATTCTGTTTATTATGAAAAATGG + Intergenic
1054594683 9:67052916-67052938 ATTCTGTTTATTATGAAAAATGG + Intergenic
1055270569 9:74553436-74553458 GTTCTGTTACTGATAAAATATGG - Intronic
1055402811 9:75942449-75942471 GTTCTGTCAGTTATGTACCACGG + Intronic
1055852285 9:80646132-80646154 GTTTTCTTATTTTTGAAACAAGG - Intergenic
1057744489 9:97740476-97740498 GTTCTATTAATCATCCAACAGGG + Intergenic
1057836515 9:98449755-98449777 CTTCTGTCAATTATGCAACCAGG - Intronic
1058148069 9:101433418-101433440 TCTCTGTTAATCATAAAACAGGG + Intronic
1058922408 9:109629544-109629566 GCTATGTCAATCATGAAACATGG + Intergenic
1186080483 X:5925617-5925639 ATTCTGTTAATTCTAGAACATGG - Intronic
1186945783 X:14565412-14565434 GTTCTATTTATTATTAAAAATGG + Intronic
1187056201 X:15743483-15743505 CATCTATTAAGTATGAAACATGG - Intronic
1187369599 X:18693869-18693891 GTTCTGTGAATTTTAACACATGG + Intronic
1187619922 X:21040801-21040823 GTTGTGGGAATTTTGAAACAAGG - Intergenic
1188002082 X:24992385-24992407 ATTCTGTCAATTATGAAATCAGG - Intronic
1188877620 X:35450241-35450263 GTTTTGGTAATTATGAATAAAGG + Intergenic
1189219436 X:39358527-39358549 CTACAGTTAATTGTGAAACATGG + Intergenic
1189717240 X:43879369-43879391 GCTTTGTTAATTATTAAACTTGG - Intronic
1192039633 X:67604875-67604897 ATACTGGTAATTATCAAACAGGG - Intronic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1194255615 X:91630159-91630181 GTTCTTTTAATTGTGATACTAGG - Intergenic
1194266162 X:91755730-91755752 GTTCTTTTAATTGTGATACTAGG - Intergenic
1194271577 X:91822746-91822768 GTTCTTTTAATTATGATACTAGG + Intronic
1194476731 X:94368365-94368387 GTTGAGTTAAATATGAAACCAGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195367735 X:104142233-104142255 GTTCAGTTTTTTTTGAAACAGGG - Intronic
1195744083 X:108096706-108096728 GTTATGTTATTTATGTGACATGG + Intronic
1195798862 X:108684183-108684205 GTTCTTTTAATTTTGATATAAGG - Intronic
1196279510 X:113806628-113806650 GTTCTGTGAACTGTGAAAAATGG - Intergenic
1196377112 X:115045475-115045497 ATTCTGTTAATTATCAAAACAGG + Intergenic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1197802769 X:130369275-130369297 TTTTTTTTAATTAAGAAACATGG - Intronic
1197831199 X:130645539-130645561 GTTCTGTTAGTAATCAAAAAAGG - Intronic
1198233513 X:134715551-134715573 TTTCTGTTAATTGACAAACAAGG - Intronic
1198737890 X:139807612-139807634 GATTTTGTAATTATGAAACAGGG + Intronic
1198932548 X:141876706-141876728 TTTCTGTTTAATATGAAAAAGGG + Intronic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1199911549 X:152292621-152292643 GTTCTTTTAATTATGATGCTAGG + Intronic
1200574350 Y:4869420-4869442 GTTCTTTTAATTGTGATACTAGG - Intergenic
1200583319 Y:4976300-4976322 GTTCTTTTAATTGTGATACTAGG - Intergenic
1200847080 Y:7841481-7841503 GTTCTTTTAATTATGATGCTAGG + Intergenic
1201428550 Y:13881925-13881947 GTTCCCTACATTATGAAACAAGG - Intergenic