ID: 1080328723

View in Genome Browser
Species Human (GRCh38)
Location 11:31110158-31110180
Sequence AGTTGTTTGCAGAAGATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080328723 Original CRISPR AGTTGTTTGCAGAAGATCAA TGG (reversed) Intronic
903474344 1:23609143-23609165 AGTAGGTTGCAGAAGATAACTGG - Intronic
906165220 1:43681066-43681088 AGTATTTTTGAGAAGATCAAGGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907616052 1:55927586-55927608 AGGTAGTTGCAGAAGATCAGAGG + Intergenic
908332977 1:63089163-63089185 AGTTGATTGCAAAAAATAAATGG - Intergenic
908442208 1:64166381-64166403 AGTTCTGTGAAGAATATCAATGG + Intronic
911860539 1:102942097-102942119 ATTTATTTGAAGAAGATAAAAGG - Intronic
912378065 1:109229036-109229058 AGTTGAATGCAGCACATCAATGG + Intronic
912946134 1:114086428-114086450 AGTTCTTTTCAAAACATCAAGGG + Intergenic
913429884 1:118778940-118778962 AGTTCTGTGAAGAAAATCAATGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
917377307 1:174363309-174363331 AGTTCTTTGAAGAATGTCAATGG + Intronic
917905252 1:179582036-179582058 AGCTTCTTGCAGCAGATCAATGG + Intergenic
919533827 1:198761212-198761234 AGTTATGTGAAGAATATCAATGG - Intergenic
920107355 1:203563402-203563424 AGCAGCTTGCAGAAGATAAAAGG - Intergenic
921013396 1:211164227-211164249 AGTTATTTGAAGAATGTCAATGG + Intergenic
921561989 1:216670317-216670339 AGTTGATTGCATCAGATCCAAGG + Intronic
921674328 1:217961647-217961669 AGATGTTTTCAGTAGATAAATGG + Intergenic
922111652 1:222563756-222563778 AGTAGTTTGCAAAAGAGAAATGG - Intronic
922280251 1:224116424-224116446 AATCGTTTGCAAAAAATCAAGGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923149375 1:231219820-231219842 AGTTCCTCCCAGAAGATCAAAGG + Intronic
923657320 1:235929285-235929307 AATTGTTTGAAAAAAATCAAGGG + Intergenic
923851247 1:237797513-237797535 AGGTCTATGCAGAAGATCATTGG + Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
1063773279 10:9229010-9229032 AGTTGATTAAAGTAGATCAAAGG - Intergenic
1067924338 10:50492766-50492788 AGTTCTGTGAAGAATATCAATGG - Intronic
1067929713 10:50548176-50548198 AGTTCTATGAAGAATATCAATGG - Intronic
1069412247 10:68165729-68165751 AGGTGTTTGCAGAAGATTCTGGG + Exonic
1070472092 10:76791069-76791091 AGTTCTTTGAAGAATGTCAATGG + Intergenic
1071248908 10:83795566-83795588 AGTTCTGTGAAGAAGGTCAATGG - Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072237869 10:93468783-93468805 GGTTGTTTGCTGCAGATCAGAGG + Intronic
1072573366 10:96677633-96677655 AAATGTTTACAGAAGGTCAAAGG - Intronic
1073058439 10:100717359-100717381 AGTTGTTTGCCCAAGGTCACAGG - Intergenic
1076850513 10:133090183-133090205 AGTTGTTCGCAGAAGGGCCAAGG - Intronic
1080328723 11:31110158-31110180 AGTTGTTTGCAGAAGATCAATGG - Intronic
1080551820 11:33378980-33379002 GGTTGTTTGCAGAAAGTCAAAGG - Intergenic
1080931333 11:36814513-36814535 AGTTATTTGCCTAAGGTCAAAGG + Intergenic
1082195977 11:49306096-49306118 AGTTGAATGCAAAAGATCTATGG + Intergenic
1085259521 11:75196277-75196299 AGATGTTTGAAGAAGCTCAAAGG + Intronic
1085340618 11:75728881-75728903 AATCGGTTGCAGAAGATCATGGG + Exonic
1085708395 11:78807455-78807477 AGTGCTTTGCAGAAGATTAGAGG - Intronic
1085955403 11:81387194-81387216 AGTTTCTGGCAGAAGAGCAAAGG - Intergenic
1086368770 11:86135311-86135333 AGTGTTTTTCAGAGGATCAAAGG + Intergenic
1086533281 11:87812152-87812174 AGTTATTTGCCCAAGGTCAATGG - Intergenic
1087185439 11:95187734-95187756 AGTTGTTTACAGATAAGCAAAGG - Intronic
1087214535 11:95481355-95481377 TGGTGTTTGAAGAAAATCAATGG - Intergenic
1087306171 11:96491569-96491591 AGTTCTTTGAAGAAATTCAATGG - Intronic
1087637696 11:100721240-100721262 AGTTGTTAGGAGAAGAACAAGGG - Intronic
1087967085 11:104429499-104429521 TGATGTTTGGAGAAGAACAATGG - Intergenic
1088191399 11:107232727-107232749 AGGTGCTTGCTGAAGATAAAAGG - Intergenic
1088243026 11:107790393-107790415 AATTGGTTGCAGAAAATGAAAGG + Intergenic
1088315219 11:108499431-108499453 AGGTGTTTACAGAACATCCACGG + Intergenic
1088624459 11:111719480-111719502 AGTGGTTTCCAGAAGAACAGGGG - Intronic
1093271368 12:17066527-17066549 AGTTGTTTGCTGAAAATGAGGGG + Intergenic
1093595638 12:20955707-20955729 AATTGTGTGAAGAAAATCAATGG - Intergenic
1093724870 12:22492839-22492861 ATTCGTTTACAGTAGATCAAGGG + Intronic
1095768160 12:45919841-45919863 ACTTGTTTGCAAAAGCTAAATGG + Exonic
1096732316 12:53624306-53624328 AGCTGATTGCAGAAAACCAAAGG + Intronic
1097499166 12:60380175-60380197 AATTCTTTGAAGAATATCAATGG - Intergenic
1097548670 12:61038137-61038159 TGTTGTTTGATGAAGAACAATGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099400975 12:82203814-82203836 AGGTGCTTGCAGAAGGTAAAGGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1102211004 12:111127236-111127258 AGTTGTTTGCCGAAGGCCAAGGG - Intronic
1102512791 12:113427081-113427103 AGTTGATTGCTGAAGCTGAAGGG + Intronic
1103071459 12:117946861-117946883 AATTGTTTAAAGAAGATAAATGG + Intronic
1105218317 13:18303393-18303415 AGGTGTTTGCAGCAGGTCACTGG - Intergenic
1105716060 13:23066052-23066074 AGTTGTTTAAAGAAGATCAGAGG + Intergenic
1105749061 13:23405025-23405047 AATTATTTGAAGAAAATCAATGG - Intronic
1106791390 13:33158387-33158409 AGATGCTTGCAGAATACCAAAGG + Intronic
1107316406 13:39136977-39136999 ATTTCTGTGCAGAAGAGCAATGG - Intergenic
1107746284 13:43513326-43513348 AATTGTTTTCAGAAAAACAATGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108974190 13:56417353-56417375 TGTTGTTAGCAGAAGACAAAAGG - Intergenic
1111299308 13:86325934-86325956 AGTTCTTTGAAGAATGTCAATGG - Intergenic
1111972729 13:94933918-94933940 AGCTGTTAGAAGTAGATCAAAGG + Intergenic
1112619736 13:101042478-101042500 AGTTCTGTGAAGAAAATCAATGG + Intergenic
1112908485 13:104453442-104453464 AGTTCTTTGAAGAATGTCAATGG - Intergenic
1113715163 13:112499809-112499831 AGTTGTTTACTGAAGATTACTGG - Intronic
1113842412 13:113367676-113367698 AGCTGTTTCCAGAACATAAAGGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115504645 14:34081553-34081575 AGTTGTTTTCCTAAGATCACTGG + Intronic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116778155 14:49205155-49205177 AGTTGTTCACACAAGAACAATGG - Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1120076433 14:80164106-80164128 AATTGTTTCCAGAAGATAGATGG + Intergenic
1202935033 14_KI270725v1_random:79990-80012 AAATGTTTGCAGAAAATGAATGG + Intergenic
1125817198 15:42596212-42596234 AGTCATTTGCAGATGACCAAGGG + Intronic
1126209077 15:46079430-46079452 AGTTATTTGGAGAAGATTTAGGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1129565058 15:76612888-76612910 AGTTCTGTGAAGAATATCAATGG - Intronic
1135776875 16:25264425-25264447 ATTCGTTTGCAAAAGATAAAAGG + Intergenic
1145191984 17:20850856-20850878 TATTGTTTGCAAAAAATCAAGGG + Intronic
1145402203 17:22550893-22550915 TATTGTTTGCAAAAAATCAAGGG + Intergenic
1156005441 18:32435509-32435531 ATTTGTCTGCAGAACATCATTGG + Intronic
1156627834 18:38931113-38931135 TGTTGTTTGCAGAAGGGCTAAGG + Intergenic
1157847417 18:51017070-51017092 GGTTGTTTGGATGAGATCAACGG + Intronic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158628642 18:59093039-59093061 AGTTGTGTGCAGAAGCCCCAGGG - Intergenic
1159765736 18:72486065-72486087 AGTTGTTTGCACAACATAAAAGG + Intergenic
1160797574 19:953026-953048 AGAGGTTTGCAGAAAATCCAAGG - Intronic
1162394697 19:10410244-10410266 AGGTGTTTGAAGAACAACAAAGG + Intronic
1163280888 19:16316964-16316986 AGTTGTTAGGAGAAGATAAGGGG + Intergenic
1168352082 19:55681755-55681777 GGTTGTTTTCAGAAAAGCAAAGG + Intronic
924996045 2:362485-362507 AGTTTCATGCAGAAGATAAAGGG + Intergenic
925322800 2:2989475-2989497 AGTTCTGTGAAGAATATCAATGG + Intergenic
925674502 2:6346620-6346642 AATTCTGTGCAAAAGATCAAGGG + Intergenic
926512722 2:13802555-13802577 AGTTCTTTGAAGAAAATAAAAGG - Intergenic
927120009 2:19950051-19950073 AGTTGTTGGCATATGATTAAAGG + Intronic
928001242 2:27524587-27524609 AGGTGTTTGTGGAAGATGAAAGG - Intergenic
930710008 2:54542233-54542255 AGTTGTTGTCAGTAGATGAAAGG + Intronic
931218041 2:60264319-60264341 AGTTGTCAACAGAAGAACAAGGG - Intergenic
932869832 2:75387777-75387799 AATTATTTGAAGAATATCAATGG + Intergenic
933250131 2:80020210-80020232 AGTAATTTGCAAAAGACCAAGGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933346139 2:81088020-81088042 TGTCGTTTCCAGAAGCTCAATGG + Intergenic
933346995 2:81100365-81100387 TGTTATATCCAGAAGATCAAAGG - Intergenic
933595158 2:84276002-84276024 TGTTGTTTGCAGAAAATCTGAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935834024 2:107030553-107030575 CATTGTTTGCAGAAAATCTATGG + Intergenic
935873574 2:107479746-107479768 AGTCATTTGCAGAGGAGCAAAGG - Intergenic
937165972 2:119817690-119817712 AGTTCTTTGAAGAATGTCAATGG + Intronic
937685778 2:124695473-124695495 AGCTGTCTGCAGAACACCAATGG + Intronic
937800925 2:126079236-126079258 AGGTGTTTGCTGAAGACAAAGGG + Intergenic
939254133 2:139720750-139720772 AGTTCTTTGCAGAGGATAAGTGG + Intergenic
939947590 2:148428461-148428483 AGTTCTTTGAAGAAACTCAATGG - Intronic
941435421 2:165464897-165464919 AAATGTTTGCAGAAACTCAAGGG - Intergenic
944130636 2:196344277-196344299 AGTCCTTTGCAAAAGACCAAAGG + Intronic
944392417 2:199230457-199230479 AGTTCTGTGCAGAATGTCAATGG + Intergenic
944627701 2:201589221-201589243 AGTTCTTTGAAGAATCTCAATGG - Intronic
944956438 2:204816620-204816642 ATTTTTTTGCAGAGGAACAAAGG - Intronic
1170681408 20:18529072-18529094 AGATGTTTGAAGAAGAGCAGTGG + Intronic
1175682944 20:61004546-61004568 AGTTGTTTGCTGCACAGCAATGG + Intergenic
1177150624 21:17452096-17452118 ATTTATTGGCAGAAGAGCAAGGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177824972 21:26072765-26072787 AGTTCTCTGCATAAAATCAAGGG + Intronic
1182252090 22:29009014-29009036 AGCTGCTTGCTGAACATCAAGGG - Intronic
1183282412 22:36938649-36938671 AGTGATTTGCTGAAGGTCAAGGG - Exonic
1183769095 22:39908130-39908152 GGTTTTCTGCAGAAAATCAAAGG - Intronic
951067875 3:18288818-18288840 AATTGTATGCAGAAGAACTATGG + Intronic
952030331 3:29134044-29134066 AGTAGTTTCCAAAATATCAAAGG - Intergenic
953325337 3:42008033-42008055 AGTTGGTTGAGGAAGATCTAAGG - Intergenic
954918213 3:54166347-54166369 AGTTGCTTGCTTAAGATTAATGG - Intronic
956003439 3:64753308-64753330 AGTTCTGTGAAGAATATCAATGG + Intergenic
956137258 3:66111400-66111422 AATTCTTGGCCGAAGATCAAGGG - Intergenic
956599790 3:71008610-71008632 AGTTGTTTTCAGAAGAAACAGGG + Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957610477 3:82459281-82459303 ATTTCCTTGCGGAAGATCAATGG - Intergenic
958539227 3:95448704-95448726 TGATGCTTGCAGAAGAGCAAAGG - Intergenic
958690258 3:97457021-97457043 AGTTGTTAGAAAAACATCAAGGG + Intronic
958774034 3:98459660-98459682 AGTTCTGTGAAGAATATCAATGG + Intergenic
959272751 3:104234459-104234481 AGGTGCTTGCTGAAGATAAAGGG + Intergenic
959507217 3:107169720-107169742 AGTTCTGTGAAGAATATCAATGG - Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
962139029 3:132768566-132768588 AGTTCTGTGAAGAATATCAATGG + Intergenic
962566290 3:136663725-136663747 TGTTGTTACCTGAAGATCAAGGG - Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
964239203 3:154572035-154572057 AGTTGCTAGTAGCAGATCAAGGG - Intergenic
964462818 3:156954881-156954903 AGTTGTGTGAAGAATGTCAATGG + Intronic
964966792 3:162504113-162504135 AGTTGTGTGAAGAAAGTCAATGG - Intergenic
965034736 3:163423991-163424013 AGGTGTTTGCAGAAGGCAAAGGG - Intergenic
965930385 3:174035655-174035677 AGGTGTTTGCAAATGATAAATGG - Intronic
966572904 3:181466923-181466945 TGTTGTTTGAAGAATACCAATGG + Intergenic
967554602 3:190840051-190840073 AGTTCTTTGAAGAATGTCAATGG - Intergenic
968389989 4:183526-183548 AGTTCTGTGCAGAATGTCAATGG + Intergenic
970493266 4:16598170-16598192 AGTTGATTACAGCAGATCACAGG - Intronic
970542146 4:17090874-17090896 AGGTATTTGCAGAAGGTCCATGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971867982 4:32197081-32197103 ATTTGTGCCCAGAAGATCAAGGG + Intergenic
972207455 4:36793377-36793399 AGTTCTTTGAAGAATGTCAATGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977468289 4:97409444-97409466 AGTTGTGTGCAGAAGCTGCAAGG + Intronic
980385536 4:132085108-132085130 AGATGTTTGCTGAAGGTAAAGGG - Intergenic
980621325 4:135308365-135308387 AGTTGTTTTAAGAAAATCATTGG + Intergenic
981166277 4:141561795-141561817 AGTTGTTTCCAGAATATTATAGG - Intergenic
982177435 4:152719177-152719199 AGCAGTGTGCAGAAGAGCAAGGG - Intronic
982295726 4:153826836-153826858 AATTATTTGAAGAAGGTCAATGG - Intergenic
983099558 4:163608279-163608301 AGTCGTCTGGAGAAGATCCAAGG + Intronic
983746727 4:171209866-171209888 AATTCTTTGAAGAATATCAATGG + Intergenic
984324515 4:178235071-178235093 AATTCTGTGCAGAATATCAATGG + Intergenic
989745144 5:44820258-44820280 AGTTGAAAGCAGAAGTTCAAGGG - Intronic
989772368 5:45159961-45159983 AGTTCTTTGAAGAATGTCAATGG + Intergenic
990686906 5:58314587-58314609 AGTGGCTTCCAGAAGTTCAAAGG - Intergenic
991317232 5:65322397-65322419 AGTTCTGTGAAGAATATCAATGG + Intronic
991414221 5:66375813-66375835 TCTTGTTTGCAGAAGATAAAAGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992975041 5:82107379-82107401 GGGTGTTTGCAGGAGATAAAGGG + Intronic
995030302 5:107473076-107473098 AGTTGTTTGCAGAAAAACGGTGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996846300 5:127903019-127903041 AGATGCTTGGAGAGGATCAAAGG + Intergenic
998148690 5:139745064-139745086 CCTTGTTTGCAGAAGACCCAAGG - Intergenic
1000431090 5:161153193-161153215 AGTTGTTCGCCCAAGATCATAGG + Intergenic
1002583810 5:180228517-180228539 GGTTGCTTGCAAAAAATCAATGG + Intergenic
1005734617 6:28733990-28734012 AGGTGGTTGCAGAAGAGGAAGGG + Intergenic
1006329549 6:33380480-33380502 AGTTTTGTGGAGAAGGTCAAGGG - Intergenic
1008048704 6:46877859-46877881 AGCTCTTTGCTGAAGATGAAAGG + Intronic
1008106821 6:47448155-47448177 AGATTTTTGCAGTAGAGCAAGGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009674794 6:66804818-66804840 AGTTGTTTGCAGAACCTGAATGG + Intergenic
1009960584 6:70516107-70516129 AGTTGTTTGCAGAAGGAAGAGGG + Intronic
1010648519 6:78423612-78423634 AGTTTTGTGAAGAATATCAATGG - Intergenic
1010864994 6:80965524-80965546 AGTTGATGGCTGAAGATCATAGG + Intergenic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015325589 6:131919491-131919513 AGTTTTGTGAAGAATATCAATGG - Intergenic
1016792572 6:148080772-148080794 AGAGGTTTGCAGATGATCACAGG - Intergenic
1017390256 6:153930762-153930784 AGTTGTTTGTAAAAAATAAATGG - Intergenic
1023002593 7:35826440-35826462 AGTTATTTAGAAAAGATCAATGG + Intronic
1023183790 7:37512865-37512887 AGTTGTTTGCAGCTGTTCAGGGG - Intergenic
1024033964 7:45490994-45491016 AATTCTGTGAAGAAGATCAATGG + Intergenic
1024314599 7:48003432-48003454 AGTTCTGTGAAGAAGGTCAATGG + Intronic
1024352993 7:48386352-48386374 AGTTCTGTGAAGAATATCAATGG - Intronic
1028040400 7:86045272-86045294 AGTTCTGTGAAGAATATCAATGG - Intergenic
1028624524 7:92863065-92863087 AGTAGATTGCAGAAGATGTATGG - Intergenic
1030489638 7:110215488-110215510 TGATGTTGGCAGAATATCAAAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031893961 7:127326558-127326580 TGGTGTGAGCAGAAGATCAATGG - Intergenic
1031917269 7:127575233-127575255 AGTTGTTTACAGTCTATCAAGGG - Intergenic
1034170195 7:149056842-149056864 AGGTGCTTGCTGAAGATAAAGGG + Intergenic
1035141378 7:156766044-156766066 AGTTCTTACCAGAATATCAAAGG - Intronic
1035823495 8:2620058-2620080 GGTTTTTTGCAGAAGTTAAAAGG + Intergenic
1037426661 8:18762845-18762867 AGTTGTTTTCTGAAGAGAAAGGG - Intronic
1039134620 8:34307184-34307206 AGATGTTTGCAGAAAAAAAAGGG + Intergenic
1040807524 8:51409746-51409768 AGATGTTTCCAGAAGATCCCGGG + Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1043036256 8:75203849-75203871 AGTTCTTTGAAGAAAGTCAATGG + Intergenic
1044186460 8:89258016-89258038 AGTTCTTTGCAACAGATCAGTGG - Intergenic
1044539815 8:93395943-93395965 AGTGTTTTTCAGAAAATCAATGG + Intergenic
1044721664 8:95156153-95156175 AGTTGTTTGCAGCATATAAATGG - Exonic
1044981948 8:97725049-97725071 AGTTCTGTGCATAAGATCCAAGG - Exonic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047422547 8:124718934-124718956 AGTTTCTTCCAGAAGCTCAAGGG - Intronic
1047799676 8:128295768-128295790 AATTGTTTGCAGACTCTCAAGGG - Intergenic
1047917712 8:129600597-129600619 AGTTCTGTGAAGAATATCAATGG + Intergenic
1047954577 8:129963995-129964017 ATTTATTTCCAGATGATCAAGGG + Intronic
1048503685 8:135001658-135001680 GGTTGTTTTCAAAAGAACAATGG + Intergenic
1048811613 8:138292590-138292612 AGTTCTGTGAAGAATATCAATGG - Intronic
1050259135 9:3822671-3822693 ATTTGTTTGCATAATATCTACGG + Intergenic
1050780399 9:9326547-9326569 TTTTATTTTCAGAAGATCAAGGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052493042 9:29190512-29190534 AGTTGTTTTCAGAAAAACACTGG - Intergenic
1052577239 9:30305954-30305976 AGTTGTGTGCAGAGGATTACAGG - Intergenic
1058703492 9:107620132-107620154 ACTTGTTAAGAGAAGATCAAGGG - Intergenic
1058759048 9:108112177-108112199 AGTTTTTTAAAGAAGATCAAAGG - Intergenic
1058761102 9:108133165-108133187 ACTTGTTTGCCATAGATCAAGGG + Intergenic
1059046863 9:110878442-110878464 TATTGTTTTCAGAAGCTCAAGGG - Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187079192 X:15968456-15968478 AGTTGATTAAAGAAGATCACAGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189190730 X:39101283-39101305 AGTTCTGTGAAGAACATCAATGG + Intergenic
1189573820 X:42328370-42328392 AGTTCTGTGAAGAATATCAATGG - Intergenic
1190126924 X:47714063-47714085 AGTTCTGTGAAGAACATCAATGG - Intergenic
1190390836 X:49929865-49929887 ATTTGTGTGCATAATATCAAAGG + Intronic
1191004061 X:55691497-55691519 AATTCTGTGCAGAAAATCAATGG - Intergenic
1191901367 X:66044007-66044029 ATCTGTTTGCAGAATATCAATGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193244860 X:79216013-79216035 AGTTCTGTGAAGAAAATCAATGG + Intergenic
1193773492 X:85616144-85616166 AGTTGTGTGAAGAATGTCAATGG + Intergenic
1193782305 X:85718600-85718622 AGTTCTGTGAAGAAAATCAATGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194598294 X:95887559-95887581 AGTTGCTTGGAGCAGATCATGGG + Intergenic
1195104309 X:101588805-101588827 AGTTCTGTGAAGAATATCAATGG + Intergenic
1195657371 X:107345051-107345073 AGTAGTTTGGAGATGATCACAGG + Intergenic
1196652642 X:118183987-118184009 AGTGAGTTGCAGAAGAGCAAAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197451115 X:126619950-126619972 ATTGATTTGCAGAAGACCAAAGG - Intergenic
1197500490 X:127235399-127235421 AATGGTTTGCAAAACATCAAGGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197906684 X:131432869-131432891 AATTGTGTGAAGAAGGTCAATGG - Intergenic
1197971271 X:132117810-132117832 TGTTGTTTGCAATAGCTCAAGGG - Intronic
1199000375 X:142629353-142629375 ATTTCTTTGCAGAATATCATTGG + Intergenic
1199642210 X:149873475-149873497 AGTTGTGTGAAGAATCTCAATGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200857313 Y:7952993-7953015 AGCTGTTTGCAAACAATCAATGG + Intergenic
1201421871 Y:13808252-13808274 AGTTCTTTGAAGAAAGTCAATGG + Intergenic