ID: 1080330740

View in Genome Browser
Species Human (GRCh38)
Location 11:31134387-31134409
Sequence GAGGAGTCCTGTGACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080330740_1080330743 -7 Left 1080330740 11:31134387-31134409 CCCTGAGAGTCACAGGACTCCTC 0: 1
1: 0
2: 2
3: 12
4: 197
Right 1080330743 11:31134403-31134425 ACTCCTCTGATGGCCAAGTTTGG 0: 1
1: 1
2: 6
3: 33
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080330740 Original CRISPR GAGGAGTCCTGTGACTCTCA GGG (reversed) Intronic
900012834 1:131463-131485 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900042899 1:487450-487472 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
900064336 1:722447-722469 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
901436711 1:9251060-9251082 CAGGGGGGCTGTGACTCTCAGGG - Intronic
904510757 1:31005014-31005036 GAAGATTCATGTGCCTCTCATGG + Intronic
904702980 1:32369282-32369304 GAAGATTTCTGTGACTCTCTTGG - Intronic
906442732 1:45863272-45863294 GAGGAGTTCTATGACTTTAAAGG + Intronic
910766174 1:90784643-90784665 GAGGAGTGTTGTGACCATCAGGG + Intergenic
911743203 1:101410580-101410602 GAAGAGCCCTGTGGCTCTCTTGG + Intergenic
914997667 1:152559152-152559174 CAGGTGTCCTGTGACTGTGAAGG - Intronic
916503106 1:165403886-165403908 GAGGAATGCTGTGACGTTCATGG - Intronic
919012557 1:191983754-191983776 CAGGAGTCCCTTGACCCTCATGG - Intergenic
919376785 1:196805066-196805088 GGTGACTCCTGTCACTCTCAGGG - Intergenic
919386489 1:196929946-196929968 GGTGACTCCTGTCACTCTCAGGG - Intronic
919389260 1:196961865-196961887 GGTGACTCCTGTCACTCTCAGGG - Intergenic
920906386 1:210173818-210173840 CAGGAGTTCTGTGGCTCTCACGG + Intergenic
920914523 1:210249397-210249419 GAGAAGTCCTGGGACCCCCATGG - Intergenic
922099235 1:222468459-222468481 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
922261273 1:223947953-223947975 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1062938144 10:1402973-1402995 GCTGAGTCCTGTGCCCCTCACGG - Intronic
1064008309 10:11715207-11715229 GAGGATTCCAGTGTCTCTCCAGG - Intergenic
1065254197 10:23848774-23848796 GTGGAGCCATGTGACTCTCCAGG - Intronic
1065784612 10:29201878-29201900 AAGGAGCCCTGTGACTCACGTGG + Intergenic
1065940858 10:30562923-30562945 CAGGAGTCCTTTGAACCTCAGGG - Intergenic
1066734037 10:38455422-38455444 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1069060925 10:63893769-63893791 GAGGAGAGCTGTGAATCTTATGG - Intergenic
1070875279 10:79799549-79799571 AAGGAGTCCTGTGACTCATTTGG - Intergenic
1072258404 10:93642962-93642984 GAGGACTTCAGTGACTGTCAGGG - Intronic
1072905466 10:99449268-99449290 GAGGAGTTCTCTGCCTCCCAGGG + Intergenic
1076820906 10:132939105-132939127 AAGGCCTCCTCTGACTCTCAAGG + Intronic
1076969172 11:123667-123689 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1079252308 11:18795258-18795280 GAAGAGTCCTGTGAGGCCCATGG + Intergenic
1080330740 11:31134387-31134409 GAGGAGTCCTGTGACTCTCAGGG - Intronic
1080350014 11:31372916-31372938 GAGTAGTCCAGTGATTCTCATGG - Intronic
1080564568 11:33496307-33496329 AGGAAGTCCTGTGACTCTAAGGG - Intergenic
1080693664 11:34581975-34581997 GTGGATCCCTGTGATTCTCAGGG + Intergenic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083373247 11:62198683-62198705 CCGGAGTCCTGTGAGTATCATGG - Intergenic
1083383952 11:62293666-62293688 CAGGAGTCCTGTGAGTATCATGG + Intergenic
1085986678 11:81796002-81796024 GAGGAGGCCTGTGTCTGCCATGG - Intergenic
1086172080 11:83848048-83848070 GAGGGGTCCTTTGTCTCTCTAGG + Intronic
1086492809 11:87372415-87372437 GAGAACTCCTGTTTCTCTCAAGG + Intergenic
1086784748 11:90954283-90954305 GAGGAGTCATGTAAGTATCAGGG + Intergenic
1088590994 11:111403084-111403106 GAGCAGCCCTGTGACTCTTGGGG - Intronic
1090611220 11:128472678-128472700 GAGGAGCTCTGTGTCTCACAGGG - Intronic
1091407703 12:219700-219722 GGTGTGTCCTGTGACTCTTAGGG - Intergenic
1091625305 12:2116829-2116851 CAGGACTGCTGTGTCTCTCAAGG + Intronic
1091659479 12:2372802-2372824 GAGAAGTCCTGTCAGCCTCAGGG + Intronic
1095493128 12:42757163-42757185 CAGGAGGCCTATGACTCGCACGG + Intergenic
1096038809 12:48496079-48496101 GAGGACTGCTTTTACTCTCAGGG + Intronic
1100797759 12:98200225-98200247 GATGAGTCCTCTGTCACTCAAGG + Intergenic
1101305603 12:103524771-103524793 GAGGTGTCCTGTAACTGTCTTGG - Intergenic
1102034373 12:109762431-109762453 GTGGCGCCGTGTGACTCTCATGG - Intronic
1102417756 12:112779304-112779326 GAGGAGTCCCATGTCTCCCAGGG + Intronic
1103480214 12:121245697-121245719 GAGGGGCCCAGTGACTCTTATGG - Intronic
1103815280 12:123650053-123650075 CTGGAGGCCAGTGACTCTCAAGG - Intronic
1104564961 12:129872283-129872305 TAGGAGTTCTGTGCCTCCCAAGG - Intronic
1104747175 12:131218174-131218196 GAGGACTTCGGTGCCTCTCAGGG - Intergenic
1108093672 13:46878309-46878331 GAGGAATTCTGTGAGTCTAATGG + Intronic
1110925038 13:81140397-81140419 CAGGAATTCTGTGACTCCCATGG + Intergenic
1113809536 13:113129855-113129877 CAGAAGCCCTGTGACCCTCAAGG - Intronic
1114404129 14:22439091-22439113 GAAGAGTCCTCTGAGTGTCATGG + Intergenic
1114805978 14:25837553-25837575 GAGGATTTCTGTGACTCTGCTGG - Intergenic
1116188650 14:41634087-41634109 GAAGAATCCTGTGACACTGAAGG - Intronic
1121656000 14:95596133-95596155 GAGGTGTCCCGTGTCTCTCAGGG + Intergenic
1123122261 14:105922136-105922158 GATGCGTCCTGTGACTGTCTTGG + Intronic
1123455573 15:20420788-20420810 GAGCAGACCTGTGACTATGAGGG + Intergenic
1125796041 15:42404645-42404667 GAGGAGTCTTGTGACTGCCTTGG + Intronic
1126106447 15:45150057-45150079 CAGGAGTCCTGGGAATCTCTGGG - Intronic
1127647838 15:60975387-60975409 GCTGAGTCCTGTCACTGTCAAGG + Intronic
1127684383 15:61327617-61327639 GAGGAGTCCACTGATTATCAGGG + Intergenic
1128579449 15:68798619-68798641 GGAGAGTCCTGTGACTTTGAGGG - Intronic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1133143584 16:3766917-3766939 GTGGAGTACAGTGAATCTCAGGG - Intronic
1134259454 16:12639227-12639249 GAGGAGTCCTGTTGCTATCTCGG - Intergenic
1135698365 16:24610231-24610253 GAGGCGGCATGTGACTCCCAGGG + Intergenic
1135949398 16:26899239-26899261 GAGGAAACAAGTGACTCTCACGG + Intergenic
1137248937 16:46729201-46729223 GAGGAGTTCTGTGTCTGTCTTGG - Intronic
1139148839 16:64355566-64355588 CAGGTAGCCTGTGACTCTCAAGG - Intergenic
1139489806 16:67280069-67280091 GATGAGTCCCCAGACTCTCAGGG + Exonic
1140420383 16:74814286-74814308 GAGGAGGCATGTGGATCTCAGGG + Intergenic
1141110386 16:81266676-81266698 GAGGAGGACTGTGAGGCTCAGGG + Intronic
1142451503 16:90175455-90175477 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1144124440 17:12189546-12189568 GAGGAGTGCTGTTCCTCACATGG + Intergenic
1145040028 17:19570875-19570897 GAAAAGCCCTGTGAATCTCAAGG - Intronic
1145761236 17:27426348-27426370 GAGGGGTCCGGTGACTCTCATGG + Intergenic
1145798298 17:27668369-27668391 GAGGGGTCAGGTGACCCTCATGG - Intergenic
1146161279 17:30560505-30560527 GAGGGGTCGGGTGACCCTCATGG + Intronic
1149387152 17:56153491-56153513 GCTCAGTCCTGTGTCTCTCATGG + Exonic
1151368983 17:73635549-73635571 GCGGACACCAGTGACTCTCAAGG - Intronic
1152585401 17:81187297-81187319 GAAGAGGCCTGGGACACTCATGG - Intergenic
1157487019 18:48095191-48095213 AAGGAGTCCTTGGATTCTCATGG + Intronic
1159818881 18:73114394-73114416 CAGGAGGCTTGTGTCTCTCACGG - Intergenic
1160645977 19:193593-193615 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1161048344 19:2149210-2149232 GAGGAAGCCTGGGACTTTCAAGG + Intronic
1164524978 19:29007029-29007051 GAGGAGAGCTGTCACTCCCAGGG - Intergenic
1164826328 19:31287424-31287446 AAGGAGCCCTGTGACTGTGATGG + Intronic
1166696465 19:44854485-44854507 GAGCAGTCCTGTGGCTTCCAGGG - Intronic
1168544768 19:57240992-57241014 GAGGAATCCTGTGGCTGTCTTGG - Intronic
925465282 2:4102520-4102542 GGGGTGTCCTGTGACCCTCTGGG - Intergenic
925538825 2:4944501-4944523 GAGGAGTTCTGGAACTCTGAAGG + Intergenic
926871698 2:17425832-17425854 GAGTAGTCTTATCACTCTCATGG + Intergenic
929575248 2:43047538-43047560 GAAGAGGCCTGTGACTTTCCCGG - Intergenic
935725483 2:106020372-106020394 GAGGAGTCCTGCCAGGCTCAGGG + Intergenic
936751315 2:115645407-115645429 GATGAGTCCTGTGATACTCAGGG + Intronic
939761795 2:146191643-146191665 AAGGAGTGCTGTGATTCTAAGGG - Intergenic
941740293 2:169028542-169028564 AAGGAGCCCAGTGAATCTCAGGG + Intronic
942063819 2:172251839-172251861 GCTGAGTCCTGAGACTCTCAGGG - Intergenic
945425505 2:209695552-209695574 GAGGAGTCCTATGAATCTAGTGG + Exonic
947363479 2:229370020-229370042 GAAGAGTCCTGTGGATTTCATGG - Intronic
947783347 2:232791071-232791093 GAGGAGTGCTCTGACTCTGAGGG + Exonic
949042176 2:241854480-241854502 GTGGGGTAGTGTGACTCTCAGGG + Intronic
1168909373 20:1434757-1434779 GAGGGGTAGTGTGACTATCAAGG + Intergenic
1172011991 20:31850932-31850954 GAGGAGGCCTGTGACTCCTCAGG + Intronic
1172397117 20:34616054-34616076 GAGGAGTCCTGGGACAAACAAGG + Exonic
1173413634 20:42837294-42837316 GAGGGGACCTGTGAGTGTCAGGG - Intronic
1174064068 20:47852149-47852171 CAGGAGCCCTGTGGCTGTCATGG + Intergenic
1174113768 20:48213542-48213564 GAGGAGCGCTGATACTCTCATGG + Intergenic
1174168083 20:48599000-48599022 GAGGAGCGCTGATACTCTCATGG - Intergenic
1175844302 20:62050639-62050661 CCGGAGCCCTGTGGCTCTCATGG - Intronic
1176046615 20:63096287-63096309 GAGGAGGGATGAGACTCTCAAGG + Intergenic
1176279529 20:64292623-64292645 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1177118556 21:17114167-17114189 GTGGATGCCTGTGACTCTGATGG - Intergenic
1177785277 21:25664760-25664782 AAGGAGCACTGTGACTCTCTAGG - Intronic
1181473989 22:23157606-23157628 GACGAGACCTGTAGCTCTCAGGG - Intronic
1183264847 22:36818823-36818845 GTGGAGTTCAGTGACTCTCTGGG + Intronic
1184790315 22:46695961-46695983 GCCGTGTCCTGTGAGTCTCAGGG + Intronic
949887630 3:8709066-8709088 CAGGACTCTTGTGAGTCTCAGGG - Intronic
950433448 3:12965165-12965187 GAAGAGTCCTGTGTTTCACAAGG + Intronic
950528943 3:13541308-13541330 AAGGAGTCCTGGGTCTCTCTGGG + Intergenic
950678018 3:14566222-14566244 TAAGAGCCCTGTGGCTCTCATGG - Intergenic
951435940 3:22664549-22664571 CAGGGGTGCTGTGACTCTCTGGG + Intergenic
956105601 3:65814666-65814688 GAGCAGTCCTGTGATTTTGAGGG - Intronic
956484833 3:69711254-69711276 GAGGAGTCCTGTGCCCCCCAAGG + Intergenic
956798918 3:72739409-72739431 GAGGTGGCCTGAGTCTCTCAAGG - Intergenic
961477964 3:127160417-127160439 GAGGAATCTTGTGACTCTCAGGG - Intergenic
962455827 3:135564788-135564810 GAGGATTCCAATGTCTCTCATGG + Intergenic
962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG + Intergenic
968228023 3:196988157-196988179 TTGGAGTCCTGAGACTCTCCTGG + Intergenic
968371704 3:198225933-198225955 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
969550793 4:7865822-7865844 CAGTGGTCCTGTGACTGTCATGG - Intronic
969698017 4:8746247-8746269 GAGGAGGCATTTGACACTCACGG - Intergenic
971220398 4:24700361-24700383 GAGCAGGCCTGTGGCTATCAGGG + Intergenic
973329420 4:48897166-48897188 CCGGAGTCCTGTGTCTCCCAAGG - Intronic
974319386 4:60326436-60326458 GAGGATTAATGTGACTTTCAAGG + Intergenic
978765569 4:112401685-112401707 CAGGATCCCTGTGAATCTCATGG - Intronic
979260392 4:118638411-118638433 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
982130385 4:152224075-152224097 GAGGAGCCCAGTGACCCACATGG + Intergenic
988201029 5:28068234-28068256 GAGGCCTCCTGTTAGTCTCATGG - Intergenic
992181476 5:74202064-74202086 GAGAAGTCCTGTCTCTCCCAGGG - Intergenic
992745332 5:79815093-79815115 GATAAATGCTGTGACTCTCAAGG + Intergenic
997888012 5:137648709-137648731 GCAGAGTCCTGTTCCTCTCAGGG + Intronic
1000045177 5:157516421-157516443 GAGGTGTGCTGTGACTCTGGAGG + Intronic
1000559956 5:162774238-162774260 GAGGAGCCCTGTAACTATTAAGG - Intergenic
1001552820 5:172616976-172616998 GAGCAGCCCTGGGTCTCTCAGGG - Intergenic
1001814234 5:174654637-174654659 GAGGGGTCATGTGACTCTCCTGG - Intergenic
1002730944 5:181331479-181331501 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1002753589 6:142625-142647 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1003158725 6:3617949-3617971 GCTGAGTCCTGAGACTCTCACGG - Intergenic
1004032174 6:11881398-11881420 GAGGAGTCCTGAGTATCTCAGGG + Intergenic
1008491306 6:52089863-52089885 GAGGAGTCCTGTGTCTCCTCTGG - Intergenic
1011691548 6:89874763-89874785 GAGAAGTTCTGTGAGTCTGAAGG - Intergenic
1014457784 6:121656529-121656551 GATTACTCCTGTAACTCTCATGG + Intergenic
1016684545 6:146866492-146866514 GAGGATCTCTGTGACTCTCCAGG - Intergenic
1017804233 6:157929457-157929479 GAGAAGTCCTAGGACTCTAAGGG - Intronic
1017978220 6:159376119-159376141 GAGGACTGCTGTGACCCACAGGG - Intergenic
1020645975 7:10814731-10814753 GAGAAGCTCTGTGCCTCTCAAGG + Intergenic
1021633366 7:22667564-22667586 GAAAAGCCCTGTGACTCTGAGGG + Intergenic
1022776401 7:33532018-33532040 GAGAACTCCAGTCACTCTCAGGG + Intronic
1023402108 7:39798011-39798033 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1024076087 7:45818641-45818663 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1025051349 7:55737144-55737166 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1025060117 7:55798399-55798421 GAGGAGCCCTGGGCCCCTCAGGG + Intronic
1025176699 7:56805692-56805714 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic
1025242356 7:57287809-57287831 GCAGAGCCCTGGGACTCTCAGGG - Intergenic
1025244723 7:57308572-57308594 GACAAATCCTGTGACTCTCCTGG - Intergenic
1026167756 7:67925439-67925461 GCAGAGCCCTGGGACTCTCAGGG - Intergenic
1030617203 7:111750524-111750546 GAGGAACCCTGTGAACCTCAGGG + Intronic
1031922921 7:127614550-127614572 GAGGAGACCTGGGAGTGTCAGGG + Exonic
1032052622 7:128658404-128658426 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1032568849 7:132978041-132978063 GGTGAGTCCTGTTATTCTCATGG + Intronic
1035971037 8:4249523-4249545 GACGTGCACTGTGACTCTCAGGG + Intronic
1038130070 8:24720215-24720237 TTGGAGTCCAGAGACTCTCAAGG - Intergenic
1038253449 8:25927680-25927702 GAGGAGTCCTGTGATTGGCTTGG + Intronic
1039101286 8:33944716-33944738 GAGGAGTGCTTTGTCTCCCAGGG + Intergenic
1039445163 8:37625275-37625297 GAGCAGTGCTGTTATTCTCATGG + Intergenic
1039449621 8:37661591-37661613 TAGGAGTCCTTTGCCTCTCAAGG + Intergenic
1040287151 8:46106240-46106262 CAGGGTTCCTGTGTCTCTCACGG - Intergenic
1040311295 8:46238181-46238203 CAGGATGCCTGTGTCTCTCACGG + Intergenic
1040311384 8:46238614-46238636 CAGGATGCCTGTGTCTCTCACGG + Intergenic
1040329267 8:46377647-46377669 CAGGATTCCTGTGTCTCTCGCGG + Intergenic
1040330919 8:46385368-46385390 CAGGATGCCTGTGTCTCTCAAGG + Intergenic
1040335095 8:46412070-46412092 GTAGGGTCCTGTGCCTCTCACGG + Intergenic
1040361648 8:46670457-46670479 GAGGATTCCTGAGACTCTTTTGG - Intergenic
1043922024 8:85994254-85994276 GAGATGCCCTGTGACTCTCCTGG + Intronic
1044607740 8:94061794-94061816 GAAGAGGCCTGAGAATCTCAAGG - Intergenic
1044607956 8:94063484-94063506 GAAGAGGCCTGAGAATCTCAAGG - Intergenic
1049880334 8:145057650-145057672 AAGGGATCCTGTGACTCTAATGG - Intergenic
1049927314 9:421775-421797 GAGGATTCCTGTGAAACTCTGGG - Intronic
1052656731 9:31372930-31372952 GAGTAGTCATGGGAATCTCAAGG + Intergenic
1056759855 9:89406744-89406766 CAGGAGTCCTGTGAGGGTCATGG + Intronic
1061922828 9:133791427-133791449 GAGGAGAACTGTGTCTCCCAGGG - Intronic
1062501923 9:136855373-136855395 GGGGAGTGCTGTGCCTCTCCAGG - Intronic
1062755350 9:138283986-138284008 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1203579263 Un_KI270745v1:28158-28180 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1188961012 X:36491345-36491367 GGTGAGGCATGTGACTCTCAGGG + Intergenic
1189379763 X:40494180-40494202 AAGGAGTCCTCTGACTCATAAGG - Intergenic
1196158949 X:112461729-112461751 GAAGAGACTTGTGGCTCTCAAGG - Intergenic
1196456315 X:115893765-115893787 GAGGACTCCTGTGTGTCACAGGG + Intergenic
1202381871 Y:24280780-24280802 GAGGAGCCCTGGGCCCCTCAGGG - Intergenic
1202488913 Y:25389345-25389367 GAGGAGCCCTGGGCCCCTCAGGG + Intergenic