ID: 1080331371

View in Genome Browser
Species Human (GRCh38)
Location 11:31143596-31143618
Sequence CTCAGTTCTCAGCTCTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080331370_1080331371 7 Left 1080331370 11:31143566-31143588 CCAGTCTTACAATGCAGGCAGAA 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG 0: 1
1: 0
2: 2
3: 21
4: 216
1080331367_1080331371 15 Left 1080331367 11:31143558-31143580 CCAAGAGCCCAGTCTTACAATGC 0: 1
1: 0
2: 2
3: 5
4: 108
Right 1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG 0: 1
1: 0
2: 2
3: 21
4: 216
1080331369_1080331371 8 Left 1080331369 11:31143565-31143587 CCCAGTCTTACAATGCAGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG 0: 1
1: 0
2: 2
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080331371 Original CRISPR CTCAGTTCTCAGCTCTGCAT TGG Intronic
900155086 1:1200713-1200735 CTCAGAGCTCAGCCCAGCATCGG + Intergenic
900522713 1:3113387-3113409 CTCAGTCCTCAGCTGGGCAGGGG + Intronic
901587677 1:10311688-10311710 CACAGTTGTCTGCTCTTCATGGG + Intronic
902156788 1:14494136-14494158 TTCAGTGCTCAGCCCTGGATGGG - Intergenic
902625966 1:17676537-17676559 CTCTGCTCTGAGCTCTGCATAGG - Intronic
905801844 1:40849290-40849312 CTCAGCTCTGGGCTCTGCCTTGG - Intergenic
906208657 1:44000320-44000342 GTCAGAGGTCAGCTCTGCATGGG - Intronic
906436290 1:45799519-45799541 CTCAGTTCTGAGCTCTACACTGG + Intronic
906923572 1:50090562-50090584 CTCATTTCACAGTTCAGCATGGG + Intronic
908675110 1:66594778-66594800 CTCAGTCCTCATCTATACATGGG + Intronic
909709011 1:78622744-78622766 CTCAGTTCTCAGTTAGTCATTGG - Intronic
910327278 1:86025159-86025181 CTCAGTTCTCAGTTCTACCAAGG + Intronic
910505917 1:87950060-87950082 CTGAGTTCTAAGCACTGCGTAGG - Intergenic
910732265 1:90411082-90411104 CTCAGTGTTCAGCTCTGTCTGGG - Intergenic
911275578 1:95853880-95853902 CTCTGTCCTCTGCTCTGCTTTGG - Intergenic
911601314 1:99850528-99850550 CTCTGTTCTCATCTCCCCATTGG + Exonic
914384780 1:147157960-147157982 CTGTGTTATCAGCTTTGCATGGG + Exonic
916215334 1:162388863-162388885 CTCAGTTCGCCGCCCTGCTTTGG + Intergenic
916507734 1:165443341-165443363 AGCAATTCTCAGCTCTGAATGGG + Intronic
918171311 1:182000139-182000161 CTCAGTTTTCTTATCTGCATTGG - Intergenic
918785999 1:188764154-188764176 CTCAGTGCTGGGCTCTGAATGGG + Intergenic
918953232 1:191168767-191168789 CTTAGTACTCTGCTATGCATAGG + Intergenic
919690788 1:200526912-200526934 ACCAGTTCTCAGCTCCCCATGGG - Intergenic
920054643 1:203183290-203183312 AGCAGCTCTCAGCTCTGCCTGGG - Intronic
920154260 1:203935592-203935614 CTCATTTCTCAGATCTGCAAGGG - Intergenic
924386455 1:243502760-243502782 CTCAGTTCCCAGCCATGCCTGGG - Exonic
1062947832 10:1474505-1474527 CTCAGTTCACAGTCCTGCTTGGG - Intronic
1063375933 10:5554151-5554173 CACAGGTCTCAGCTCCCCATGGG + Intergenic
1065240522 10:23699226-23699248 CTGACTTCACAGCTCTGCCTAGG - Intronic
1067414288 10:46091914-46091936 CCCCATCCTCAGCTCTGCATCGG + Intergenic
1067414979 10:46095986-46096008 CACAGTTCTCAGAACTCCATGGG + Intergenic
1067435025 10:46270566-46270588 CACAGTTCTCAGAACTCCATGGG + Intergenic
1067438729 10:46296431-46296453 CACAGTTCTCAGAACTCCATGGG - Intronic
1067439348 10:46299900-46299922 CCCTGCCCTCAGCTCTGCATGGG - Intronic
1067576093 10:47409540-47409562 CCCCATCCTCAGCTCTGCATGGG - Intergenic
1067581600 10:47449971-47449993 CCCCATCCTCAGCTCTGCATCGG - Intergenic
1068114656 10:52723992-52724014 GTAAATTCTCAGCTCTGCACCGG + Intergenic
1069064002 10:63923654-63923676 CACAGATGTCAGCTCTACATTGG + Intergenic
1070011591 10:72480496-72480518 CTCACTCCTCAGTTTTGCATGGG - Intronic
1071202585 10:83236548-83236570 CTCTCTTCTCAACTCAGCATTGG - Intergenic
1073558839 10:104480195-104480217 TTCAGCTTCCAGCTCTGCATTGG + Intergenic
1074162469 10:110845849-110845871 CTTTGTTCTCAGCTCTGCCTGGG - Intergenic
1075800170 10:125148857-125148879 CTCATTTCTCAGCTAAGCCTGGG - Intronic
1075839984 10:125493554-125493576 CTCAGTTAGCAGCTCTGCAGAGG + Intergenic
1076607401 10:131697934-131697956 CTCAGTTTCCACCTCTGCAAAGG + Intergenic
1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG + Intronic
1081487102 11:43539249-43539271 CTGAGTTAGCAGCTCTGCAAAGG - Intergenic
1083300609 11:61737954-61737976 CTCACTCCTCAGCTCTGCTCTGG + Intronic
1083576875 11:63798330-63798352 TCCAGCTCTCAGCCCTGCATGGG + Intergenic
1085443090 11:76580540-76580562 CTCAGTCCTCAGCTCTGTGAGGG + Intergenic
1086100405 11:83093203-83093225 CTCAGTTTTCAGCCCTGCTTAGG - Intergenic
1086772377 11:90783178-90783200 CTTTGCTCTCAGCTCTGCTTTGG + Intergenic
1088742495 11:112778460-112778482 CTCAGTTCTGTTCTCAGCATGGG - Intergenic
1089268782 11:117286789-117286811 CTGAGTACTCAGCTCTTCAGAGG + Exonic
1089894996 11:121921264-121921286 CTGAGTACTCAGCTCTGGGTGGG + Intergenic
1091368311 11:135039635-135039657 CTCAGTTCCCAGCTCCACTTGGG - Intergenic
1091545341 12:1498065-1498087 TTCAGTTCTGAGCACTGCACAGG + Intergenic
1093860124 12:24155222-24155244 CTAAATTCTCATCTCTACATAGG - Intergenic
1095955485 12:47803370-47803392 CTCATTTCTCGGCTCTGAAGAGG - Intronic
1097108052 12:56636639-56636661 TTCAGTTCCCAGGTCTGTATCGG + Intronic
1097705203 12:62861189-62861211 CTCATTTCTCTCCTCTGAATCGG + Intronic
1097750515 12:63347531-63347553 TTCAGCTCTCAGATCTGCAAAGG + Intergenic
1097986463 12:65787667-65787689 CTCAGCTGTCAGCTCTCTATGGG - Intergenic
1097994109 12:65868951-65868973 CTCAGTTCTACGCAATGCATTGG - Intronic
1101231881 12:102749775-102749797 CTTAGTTCTCAGCAATGCAGTGG - Intergenic
1101849237 12:108389049-108389071 CTCAGTCCTGAGCCCTGCAGGGG - Intergenic
1104031448 12:125067989-125068011 CCCAGTGCTCAGCTCTGCCCTGG + Intronic
1106358783 13:29010703-29010725 CACAGTTTTCAGCTCTCAATGGG - Intronic
1106559081 13:30833319-30833341 CTCAGTGTTCAGGTCTGCAGGGG - Intergenic
1108245065 13:48505841-48505863 TTCGGTTCTCAGCTCTGCCAAGG - Intronic
1108465780 13:50714185-50714207 CTCCCTTCTCACCTCTGCCTTGG + Intronic
1110470437 13:75854066-75854088 CTCAGATATCAGCCCTGCTTGGG + Intronic
1110779786 13:79451640-79451662 CCCAGTTTTCAGCTCTGCTGAGG - Intergenic
1112786990 13:102961920-102961942 CTCAGTTCTCCCCTCTCTATTGG + Intergenic
1113304456 13:109061734-109061756 TTCACTTCTCTGCTTTGCATTGG - Intronic
1115474047 14:33797307-33797329 ATCATTTCTCAGCTCTTCATGGG - Intronic
1115875744 14:37859409-37859431 CTCAGTCCTCAGCTCATCACAGG + Intronic
1115910359 14:38249829-38249851 CTCAGTTTACAGTTCTGCCTTGG - Intergenic
1118593770 14:67420373-67420395 CTTCGTTCACAGCTCTGCCTTGG - Intergenic
1119982433 14:79097068-79097090 CTCATTTCTTAGCTCTTCAAAGG + Intronic
1120815509 14:88853144-88853166 CACAGTTCTCATTTCTTCATGGG - Intronic
1120860378 14:89249981-89250003 CTCACTTCTCAGCTCTGCCCAGG - Intronic
1121078006 14:91085317-91085339 CTCAGTCCTGACCTCTGCCTGGG + Intronic
1121563539 14:94892316-94892338 CTCAGATCTCAGCTCAGAAAAGG + Intergenic
1123053117 14:105556961-105556983 CTCAGTTCTTAACACAGCATGGG - Intergenic
1123077693 14:105677375-105677397 CTCAGTTCTTAACACAGCATGGG - Intergenic
1124099017 15:26675926-26675948 GTCAGTGTTCATCTCTGCATTGG - Intronic
1126102351 15:45126808-45126830 CCCAGTCCTTAGCTCTGTATTGG - Intronic
1126320112 15:47412838-47412860 CTCTGTTTTCAATTCTGCATGGG + Intronic
1126795810 15:52259890-52259912 CTCAGCTCTCCCCTTTGCATGGG + Intronic
1127992559 15:64131570-64131592 CTCAGTTCCCAGATATGCAGTGG + Intronic
1128816829 15:70616134-70616156 TTCTGTGCTCAGCTCTGCAATGG - Intergenic
1129159405 15:73739110-73739132 CACAGATCTCAGGTCTGCTTAGG + Exonic
1129274431 15:74435730-74435752 CTCAGTTTTCTTCTCTGCAGTGG - Intergenic
1129749214 15:78048858-78048880 CACAGTTCTGTGCTCTGCAGAGG - Intronic
1130046034 15:80445642-80445664 CTCAGGACTCAGCTCCGCACAGG + Intronic
1130112598 15:80977913-80977935 CTCAGTTCTCTGCTTTGGATGGG - Exonic
1130549890 15:84883707-84883729 CTCATTTCTTAGCTCTTCACAGG - Intergenic
1132947975 16:2543170-2543192 CTCACTTTTCAGTTCTGCCTCGG + Intronic
1132966472 16:2658172-2658194 CTCACTTTTCAGTTCTGCCTCGG - Intergenic
1133108410 16:3530313-3530335 CTCACTTCTCAGGTCTGTATTGG + Intronic
1134182810 16:12061406-12061428 TTCTGTTCTCAGCCCTGCCTTGG + Intronic
1137512129 16:49110364-49110386 GTCAGTTCTGAACTCTGCAATGG - Intergenic
1139652706 16:68370653-68370675 CTCGGTGCTCATCCCTGCATTGG + Intronic
1141285456 16:82667641-82667663 GTCACATCTCAGCTCTGCCTGGG - Intronic
1141640496 16:85338192-85338214 CTCCTTTCTCATCTCTGCACCGG + Intergenic
1141861591 16:86720365-86720387 ATCAGTTCTCTCTTCTGCATGGG + Intergenic
1143330576 17:6132000-6132022 CTCAGCTCTGAGAGCTGCATTGG + Intergenic
1143568579 17:7740325-7740347 CTCTGTCCTCAGCAATGCATGGG + Intronic
1146564014 17:33896483-33896505 GTCAGTCCTCAGCTGTGCAATGG + Intronic
1148441059 17:47711777-47711799 CCCAGGTCTCAGCTCTGGGTGGG + Exonic
1150598343 17:66627000-66627022 CTTAATTCTCTGCTCTGCAGAGG - Intronic
1151445132 17:74158725-74158747 ATCAGTTGTCAGCTTTGCTTAGG - Intergenic
1151508051 17:74542225-74542247 CTCAGCTCTCAGCTCCTCAGAGG + Intronic
1151509557 17:74550013-74550035 CTCAGCTCTCAGCTCCTCAGAGG + Intergenic
1156914026 18:42444309-42444331 CTCAGTTTTCAGCATTGCAATGG - Intergenic
1159248917 18:65848230-65848252 CTCATTTCTCATGTCAGCATTGG + Intronic
1160579024 18:79873305-79873327 CTCAGTTCTGTGCCCTGCAGGGG + Intronic
1164572818 19:29386480-29386502 CCCTGGTCTCATCTCTGCATGGG - Intergenic
1167505611 19:49869627-49869649 CTGAGTTCTAAGCTCTAAATGGG - Exonic
925422578 2:3724868-3724890 CTCACTTCCCAGCTCTGCCCTGG - Intronic
925444936 2:3919545-3919567 CACAGCTCTCAGCTGTGCAATGG - Intergenic
925636401 2:5945426-5945448 CTTAGTTCTTTGCTCTGCACAGG - Intergenic
927325986 2:21805815-21805837 CTCAAGTCTCACCTCAGCATTGG - Intergenic
928186840 2:29117858-29117880 CTAAGTTCTAAGCTATGCAAAGG - Intronic
928393991 2:30930298-30930320 CTCAGGTCCCAGCTCTCCAAGGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
931644183 2:64406509-64406531 CCCAGCTCTCAGCTCTACAGAGG - Intergenic
931988689 2:67767345-67767367 TTCCTTTCTCAGCTCTGCAGAGG - Intergenic
935399483 2:102644931-102644953 CACAGTGCTCAGCTCTGCAAAGG + Intronic
939329405 2:140737964-140737986 CTCTGTTTTCATCTCTGCATTGG - Intronic
939728724 2:145755127-145755149 CTCAATTCCAAGCTCTGCAGAGG - Intergenic
941278973 2:163526258-163526280 CTCATTGCTCACCTCTGCATGGG - Intergenic
942930297 2:181484067-181484089 CTCATTTCTCAACTCTGAAATGG + Intronic
945364534 2:208935334-208935356 CCCAGTACTCAGCTCATCATGGG - Intergenic
946071779 2:217040291-217040313 ATGAGTTTTCAGCTCTCCATAGG - Intergenic
946359226 2:219209175-219209197 CTCATTTCAGAGCTCAGCATGGG - Intronic
947746578 2:232511128-232511150 CCCAGTTCTCAGTGCAGCATGGG + Intergenic
948962107 2:241347459-241347481 CACAGTTCTCAGGTGTGCTTGGG + Intronic
1169395021 20:5221458-5221480 CTCAGTCCTCATCTTTGCCTTGG + Intergenic
1170049141 20:12122386-12122408 CTCTGTTATCAGCAATGCATGGG - Intergenic
1171088393 20:22261119-22261141 CTCCCTTCTCAGCTATGCTTGGG - Intergenic
1173018282 20:39246260-39246282 CCAAGTTCTGAGCTATGCATGGG - Intergenic
1174160234 20:48545363-48545385 CTCAGTTCCCATCTCTGCCCAGG + Intergenic
1175385287 20:58591021-58591043 CTCAGTTCTCGGCCCAGCCTGGG - Intergenic
1175728709 20:61337168-61337190 CTAAGTTCTCAGGTATCCATGGG - Intronic
1176684713 21:9837891-9837913 CTCCGGTCTCACCTCTCCATGGG - Intergenic
1178127534 21:29531261-29531283 CTCAGTTCTTATCCCTACATTGG + Intronic
1179411319 21:41165815-41165837 CTCCTTTCTCTGCCCTGCATCGG + Intergenic
1180151196 21:45948956-45948978 CACAGTTCTCAGCCCTGCCCGGG + Intergenic
1181130181 22:20726631-20726653 CCCAGTTCTCAGCCCTGCTGTGG - Intronic
1183355286 22:37355531-37355553 CTCAGACCTCACCTCTGCAGCGG + Intergenic
1184692970 22:46125709-46125731 ACCAGGGCTCAGCTCTGCATGGG + Intergenic
950546322 3:13640143-13640165 CTCAGTTCTGACCTCTGCGAGGG - Intergenic
951853626 3:27170336-27170358 CCCAGTTCTCATCTCAACATTGG + Intronic
952719771 3:36520440-36520462 CTCTGTGCACAGGTCTGCATTGG + Intronic
953795910 3:45985746-45985768 CTGAGTTATCAGCCCTACATGGG + Intronic
956129714 3:66041482-66041504 CTCAACTCTCACCTCTGCCTGGG + Intergenic
956605402 3:71068356-71068378 CTCCATTCTCAGCTCTGAATGGG - Intronic
961988936 3:131166949-131166971 TGCAGTTCTCAGCACTGCAGGGG - Intronic
962358309 3:134713901-134713923 CACAGTTCTGAGCTCTGGACAGG - Intronic
962652373 3:137509558-137509580 GGCAGTTCTCAGCTCTGAGTAGG + Intergenic
962919480 3:139937270-139937292 CTGAGTTCTCAGGTCAGAATGGG + Intronic
965053415 3:163681841-163681863 CTAAGCTCTCAGCTCTTCCTTGG + Intergenic
966882653 3:184358963-184358985 CCCAGTTCTCACCGCGGCATCGG + Exonic
967680197 3:192353187-192353209 CTCAGTCCTCAGCTCTTTCTAGG + Intronic
967723505 3:192839999-192840021 CTCTTTTCTTATCTCTGCATAGG - Intronic
967915161 3:194573094-194573116 CTCAGGTCTCAGCTCCTGATCGG - Intergenic
969578096 4:8048140-8048162 CTCAGTCCCCAGCTCTGCGATGG + Intronic
973125811 4:46583118-46583140 CTCATTTCTGAGGTCTGAATGGG - Intergenic
975925521 4:79446360-79446382 CTCAGTTCTCAGCAGTGGAGGGG + Intergenic
976549771 4:86380932-86380954 GACAGTTCCCAGCTCTGCTTCGG - Intronic
979718582 4:123871064-123871086 ATCAGGTCTCAGTTATGCATAGG + Intergenic
985269146 4:188177827-188177849 CTCATTGCAAAGCTCTGCATTGG - Intergenic
985715801 5:1460361-1460383 TTCAGTTCTCCACTCAGCATTGG - Intronic
985939733 5:3125913-3125935 CCCAGTCCTCAGCTTTGCACTGG + Intergenic
988728425 5:33946525-33946547 CTCTGTTATAAGCACTGCATAGG + Intronic
990501468 5:56400573-56400595 ATCAGTTTTCAGCTTTGCATAGG + Intergenic
990513648 5:56512462-56512484 CTCAACTCTTGGCTCTGCATAGG - Intronic
991956572 5:72000712-72000734 CACAGGTCTCAGCTCTGCATGGG + Intergenic
995641152 5:114259094-114259116 CACTGTACTCAGCTCTGCAAGGG - Intergenic
996060951 5:119032782-119032804 CTGACTTCTCAGCTCTGCATAGG - Intergenic
999229304 5:150052362-150052384 CTCAGTTCTCAACCCTCCAGGGG + Exonic
999858427 5:155620001-155620023 CTCAGTTCTCAGCTCAGGAGTGG + Intergenic
1000098265 5:157989977-157989999 CTCAGTTTTCAGCTGACCATGGG - Intergenic
1000407229 5:160901065-160901087 CTCCGTTCTCAGCTCAGAATGGG + Intergenic
1002075321 5:176705086-176705108 CTCAGCTCTCAGCACAGCCTCGG + Intergenic
1002869023 6:1148880-1148902 CTAAGTTCTCATCCCTCCATTGG + Intergenic
1002972413 6:2037402-2037424 CTCACTAGTCAGCTGTGCATGGG + Intronic
1007112471 6:39320829-39320851 CTCCTCCCTCAGCTCTGCATTGG - Intronic
1007733243 6:43964759-43964781 CTGAGTTCTCTGCTCTGCAAAGG - Intergenic
1010429489 6:75762661-75762683 CTCAGATTTCTGCTCTGCACAGG + Intronic
1010734197 6:79424706-79424728 ATAATTTCTCAGCTCTGCAATGG + Intergenic
1011961649 6:93098348-93098370 TTCAGTTCACATCTCTGCATTGG - Intergenic
1014401416 6:120995015-120995037 GTCAGCTCTCAGTTCTGCCTAGG - Intergenic
1014978856 6:127922561-127922583 CTCAGATGACAGCTCTGCTTAGG - Intergenic
1015417351 6:132964379-132964401 ACCAGTTCTCAGCTCTGCTCTGG + Intergenic
1015661566 6:135581069-135581091 CACACTTCTGAGCTGTGCATGGG - Intergenic
1017414822 6:154208371-154208393 CTCAGATCTCAGCTCTCAGTCGG + Intronic
1019863697 7:3684803-3684825 TTCAGTTCTCTGCTTTCCATTGG - Intronic
1020262222 7:6536877-6536899 CGCAGCTCTCGGCTCTGCAGCGG - Intronic
1021179484 7:17489191-17489213 CTCAATTAACTGCTCTGCATGGG + Intergenic
1021904680 7:25321729-25321751 CTCAGTGCTTACCTCTGCACAGG - Intergenic
1022477380 7:30720371-30720393 CCCAGGTCTCACCTCTGCCTAGG - Intronic
1022505522 7:30906920-30906942 CCCTGTGCTCAGCTCTGCAGCGG + Intergenic
1023865758 7:44237606-44237628 CTCATTTCACATCTCTGCCTGGG + Intronic
1026108017 7:67436460-67436482 CTCACTCCTCACCTCTGCCTGGG + Intergenic
1028613491 7:92738273-92738295 CCCAGTTCTCAGTTTTGCCTTGG - Intronic
1031155868 7:118111434-118111456 CTCTGTTCCCAGCTCTCCAGAGG + Intergenic
1033542753 7:142372402-142372424 CTCAGAACTCAGCTCTTCCTGGG + Intergenic
1035397889 7:158546968-158546990 GTGAGCTCTGAGCTCTGCATGGG - Intronic
1035815123 8:2530659-2530681 CTCAGTTCTAAGCTCCTCAGAGG + Intergenic
1036543793 8:9746678-9746700 CCCAGTCCTCAGCCCTCCATAGG + Intronic
1037862663 8:22416826-22416848 CTCAGTTCTCACCTATACAGTGG + Intronic
1039764063 8:40609328-40609350 ATCAGTTCTCAGACCAGCATTGG + Intronic
1040506330 8:48051897-48051919 CTCAGGTCCCAGCTCTGAGTTGG - Intronic
1041868079 8:62599464-62599486 ATCATTTCTAAGCCCTGCATAGG - Intronic
1042683685 8:71414229-71414251 CTCAGCTGTCAGCTCTCCTTAGG - Intronic
1045155572 8:99466129-99466151 CTCTGATCTCATCTCTGCCTGGG + Intronic
1048203853 8:132400071-132400093 CTCACTGCTCAGGTCTGCCTAGG - Intronic
1050961453 9:11738530-11738552 TTCAGTTCTCCACTCTGCAGAGG - Intergenic
1054916831 9:70502231-70502253 CTCAGTTCTATGTTCTTCATAGG + Intergenic
1055172402 9:73274966-73274988 CTGTGGTCCCAGCTCTGCATGGG + Intergenic
1056441499 9:86626219-86626241 CAAAGTGCTCAGCTCTGAATTGG - Intergenic
1057182396 9:93037141-93037163 GTCAGAGCTCAGCTCTGCAGGGG - Intergenic
1057792391 9:98132792-98132814 TTCAGATCCCAGCTCTCCATGGG + Intronic
1058164403 9:101604062-101604084 CTCTGTATTCATCTCTGCATTGG + Intronic
1059505041 9:114790851-114790873 ATCAGTTCCCAGCTCTGCACTGG - Exonic
1059639400 9:116202007-116202029 CTCAGCTATCACTTCTGCATAGG + Intronic
1059779316 9:117509237-117509259 CTGATTTCTTAGCTCTGCATTGG + Intergenic
1060875943 9:127083726-127083748 CTAAGTTCTCAGCTTTGACTGGG - Intronic
1061324647 9:129856241-129856263 CTCAGTGCTCAGCCCCGCAACGG + Intronic
1062483764 9:136764193-136764215 CTCAGTTCCCAGCTGTGAAGTGG + Intronic
1186755568 X:12667872-12667894 CACAGTGCTCATCTCTGCAGGGG - Intronic
1189560638 X:42188166-42188188 CTCAGTGCTCACCTCTGTAAAGG + Intergenic
1190991687 X:55557239-55557261 TTCAGTTCTCAGCTGAGCACAGG - Intergenic
1191221268 X:57990249-57990271 CTCAGTCCTCTGCACTGCTTAGG - Intergenic
1196593572 X:117517406-117517428 CTATGTTCTCAGCCCTGTATAGG + Intergenic
1196813700 X:119648161-119648183 CTCTGTTCTCAGCTCAGCTCTGG - Intronic
1198266731 X:135016386-135016408 CTCAGGTCTCAGTTTTTCATTGG + Intergenic