ID: 1080331465

View in Genome Browser
Species Human (GRCh38)
Location 11:31144533-31144555
Sequence ACTAGTGAATACAGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080331465_1080331471 26 Left 1080331465 11:31144533-31144555 CCAGTTTCCCTGTATTCACTAGT 0: 1
1: 0
2: 2
3: 10
4: 151
Right 1080331471 11:31144582-31144604 CATCAAATTTTTTGACCGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080331465 Original CRISPR ACTAGTGAATACAGGGAAAC TGG (reversed) Intronic
909469188 1:76007515-76007537 AATAGTGAATCCAGATAAACTGG + Intergenic
910707422 1:90144674-90144696 ATTAGTGGATGCGGGGAAACAGG - Intergenic
912425856 1:109589112-109589134 AGTAGTGAAAACATGGAAATGGG + Intronic
912969394 1:114266437-114266459 GCTAGTGACTAGAGGGAAAATGG + Intergenic
913030372 1:114896894-114896916 AAAAGTGAAAAAAGGGAAACAGG + Intronic
913041368 1:115028095-115028117 AATTTTGAAAACAGGGAAACTGG - Intergenic
914317605 1:146529072-146529094 ACTAGTGTACACAGAGAAATTGG + Intergenic
914496750 1:148204288-148204310 ACTAGTGTACACAGAGAAATTGG - Intergenic
915494790 1:156274388-156274410 ATCAGTGAATACAGGAAAAAGGG - Intronic
916440815 1:164822803-164822825 AGTAGTGGATTCAGAGAAACAGG + Intronic
919913786 1:202127993-202128015 ACCAGTGAATACAGGGACTCGGG - Exonic
920406196 1:205713804-205713826 ACTAGTTAATACAGTGAAGCAGG + Exonic
924710241 1:246525089-246525111 ACTAATGAGTACAGGGGAGCAGG - Intergenic
1064715642 10:18173903-18173925 ATTAGTAAGTTCAGGGAAACTGG + Intronic
1066227791 10:33401548-33401570 ATTAGTTAATTTAGGGAAACAGG + Intergenic
1066295454 10:34050328-34050350 ACTTCTGAATACAAGGAACCAGG + Intergenic
1066809435 10:39308179-39308201 ACTGATGAATACAGTGAAATGGG - Intergenic
1068185611 10:53581765-53581787 ACTATTGTATACAAGGAATCAGG + Intergenic
1069877175 10:71570243-71570265 ACTCATGAATGCAGGGACACAGG + Intronic
1071404347 10:85315735-85315757 ACAAGCGGTTACAGGGAAACGGG + Intergenic
1071527110 10:86365296-86365318 ACCAGCGAGCACAGGGAAACTGG - Intronic
1074420051 10:113300469-113300491 AATAGAGAAAACAGGGAAGCAGG - Intergenic
1075183104 10:120229747-120229769 ACTAGAGACTAGAGGGAACCAGG - Intergenic
1080331465 11:31144533-31144555 ACTAGTGAATACAGGGAAACTGG - Intronic
1081024503 11:37993507-37993529 ACTAGTGAAGTTAGGGAAAGAGG + Intergenic
1084136064 11:67183138-67183160 ACTAAGGAATACATGGCAACAGG - Intronic
1087622430 11:100557632-100557654 ACTACTTAATAAATGGAAACAGG + Intergenic
1088159666 11:106854531-106854553 AATAGTGCATACAGGCAAAGCGG + Intronic
1089915121 11:122147236-122147258 ACAAGTGCAAACAGGGAAATAGG - Intergenic
1090319947 11:125833589-125833611 ACTACTGATTGCAGGGAAACAGG + Intronic
1090908628 11:131098585-131098607 ACTAATGAATCCAGGGATACAGG - Intergenic
1091252773 11:134157598-134157620 ACTTAAGAATGCAGGGAAACAGG + Intronic
1094554053 12:31480695-31480717 AGTATTTAATACAGGGAAATAGG + Intronic
1095172390 12:39051131-39051153 ACCTGTGAATACTGAGAAACAGG + Intergenic
1097039298 12:56145231-56145253 ACTACTGAAAACAGGGTCACTGG + Intergenic
1099148495 12:79078122-79078144 ACCAGTGAGTAAAGGGAAAAAGG - Intronic
1099186236 12:79518289-79518311 ATGAGTGAATGCAGTGAAACAGG - Intergenic
1099888826 12:88564371-88564393 ACAAATGTAAACAGGGAAACTGG + Intronic
1100558394 12:95721333-95721355 ACAGGTGAATACAGAGAGACTGG + Intronic
1101711396 12:107270144-107270166 TCTAGTGAATAAAGAGAAACTGG - Intergenic
1105365443 13:19760193-19760215 ACTGATAGATACAGGGAAACTGG - Intronic
1107733564 13:43372743-43372765 ATTAGTGAATTAAGGGAAAAAGG + Intronic
1111069622 13:83147956-83147978 AATAGTGAAAACATGGAAAATGG - Intergenic
1113607952 13:111623693-111623715 TCTACTAAAAACAGGGAAACTGG - Intronic
1113684536 13:112273234-112273256 TATTGTCAATACAGGGAAACAGG + Intergenic
1115431443 14:33323503-33323525 ACTAGTGAATACGTGGAAGATGG + Intronic
1121779703 14:96614416-96614438 ACTATTTTAAACAGGGAAACGGG - Intergenic
1125533658 15:40430005-40430027 ACTCCTGAAAACAGGCAAACTGG + Intronic
1125572761 15:40733616-40733638 ACTAGTGAAAAGAGGTAAAGGGG - Intergenic
1126681790 15:51209297-51209319 GGGAGTGAATACAGGGAGACAGG + Exonic
1128968796 15:72087532-72087554 CCCAGTGACTCCAGGGAAACGGG - Intronic
1131712968 15:95075662-95075684 ACTAGTGAAAAGAGGGAAGCGGG - Intergenic
1131856537 15:96603077-96603099 ACTGGTGAATACAGACAAAGAGG + Intergenic
1132710333 16:1263491-1263513 ACTGGTGTAGACAGGGAACCCGG - Intergenic
1139000962 16:62509334-62509356 ATTAGGGTATACATGGAAACAGG + Intergenic
1141988034 16:87592814-87592836 ACTAAGAAATCCAGGGAAACAGG + Intergenic
1143192750 17:5052307-5052329 CCAAGTGAATAAAGGGCAACAGG + Intergenic
1143707155 17:8706595-8706617 ACTAGAGAATGCAGAGAGACTGG - Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145270763 17:21403744-21403766 ATGAGTGAATACATGGAGACTGG - Intronic
1146895428 17:36537490-36537512 ACTGGTAATTACACGGAAACAGG - Exonic
1147298462 17:39504153-39504175 ACTAGTCAATACAAGGAAGATGG + Intronic
1148428159 17:47618695-47618717 ACTCTTGAAAACTGGGAAACTGG + Intronic
1149058580 17:52393920-52393942 AATAGGAAAAACAGGGAAACAGG - Intergenic
1155725513 18:29076918-29076940 ACTAGTGATTACAGAGTAATTGG + Intergenic
1156809808 18:41233946-41233968 ACTAGAGAATACAGGTATAAAGG + Intergenic
1158243533 18:55404864-55404886 AAAAGTTAATACTGGGAAACGGG - Intronic
1158595112 18:58809124-58809146 ACTAGATAATACAGGGGAGCAGG + Intergenic
1159096260 18:63905880-63905902 ACTAGTAAAGACAGAGAAATAGG - Intronic
1159779935 18:72649475-72649497 TGTGGTGAATACGGGGAAACAGG + Intergenic
1159857869 18:73610980-73611002 ACTAGATAGTGCAGGGAAACTGG + Intergenic
1160377630 18:78425784-78425806 AAAAGAGAATACAGGGTAACAGG + Intergenic
1167057634 19:47122303-47122325 ACCAGTGACTACATGGGAACAGG - Intronic
1167456727 19:49600167-49600189 ACTGGAGAATGCAGGGAGACAGG + Intronic
928689555 2:33785100-33785122 AAGAGTAAATACAGGGAGACTGG - Intergenic
930403278 2:50919539-50919561 AGTAGTGAATTCAGGGGATCTGG - Intronic
931219056 2:60272477-60272499 ACTATTAAATATATGGAAACTGG - Intergenic
932534225 2:72574985-72575007 ATGAGTGATTACAGGGTAACTGG - Intronic
942754807 2:179328079-179328101 AAAAGTGAAAACAGGTAAACTGG + Intergenic
945717351 2:213375287-213375309 AGTAGTTAATTCAGGGACACAGG + Intronic
946315275 2:218907268-218907290 TGCAGTGAATAGAGGGAAACAGG + Intergenic
947758130 2:232583656-232583678 ACTTGTCAATACAAGGGAACCGG + Intergenic
947868820 2:233420859-233420881 ACTACTGATCACAGGGAATCTGG - Intronic
1168731586 20:87150-87172 AATAGTGAAAACAGGAAAACAGG - Intergenic
1173931535 20:46824325-46824347 ACTTGTGAATACAGCTAACCAGG + Intergenic
1175374731 20:58516185-58516207 ACTCGTGAGTCCCGGGAAACAGG - Intergenic
1177564503 21:22801122-22801144 ACTACTGAATATAGAAAAACTGG + Intergenic
1177681220 21:24374140-24374162 AATTTTGTATACAGGGAAACTGG - Intergenic
1178016907 21:28357473-28357495 ATTAATGAAGACTGGGAAACTGG - Intergenic
1178126534 21:29521684-29521706 ATTAGTGAATACAGGGCAGATGG - Intronic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
950232998 3:11293050-11293072 ACTAGGAAATACAGAGAAAGGGG + Intronic
951299806 3:20982078-20982100 AGTAGAGAAAACAGGGAAAGAGG + Intergenic
953045032 3:39287007-39287029 ACAAGTGAATACAGGGAAGCCGG + Intergenic
957459202 3:80495612-80495634 TATAGTGAATATAAGGAAACAGG - Intergenic
959384504 3:105685353-105685375 GGTTGTGAATTCAGGGAAACAGG + Exonic
960484394 3:118233707-118233729 ACTAATGAACACAGGGAGAGAGG - Intergenic
961534365 3:127560637-127560659 AATAGTAAATGCAGGGAAATAGG - Intergenic
965211664 3:165797384-165797406 GCTAATGAATAAAGGGAAAAAGG - Intronic
966912579 3:184567679-184567701 CCAAGTCTATACAGGGAAACTGG + Intronic
970948029 4:21717907-21717929 ACTAGTGAATTGAGGCCAACTGG - Intronic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
974596123 4:64016244-64016266 CCATGTGAAAACAGGGAAACAGG - Intergenic
980798904 4:137722825-137722847 ACTAAGGGATACAGGGAAATTGG - Intergenic
981425130 4:144594319-144594341 GCTAGGAAATACAGGAAAACAGG + Intergenic
986250044 5:6046991-6047013 ACTAGTGAATTCAGAGACAAGGG - Intergenic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
991588363 5:68222540-68222562 ACTAGTGAATAAAAGAATACTGG - Intronic
993927647 5:93890641-93890663 ACTAATGAACACAGTGACACAGG + Intronic
996456459 5:123689167-123689189 AACAGAGAATACAGAGAAACTGG + Intergenic
996851385 5:127957029-127957051 ACTAGGGAATACTGGGTAAATGG + Intergenic
997328462 5:133041773-133041795 ACTATAGAATACAGGGTACCTGG - Intergenic
999833935 5:155349059-155349081 ACAGGTAAATACAGGGAATCAGG + Intergenic
1005820547 6:29594999-29595021 ACTAGTGAATGCTGTAAAACAGG + Intronic
1006264313 6:32905087-32905109 ACTAGACAATACAGTGAAATGGG + Intergenic
1007327978 6:41077393-41077415 AGTGGAGAATACAGGGAGACAGG - Intronic
1008323948 6:50153727-50153749 ATTAGTGAATACATGAAAATAGG + Intergenic
1010369018 6:75085877-75085899 ACCAGTGACTACAGCAAAACAGG + Exonic
1010726997 6:79346448-79346470 AATTGTAAAGACAGGGAAACTGG - Intergenic
1011420266 6:87164521-87164543 AGTAGGGAATAAAGGGAAAAGGG - Intronic
1016494890 6:144649884-144649906 ACTGGAGAATACAGAGAGACTGG + Intronic
1016706325 6:147112526-147112548 ACTATTGAGTACAAGGGAACAGG - Intergenic
1018513619 6:164554308-164554330 ACTAGAGAATACATTAAAACAGG + Intergenic
1021247817 7:18285714-18285736 ACTAGAGAAGACAGGCACACTGG + Intronic
1021932012 7:25590334-25590356 ACTGGGAAATACAGGGAAAAAGG + Intergenic
1023695310 7:42839982-42840004 ACTAAAGAACACAGTGAAACAGG + Intergenic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1028901887 7:96110607-96110629 CCAAGTGAAGACAGGGAAAGAGG - Intergenic
1028940135 7:96512577-96512599 ATTAGTGAGAAAAGGGAAACGGG + Intronic
1029559775 7:101294915-101294937 ACCCCTGAATACAGGGACACAGG + Intergenic
1030342757 7:108399338-108399360 AGTAGTGAAAAGAGGGAAACAGG - Intronic
1030945245 7:115711303-115711325 AATAGTGAATTCAGGGAGACCGG - Intergenic
1035897517 8:3420515-3420537 AGTATTAAATATAGGGAAACTGG + Intronic
1036776238 8:11614607-11614629 ACTAGTGATTGCAGGGAAGATGG - Intergenic
1037067593 8:14601736-14601758 ATTAGTGAAAACTGGAAAACTGG + Intronic
1039925735 8:41930349-41930371 AATAGTATATACAGAGAAACTGG + Exonic
1040293032 8:46135211-46135233 ACAAGTGAATACAGGGAAGCAGG - Intergenic
1040302433 8:46194987-46195009 ACAAGTGAAAACAGGGATGCTGG + Intergenic
1040306764 8:46216013-46216035 ACCAGTGAAAACAGGGCAGCAGG + Intergenic
1040307658 8:46220568-46220590 ACTATTGAAAACAGGGCCACAGG + Intergenic
1040309124 8:46227538-46227560 ACAAGTGAAAACAGGGAGGCAGG + Intergenic
1040312725 8:46245079-46245101 ACAAGTGAAAACAGGGCCACAGG + Intergenic
1040331462 8:46387842-46387864 ACAAGTGAAAACGGGGAACCAGG + Intergenic
1040740394 8:50567956-50567978 ACCAATGAATACAGAGATACAGG - Intronic
1041236506 8:55808244-55808266 AATAGTGAATTCAAGGAAAAAGG - Intronic
1043803722 8:84644201-84644223 ACTAGGGAAAAAAGGGAAAAGGG + Intronic
1047388312 8:124429870-124429892 TCTAGTGAATACATGAAAAAAGG - Intergenic
1052122370 9:24733565-24733587 ACTAGAGAATATAAAGAAACAGG - Intergenic
1058971820 9:110090298-110090320 CCTACTGAAGAAAGGGAAACTGG + Intronic
1058974805 9:110115800-110115822 CCTATTGATTGCAGGGAAACTGG - Intronic
1059722738 9:116977071-116977093 ACAACTTAAGACAGGGAAACAGG + Intronic
1188350524 X:29125016-29125038 ATTAGAGAAGACAGGGAAAGAGG + Intronic
1188993836 X:36857880-36857902 ACTAGTGAGTAAAGGTAAATAGG - Intergenic
1189558255 X:42166771-42166793 CCTAGTGACTCCAGGGAAAAGGG - Intergenic
1189997094 X:46649499-46649521 ACCAAAGAATGCAGGGAAACTGG + Intronic
1191065454 X:56342946-56342968 ACTAGTGAATGCTGTGAAATAGG + Intergenic
1192335997 X:70220318-70220340 ACTGGGGAAAACAGGAAAACTGG - Intergenic
1193958932 X:87899913-87899935 ATTACTGAATTCAGGGAAATAGG + Intergenic
1194087756 X:89550252-89550274 ACCAATGAATATAAGGAAACAGG + Intergenic
1194340067 X:92696516-92696538 TATAGTGAATTCAGGGAGACAGG - Intergenic
1195248226 X:103016235-103016257 ACTAGTGATTATACTGAAACAGG + Intergenic
1197861086 X:130971395-130971417 AATAGAGAATACAGGGGAAGAGG + Intergenic
1200440865 Y:3210551-3210573 ACTAATGAATATAAGGAAACAGG - Intergenic
1200648440 Y:5813280-5813302 TGTAGTGAATTCAGGGAGACAGG - Intergenic