ID: 1080333479

View in Genome Browser
Species Human (GRCh38)
Location 11:31169854-31169876
Sequence TGTCTCTCCAAGACCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080333479_1080333486 17 Left 1080333479 11:31169854-31169876 CCAACCTAGGTCTTGGAGAGACA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1080333486 11:31169894-31169916 GAGCATTCTTGCTTTTTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 292
1080333479_1080333485 -5 Left 1080333479 11:31169854-31169876 CCAACCTAGGTCTTGGAGAGACA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1080333485 11:31169872-31169894 AGACAAAGATTTTGGGGGTAAGG 0: 1
1: 0
2: 1
3: 21
4: 320
1080333479_1080333484 -10 Left 1080333479 11:31169854-31169876 CCAACCTAGGTCTTGGAGAGACA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1080333484 11:31169867-31169889 TGGAGAGACAAAGATTTTGGGGG 0: 1
1: 0
2: 1
3: 32
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080333479 Original CRISPR TGTCTCTCCAAGACCTAGGT TGG (reversed) Intronic
901883095 1:12205333-12205355 TGCCGCTCCAAGACCTTGATGGG - Intronic
902975593 1:20085975-20085997 GGTCCCTCCAAGCCCTGGGTGGG + Intronic
903684307 1:25119780-25119802 TGTCTCCCCATGGCCTGGGTGGG - Intergenic
908240472 1:62184957-62184979 TCTCACTCCAACACCCAGGTTGG + Intergenic
908790924 1:67780504-67780526 TGTCTCTCCAGGACCTAGTAAGG + Intronic
911047332 1:93639360-93639382 TGTCTCTCCCAGACCCAAGGAGG + Intronic
917138299 1:171808933-171808955 AGCATCTTCAAGACCTAGGTAGG - Intronic
918130299 1:181621852-181621874 TATCTCTACAATACATAGGTAGG + Intronic
918226641 1:182489649-182489671 TGTCTCTCCACTGCCTGGGTGGG - Intronic
918356531 1:183710309-183710331 TACCTCTCCAAGACCTATGAAGG + Intronic
919182344 1:194103093-194103115 TGCCTCTCTAGGACATAGGTTGG - Intergenic
920219938 1:204389516-204389538 TTTTTCCCCAAGTCCTAGGTTGG - Intergenic
921569078 1:216756963-216756985 CATCTCCCCAAGACCAAGGTGGG + Intronic
922513672 1:226190291-226190313 TCTCTCTCCATCACCTAGGCTGG - Intergenic
922721956 1:227903892-227903914 TGTGTCTCCAGAACCAAGGTAGG - Intergenic
1074640758 10:115377885-115377907 ACTCTCTCCAGGACCTTGGTTGG + Intronic
1075746024 10:124728275-124728297 TGTCTCTCCAAGTCCATGGGTGG - Intronic
1076216639 10:128699510-128699532 TTTCTCTCCAAGTCTTAAGTAGG - Intergenic
1077581453 11:3419781-3419803 TGTCTCTTCTAGACCTAAATGGG - Intergenic
1080091935 11:28358722-28358744 TGTCTCTCCAAAACCTAGCATGG + Intergenic
1080333479 11:31169854-31169876 TGTCTCTCCAAGACCTAGGTTGG - Intronic
1084238364 11:67802616-67802638 TGTCTCTTCTAGACCTAAATGGG - Intergenic
1084834049 11:71790214-71790236 TGTCTCTTCTAGACCTAAATGGG + Intronic
1087613665 11:100464082-100464104 TCACTCTCCAAGACCCAGGGAGG - Intergenic
1087664537 11:101028607-101028629 TGTGTCTCCAAGACCTAACATGG + Intergenic
1089104338 11:115989851-115989873 TGTCTCTCCTAGGCCAAGTTTGG + Intergenic
1089931153 11:122313879-122313901 TGTCTCTACAAAACTTAGCTGGG + Intergenic
1091590648 12:1840998-1841020 TGTCTGTCCAAGACCCGTGTTGG - Intronic
1092409051 12:8240252-8240274 TGTCTCTTCTAGACCTAAATGGG - Intergenic
1092776926 12:11951953-11951975 TGTTTTTGGAAGACCTAGGTGGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096840015 12:54374407-54374429 TGTCTCTACCAGGACTAGGTGGG - Intronic
1097102601 12:56600160-56600182 TTTCTCTCCAAGACCAAGAATGG + Intronic
1097405394 12:59183179-59183201 TGTCTCTACAAGAATTAGCTGGG + Intergenic
1102831923 12:116010403-116010425 TGTCTCTCAAAGAACTAGTGCGG - Intronic
1103173940 12:118845310-118845332 TCTCTCTCACAGACCTAGGAAGG + Intergenic
1107574967 13:41708671-41708693 GATCTCTGCAGGACCTAGGTGGG - Intronic
1109210456 13:59529418-59529440 TCTCTCTGCAATACCTAGTTAGG + Intergenic
1111801563 13:92987209-92987231 TTTCTCTACCAGACCTGGGTAGG + Intergenic
1115141896 14:30181565-30181587 TTTCTCTCCAAGAATTAAGTAGG - Intronic
1115641290 14:35337161-35337183 TGTCTCCCCAAGACCTGAGGAGG + Intergenic
1116841806 14:49826321-49826343 TGTCTCTTCTAGACCTAGTGGGG - Intronic
1118737126 14:68709684-68709706 TGTCTCTACAAAAAATAGGTGGG - Intronic
1122477230 14:102018789-102018811 TGTCTCTACAAAAAATAGGTGGG + Intronic
1126360607 15:47841999-47842021 TGTCTATGCAATAGCTAGGTTGG - Intergenic
1127047020 15:55036666-55036688 TGTGTGACCAAGACCTATGTAGG - Intergenic
1128352208 15:66898714-66898736 TGCCCCTCCAAGACCCAGCTGGG + Intergenic
1129818739 15:78580664-78580686 TCTCTCTCCATGGCCCAGGTTGG + Intronic
1130989139 15:88865373-88865395 TGTCTCCCCAACACCCAGGTTGG + Intronic
1131829851 15:96347315-96347337 TGCCTGTCCAAGACCCTGGTTGG + Intergenic
1132244533 15:100284195-100284217 TAGCTCTCCAAGGCCTAGGGAGG - Intronic
1138094455 16:54201102-54201124 TATCTCTCCAAGCCCTAAGGAGG - Intergenic
1139326079 16:66153532-66153554 TTTCTATCAATGACCTAGGTTGG - Intergenic
1139819705 16:69711581-69711603 TGACTCACCAAGACCTGCGTGGG + Intronic
1140034508 16:71361995-71362017 TGTCTCTCAAAGGCTGAGGTAGG + Intronic
1141646030 16:85368248-85368270 TCTCTCTCCAGGACCCAGGGTGG + Intergenic
1146296962 17:31657907-31657929 TGCCTCTCCAAGACCCAGAGCGG - Intergenic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1164209730 19:23088496-23088518 TGTCTCTCCAGCACCTAGGCTGG + Intronic
1164392263 19:27835141-27835163 AGGCTCTCCAGGCCCTAGGTAGG - Intergenic
1167824259 19:51957915-51957937 TGTCTCTGCAAGCACAAGGTTGG - Intergenic
1167834022 19:52051855-52051877 TGTCTCTGCAAGCACTGGGTTGG - Intronic
927685411 2:25167578-25167600 CTTCTCTCCAAGACCTAGCTGGG - Intronic
932176368 2:69606660-69606682 TGTATCTCCAATACCTAGAGAGG - Intronic
932298381 2:70645484-70645506 TGTCACTCCAGGACCTAGCAAGG - Intronic
934746601 2:96763565-96763587 AGTCCCTCCAAGCCCTAGGTCGG - Intronic
937277358 2:120693690-120693712 TCTCTCTCCATCACCCAGGTTGG + Intergenic
937909717 2:127069519-127069541 TGTCTCTGCCAGGCCTGGGTTGG - Intronic
939390220 2:141558750-141558772 AGTATCTTCAAGACCTAAGTAGG + Intronic
940281594 2:151994715-151994737 TGTATCTCCTAGATGTAGGTGGG - Intronic
941021853 2:160415709-160415731 TGTCTATCCAAAACCTAAGATGG + Intronic
942369517 2:175267524-175267546 TGTTTCACCAAGAGCTTGGTGGG - Intergenic
946052987 2:216879608-216879630 TATCTCTCCCAGACCCAGCTGGG + Intergenic
947024194 2:225718327-225718349 TGTCACTCCGTGACCTAGGCTGG + Intergenic
947263290 2:228249526-228249548 TGTCTCTTCAATGCCTAGTTTGG - Intergenic
948748979 2:240118180-240118202 TGTCTCTCCCAGGATTAGGTTGG - Intergenic
1168776988 20:456110-456132 TGTCTCTACAAAAAATAGGTGGG + Intronic
1175100282 20:56574550-56574572 TGTTTCTCCAGGACCTTGTTTGG + Intergenic
1176935956 21:14867058-14867080 TGTATCTCCAACACTTTGGTAGG - Intergenic
1177664538 21:24137121-24137143 TGTCTCTACAGAACCTTGGTGGG + Intergenic
1178588753 21:33891636-33891658 TGTCTCTCCAGGAACTGGCTAGG + Exonic
1183142888 22:35960758-35960780 TGTCTTTCAAAAACCTAGGTAGG + Intronic
1184675881 22:46043139-46043161 TTTCTCCCCAAGGCCTAGGATGG - Intergenic
949488612 3:4565648-4565670 TGTCTCCCCAAGACGAAGGTCGG + Intronic
950687387 3:14628216-14628238 TGTCTCTCCTCCAGCTAGGTAGG + Intergenic
952760557 3:36909621-36909643 TGTCTCTCCAAGAATTGTGTTGG - Intronic
954222850 3:49165279-49165301 TGGCCCTCCAAGTCTTAGGTAGG - Intronic
955287033 3:57651950-57651972 TGTAACCCCAACACCTAGGTGGG + Intronic
957054320 3:75432418-75432440 TGTCTCTTCTAGACCTAAATGGG - Intergenic
960217022 3:115052425-115052447 TCTCACTCCATTACCTAGGTTGG - Intronic
960493557 3:118348444-118348466 TGACTCTCCATGACCTAGGAAGG + Intergenic
960794249 3:121467870-121467892 TGTCTCTACAAAAACTAGCTAGG + Intronic
961300523 3:125919296-125919318 TGTCTCTTCTAGACCTAAATGGG + Intergenic
966952375 3:184833296-184833318 AGTCTCTCCAAGAACTTGGAAGG - Intronic
968533372 4:1108480-1108502 TGTTTCTCCAAGAAATAGGCAGG + Intronic
969756888 4:9155953-9155975 TGTCTCTTCTAGACCTAAATGGG + Intergenic
969934763 4:10669341-10669363 TGGCTCTCCAAGACAGAGTTAGG - Intronic
979202681 4:117997313-117997335 TGTCTCTCCATGACTTTGGCAGG - Intergenic
979701618 4:123674633-123674655 TGTCTCTCCAAGATTTAGCCCGG + Intergenic
981426703 4:144611669-144611691 TTTCTTTCCAACACCTAGTTGGG - Intergenic
983271414 4:165566924-165566946 TTTTTCCCCAAAACCTAGGTTGG - Intergenic
985749687 5:1667197-1667219 TGTCTGTCCCAGGCCTGGGTTGG - Intergenic
986354115 5:6907045-6907067 TCTCACTCCATCACCTAGGTTGG - Intergenic
989114817 5:37942325-37942347 TGTCTCTACAAAAATTAGGTGGG - Intergenic
996254593 5:121383771-121383793 TGTATCTCAAAGACTTACGTAGG + Intergenic
998017868 5:138746904-138746926 TCTCACTCCATCACCTAGGTTGG - Intronic
999263932 5:150254320-150254342 TGTATCACCAGCACCTAGGTTGG + Intronic
1001147013 5:169193796-169193818 TGTCTCTCCAAGACTGATGGAGG - Intronic
1006652374 6:35562367-35562389 TGTCTCTCAAAGACCTAAAATGG - Intergenic
1007384061 6:41508760-41508782 TGTCTCTGCATGTCCTAGTTTGG - Intergenic
1008088439 6:47268517-47268539 TGTCTCTTCAAGGCAAAGGTGGG + Intronic
1009937551 6:70251515-70251537 TGTCTCTCAATCACCCAGGTTGG - Intronic
1010978006 6:82338557-82338579 TGTCTCTCAAAGACCTTTTTAGG - Intergenic
1011770128 6:90666393-90666415 TTTCTCTCCAAAACCTTGCTGGG - Intergenic
1014092807 6:117423882-117423904 TGTCCCTCCAGGCCCTATGTGGG + Intronic
1015489267 6:133806981-133807003 TGTATGTCCAAGACAGAGGTGGG + Intergenic
1016040424 6:139427061-139427083 TGTCTTTCCAAGACCCAGATAGG + Intergenic
1016054505 6:139565475-139565497 TGTTTCCCCCAGCCCTAGGTGGG + Intergenic
1016369250 6:143355135-143355157 TGTCTCTCCAGGTGCTAGGAAGG + Intergenic
1016558215 6:145364205-145364227 TTTCTATCCAAGACCTACCTTGG - Intergenic
1018031457 6:159845090-159845112 TGTCTCTCCAGGGCCTTGGATGG + Intergenic
1020181953 7:5929462-5929484 TTTGTCCCCAAGACCTAGGCCGG - Intronic
1020300981 7:6795474-6795496 TTTGTCCCCAAGACCTAGGCCGG + Intronic
1024788474 7:52934900-52934922 TCTCACTCCAACACCTAGGATGG - Intergenic
1025144145 7:56490452-56490474 GGTCTCTCCAAGACCTGGCCTGG - Intergenic
1027833794 7:83215518-83215540 TGTCACTCCTTTACCTAGGTTGG - Intergenic
1029665801 7:101994223-101994245 TTTCTCTCCTAGACCTTGGCTGG + Intronic
1030042695 7:105466126-105466148 TCTCACTCCAAGACCCAGGATGG - Intronic
1031495882 7:122447581-122447603 TGTCACTCCATCACCTAGGCTGG + Intronic
1032781083 7:135165747-135165769 TGTCTTTCCAAGTTCTGGGTTGG - Exonic
1034348923 7:150404116-150404138 TCTCTCTCCAAGGCCCAGGCAGG - Intronic
1036380121 8:8231272-8231294 TGTCTCTTCTAGACCTAAATGGG + Intergenic
1036659347 8:10697982-10698004 TGTCTCTCCAGGACCTGGCCGGG - Exonic
1036849438 8:12191390-12191412 TGTCTCTTCTAGACCTAAATGGG - Intronic
1036870800 8:12433663-12433685 TGTCTCTTCTAGACCTAAATGGG - Intronic
1037312370 8:17570152-17570174 TGTCTCACCAAGACCCAGTTGGG + Exonic
1038525377 8:28268390-28268412 TGTCACTCCATCACCTAGGCTGG - Intergenic
1039417962 8:37411783-37411805 TGTCTCTCCATGACCTGGTCTGG - Intergenic
1041990067 8:63976944-63976966 TGTGTCTCAAAGACGCAGGTAGG - Intergenic
1042774593 8:72415997-72416019 TGTCTTCCCAAGAGGTAGGTTGG + Intergenic
1045831596 8:106468151-106468173 GTTCTCTCCAAGACCTAGAATGG - Intronic
1046953291 8:120038428-120038450 TGTCTCTACAAAACTTAGCTTGG + Intronic
1048705208 8:137146227-137146249 TGTCTTTCCAAGCCCTCCGTGGG + Intergenic
1048773508 8:137920433-137920455 TGTCTCTCTGTGACCTAGGCTGG - Intergenic
1049758801 8:144322600-144322622 TTGCTCCCCAAGACCAAGGTTGG + Intronic
1052961055 9:34297388-34297410 TTTCTCTCCTAGACCTAAGGAGG - Intronic
1053294526 9:36903195-36903217 TCTCTCTCCCAGACCAAGGAAGG + Intronic
1055097722 9:72431223-72431245 TATCTCTCCAAGACATAGTCTGG + Intergenic
1058833927 9:108843963-108843985 TGTCTCTCCAAGACCTGGGCCGG + Intergenic
1061388045 9:130301913-130301935 TGTCACTCCAAGACCAGGCTCGG + Intronic
1187302368 X:18063440-18063462 TGTGTCTTCAAGAACTAGATTGG + Intergenic
1187853046 X:23609914-23609936 TGTGTATCCAAGACCCAGTTTGG - Intergenic
1189418857 X:40837693-40837715 TGTGTATCCAAGACCCAGTTTGG - Intergenic
1198441334 X:136666383-136666405 TGTCTCTCTGTTACCTAGGTTGG + Exonic
1200312535 X:155093262-155093284 CCTCTCTCCAGGAACTAGGTAGG - Intronic