ID: 1080336727

View in Genome Browser
Species Human (GRCh38)
Location 11:31206243-31206265
Sequence AGCCCATTGCTGAGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080336727 Original CRISPR AGCCCATTGCTGAGAGTGGG AGG Intronic
901424050 1:9169878-9169900 AGCCCATAGCTGAGTGAGGGGGG - Intergenic
902767946 1:18629659-18629681 ACCCCACTGCCGAGAGAGGGCGG + Intergenic
903294621 1:22335839-22335861 AGCACATGGGTGAGAATGGGAGG - Intergenic
905568683 1:38986969-38986991 TCCACATTGCTGAGTGTGGGTGG - Intergenic
905693380 1:39958377-39958399 AGCTCAGGGCTGAGAGAGGGAGG + Intronic
906013568 1:42552703-42552725 AGCACATGGCTGAGAAGGGGAGG + Intronic
907429874 1:54405756-54405778 AGCCCATTGTTGGGAGCCGGCGG - Intronic
910689333 1:89949671-89949693 AGCCCATTTTTGAGGGTGTGCGG + Intergenic
912263275 1:108130210-108130232 AGCCCGTGGCTGAGATTGTGTGG + Intergenic
912458392 1:109815068-109815090 ATCACATGGCCGAGAGTGGGGGG + Intergenic
915835893 1:159174266-159174288 AGGCCAGTGCTGATGGTGGGAGG + Intronic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
917929809 1:179815448-179815470 AGCCCAGTCCTGAGGATGGGAGG + Exonic
918061112 1:181062206-181062228 AGGGCATTGGTAAGAGTGGGTGG - Intergenic
920115694 1:203619569-203619591 ACCCCCTTGCTGAGTGTGGGTGG - Intergenic
1064203548 10:13303798-13303820 AGCACATTACTGGAAGTGGGGGG - Intergenic
1064675402 10:17755370-17755392 ATACCATTGCTGAGGTTGGGAGG + Intronic
1067118647 10:43455671-43455693 GGCCCATTTCCGAGAGTGGCAGG + Intronic
1067227764 10:44386555-44386577 AGCCCAGTGCCCAGGGTGGGTGG - Intergenic
1068924188 10:62517687-62517709 AGCACAGTGCTGGGAGAGGGTGG + Intronic
1069047214 10:63755715-63755737 AGCAGATTGCTGGGAATGGGTGG - Intergenic
1070705023 10:78631273-78631295 AGCCAAATGCTGAGAATGCGGGG - Intergenic
1071113272 10:82187708-82187730 AGCCCATTGTGAAGAGTGGCTGG + Intronic
1073061256 10:100735233-100735255 AGCCGAGAGCTGAGAGTGGTGGG + Intergenic
1075501755 10:122980799-122980821 CGCCCATTGCTTGGTGTGGGAGG + Intronic
1076256140 10:129026054-129026076 AGCACAGGGCTGGGAGTGGGTGG + Intergenic
1076571099 10:131433587-131433609 AGCCCCTTGCTGAAGGGGGGTGG + Intergenic
1076761946 10:132610347-132610369 AGCCCAGTGATGGGGGTGGGGGG + Intronic
1076912599 10:133399239-133399261 GGCCCAGAGCTGGGAGTGGGAGG + Intronic
1080336727 11:31206243-31206265 AGCCCATTGCTGAGAGTGGGAGG + Intronic
1081131266 11:39383200-39383222 AGCCCATTGCTGAGACAATGAGG + Intergenic
1083229654 11:61308231-61308253 AGGTCATAGGTGAGAGTGGGCGG - Intronic
1083671831 11:64304252-64304274 AGCTGATGGCTTAGAGTGGGTGG + Intronic
1084496307 11:69505646-69505668 AGGCCATTGATGAAGGTGGGTGG + Intergenic
1084789079 11:71462135-71462157 AGGCCATGACTGGGAGTGGGGGG + Intronic
1087624346 11:100579879-100579901 ACCACATTGATGAGGGTGGGTGG + Intergenic
1088228545 11:107648450-107648472 AGCACAGGGCTGAGAGTGGAGGG - Intronic
1088897446 11:114089128-114089150 AGACCTTTGCTGGGAGTGGCGGG + Intronic
1088995147 11:114989672-114989694 AGGACACTCCTGAGAGTGGGCGG - Intergenic
1089919179 11:122191638-122191660 AGCCCATAGCTGGGAGTGATGGG + Intergenic
1090901883 11:131039162-131039184 AGACCAGTTCTGGGAGTGGGAGG + Intergenic
1092758767 12:11790334-11790356 TGCCCATTTCTGAGAGTTGATGG + Intronic
1094000184 12:25686528-25686550 AGCCCACTGCGGGGAGTGGGGGG - Intergenic
1095901917 12:47336389-47336411 AGCCAATTGTTGAGAGGGGTAGG + Intergenic
1096465768 12:51847280-51847302 AGCCCACTCCAGAGACTGGGCGG + Intergenic
1097431075 12:59507821-59507843 TGACCATGGGTGAGAGTGGGAGG + Intergenic
1099904660 12:88758047-88758069 AGGGCATTGCTGAGAGTTAGAGG - Intergenic
1100728066 12:97430939-97430961 CGCACAGTGTTGAGAGTGGGTGG - Intergenic
1101555735 12:105807384-105807406 AGACTATTCCTGGGAGTGGGAGG + Intergenic
1102620990 12:114194244-114194266 AGCCCTTTGCTCACAGTGTGCGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104530487 12:129565565-129565587 AGCCCTTGGCTGAGAGGAGGGGG + Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1109364670 13:61339443-61339465 AGCCCACGGCTGGGGGTGGGTGG - Intergenic
1113098806 13:106695213-106695235 AGCTCACAGCTCAGAGTGGGAGG - Intergenic
1113223763 13:108135957-108135979 AGCACATTGCTGGCAGTGTGAGG - Intergenic
1118736710 14:68706116-68706138 AGCCCTTTCCTGGGACTGGGTGG - Intronic
1118752928 14:68819607-68819629 AGCCCCTCCCTGGGAGTGGGCGG + Intergenic
1119509006 14:75196608-75196630 GGGCCAGTGGTGAGAGTGGGAGG - Intergenic
1119849217 14:77854844-77854866 AGCACACTCCTGTGAGTGGGTGG - Intronic
1120087537 14:80291411-80291433 AACCCATTACTAAGAGTGGATGG - Intronic
1122209663 14:100166223-100166245 AGCCCATCCAGGAGAGTGGGGGG + Intergenic
1125437012 15:39657068-39657090 AGCACATTGCAGAGAGTTTGTGG - Intronic
1127800512 15:62473233-62473255 AGCCCAGTGCTGTGAAGGGGTGG - Intronic
1127866396 15:63036784-63036806 CTCCCATCACTGAGAGTGGGTGG + Intergenic
1128126311 15:65195608-65195630 AGCCCATTTCTGAGTGAGGCCGG + Exonic
1128156397 15:65394452-65394474 TGCCCATTGCTCAGGCTGGGGGG + Exonic
1128876596 15:71206784-71206806 AGCAGATTGTGGAGAGTGGGAGG - Intronic
1129465596 15:75722631-75722653 ATCCCAGTGCTGAGAGGGGCCGG - Intergenic
1129544079 15:76376107-76376129 CCCCCAGTGCTGAGAGTGTGAGG - Intronic
1129616283 15:77100983-77101005 AGCCCCTTGCTGAGGGAGGGAGG + Exonic
1129932245 15:79421615-79421637 AGACCATTTCTAAGAGTAGGGGG - Intronic
1130870493 15:87967614-87967636 ATCCCATTGGTGAGAGCAGGAGG - Intronic
1133025970 16:2989135-2989157 AGCCCAGTACTGAGAATGGATGG + Intergenic
1133062304 16:3182945-3182967 AGCCCAGGGCTGAGAGGCGGAGG - Intergenic
1135911036 16:26560879-26560901 GGAACATTGCTGAGAGAGGGTGG + Intergenic
1138618051 16:58187808-58187830 AGCCCATGGCAGAGAGGGGCAGG + Intronic
1143282417 17:5764791-5764813 AGACCATCCCTGAAAGTGGGGGG - Intergenic
1146696030 17:34909655-34909677 ATCCCATTGCTGAGAGCCAGGGG + Intergenic
1147935394 17:44007780-44007802 AGCCCAGAGCTGGGAGTGGCAGG - Intronic
1148485914 17:47990969-47990991 GGGACACTGCTGAGAGTGGGAGG + Intergenic
1151815662 17:76470293-76470315 AGCCCATTGCTCGGTGGGGGGGG + Intergenic
1152008078 17:77694934-77694956 GGCCCTTTGCTGGGAGTGGAAGG - Intergenic
1152239421 17:79153758-79153780 AGCCCATTGCCAAAGGTGGGAGG - Intronic
1152877474 17:82795299-82795321 AGCCCGTTGCTGAGAGAGACCGG + Intronic
1153413818 18:4823726-4823748 AGCCCTTGGCTGAGAGGAGGGGG + Intergenic
1153752381 18:8246057-8246079 AACTCATTGCTCAGAGTGGGAGG - Intronic
1157973281 18:52295667-52295689 GGCCCATTTCTGTGAGTAGGTGG + Intergenic
1158886421 18:61831268-61831290 AGCCCAGGGTTTAGAGTGGGAGG - Intronic
1159446325 18:68545436-68545458 AGCCCATTGCTTTGAATGGAAGG + Intergenic
1160200047 18:76788660-76788682 AGCCCATGGCGGGGAGGGGGAGG + Intergenic
1160812496 19:1019035-1019057 AGCCCTCTGCTGAGAGAGGAGGG + Intronic
1161652238 19:5492538-5492560 AGCCCAGGGCTGCGAGTGGGGGG - Intergenic
1161773576 19:6244447-6244469 AGCCCACTGTTGAGAGAGGCGGG - Intronic
1161952898 19:7477528-7477550 AGCCCCTGCCTGTGAGTGGGAGG + Intronic
1162307236 19:9882589-9882611 AGCCCATAGCTGTGTGTGAGTGG + Intronic
1162326470 19:10002545-10002567 AGGCCATTGATGGGAGTGGGAGG - Intronic
1162357514 19:10195123-10195145 AGCCCACTGCTCCGCGTGGGGGG - Intronic
1163125285 19:15241126-15241148 AGCCCACTGCTGTGTGTGGCTGG + Intronic
1163403962 19:17111013-17111035 ACCCCAGTGCTGACTGTGGGTGG - Intronic
1164146270 19:22514434-22514456 AGCCCTATGGTGAGACTGGGTGG - Intronic
1164889870 19:31814219-31814241 ATCCCATGGCAGAAAGTGGGAGG - Intergenic
1165339589 19:35201438-35201460 AGACCAGTGCTGAGAGAGGATGG - Intergenic
1167093025 19:47357805-47357827 AGCCCATTGCTCTGAGCTGGAGG + Intronic
925749878 2:7078472-7078494 AGGCCAGGGCTGAGAGTAGGTGG + Intergenic
926276965 2:11411371-11411393 AGACCTTTGCTGAGAGTGGTGGG - Intergenic
927890062 2:26742573-26742595 AGCCCATGGCTGGGAGTGGTTGG + Intergenic
929093971 2:38246606-38246628 AGCCCATCGATGATGGTGGGGGG + Intergenic
930371668 2:50509476-50509498 AGCAAATTGCTGATTGTGGGTGG - Intronic
931489293 2:62726290-62726312 AGGTCAGTGGTGAGAGTGGGTGG + Intronic
934754856 2:96817685-96817707 AGGCCATCGATCAGAGTGGGAGG + Intronic
935454363 2:103250052-103250074 AGCCAATGGCTGAGTGTGGTGGG + Intergenic
935713184 2:105917294-105917316 AGCCCATTGCAGTGAGAGGGAGG - Intergenic
937028818 2:118721250-118721272 AGCTCATTGGTGAGTGTGGCTGG + Intergenic
938261453 2:129898373-129898395 TGTCCATTACTGAGAGTGGGAGG - Intergenic
942202093 2:173581625-173581647 AGGGCATTGGGGAGAGTGGGTGG + Intergenic
944428049 2:199604037-199604059 AGCCCAGTGCTGGGAGCGGAGGG + Intergenic
947530355 2:230905141-230905163 AGCACAGTTCTGGGAGTGGGTGG - Intergenic
1169868965 20:10231146-10231168 AGCTCATTGCTGAGGGATGGGGG - Intronic
1173985571 20:47259111-47259133 AGCTCTTTGCTGAAACTGGGTGG - Intronic
1175122209 20:56724489-56724511 AGCCCACAGGTGGGAGTGGGAGG - Intergenic
1176189413 20:63800813-63800835 AGCCCACTGCGGGGAGGGGGAGG - Intronic
1177446277 21:21200354-21200376 AACCCATTCCTGAGAGTTGACGG - Intronic
1179078470 21:38146903-38146925 AGTCCACCGTTGAGAGTGGGAGG - Intronic
1180657741 22:17437386-17437408 AGCCAACTGCTGAGAGTTGCTGG + Intronic
1181000632 22:19986428-19986450 ACCTCAATGCTGAGAGGGGGAGG + Intronic
1183422374 22:37719362-37719384 TGCCCTTTGCTGAGAGCAGGTGG + Intronic
1184881098 22:47304591-47304613 AGCCCCATGGTGAGAGTGAGGGG + Intergenic
1184929688 22:47671931-47671953 AGGTCATAGCTGAGACTGGGTGG - Intergenic
953370977 3:42388113-42388135 AGCTCATTTGTGACAGTGGGTGG + Intergenic
953806672 3:46076265-46076287 GGCCAAGTGCTGAGTGTGGGTGG - Intergenic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
957437697 3:80200330-80200352 AAACCATTGCGGAAAGTGGGTGG - Intergenic
959443469 3:106408071-106408093 AGCACATTGCTTAGAGTGGATGG - Intergenic
959633833 3:108538895-108538917 ACCCCATGGCAGAGAGTGGAAGG + Intergenic
960923045 3:122767823-122767845 AGCCAAGTCCAGAGAGTGGGTGG + Intronic
961500513 3:127329812-127329834 AGGCCATGGCTGAGAGGGGCTGG - Intergenic
963285451 3:143430608-143430630 AGCCCAGATCTGAGAGGGGGAGG + Intronic
964405527 3:156344492-156344514 AGCGCACAGCTGAGAGAGGGTGG + Intronic
964480485 3:157134052-157134074 AGACCTTTGCTGAGAGAGGTGGG - Intergenic
964642950 3:158929448-158929470 AGCCCCTGGATGAGAGTGGTGGG + Intergenic
968494915 4:910232-910254 AGCCCTGTGCTGAGTGAGGGAGG - Intronic
968954324 4:3710571-3710593 AGCCCACTGCGGGGGGTGGGTGG - Intergenic
968965723 4:3768194-3768216 AGCCCCTTGCTGAGGGGGGAAGG - Exonic
969497240 4:7533194-7533216 AGCCCAAAGCTGAGGGTGGAGGG + Intronic
969987412 4:11226180-11226202 AGGCCAAGGCTGAGAGTTGGAGG - Intergenic
970491556 4:16580362-16580384 AGCCCCCTGCTGAGACTGAGAGG + Intronic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972640368 4:40919897-40919919 GGCTCATTGCTGACAGTAGGGGG + Intronic
972829472 4:42798140-42798162 TGACTATTGCTGAGAGTGGAAGG - Intergenic
974380124 4:61128774-61128796 AGCCAAGTGCTCATAGTGGGTGG - Intergenic
975663361 4:76709189-76709211 AGGCCATGGCTGAGAGGGGAAGG - Intronic
976276540 4:83284498-83284520 AGCCCATTGGTGAGTGCGGGCGG - Exonic
976352891 4:84080715-84080737 TGCCCAGTGGTGTGAGTGGGAGG - Intergenic
976367544 4:84247106-84247128 AGCTCATTGCTGACAGAGGCTGG - Intergenic
978050198 4:104189831-104189853 AGCCCATTGATGAGTGTGCTTGG - Intergenic
978570885 4:110135735-110135757 AGACCATTGCTGATAATAGGAGG - Intronic
979724316 4:123942383-123942405 AGCCCAGTGCTGGCAGAGGGTGG - Intergenic
984024923 4:174531275-174531297 AGCCCATTGCCTAGACTTGGAGG + Intergenic
985494816 5:198517-198539 AGCCCACTGGTGTCAGTGGGCGG + Exonic
985832960 5:2249572-2249594 AGCCGGATGCTGACAGTGGGAGG + Intergenic
988530346 5:32022036-32022058 AGCACAGTGCTGAGTGTGGACGG - Intronic
988864999 5:35324737-35324759 AGGCGGTTGCTCAGAGTGGGTGG - Intergenic
990876776 5:60494886-60494908 GGCCCATTTCTGAGAGGGGAAGG - Intronic
992812898 5:80407693-80407715 AGCCCTTTGCTGAGCCTGCGCGG - Intergenic
994276339 5:97842838-97842860 AGCCAATGACTGAGAGTGGCAGG - Intergenic
995271750 5:110227851-110227873 ATCCTAATGCTGAGAGTAGGAGG - Intergenic
997131922 5:131285758-131285780 AGCCCATAGCTGTGACTGAGAGG + Intronic
998138699 5:139688105-139688127 AGCCCAGGGCTGCGGGTGGGCGG - Intergenic
1001231655 5:169994009-169994031 TTCCAATTGCTCAGAGTGGGGGG - Intronic
1003231430 6:4257246-4257268 AGCCCAGTGAAGAGAGTAGGAGG - Intergenic
1005725699 6:28645955-28645977 AGCTCTTTGCTGAGTGTGAGGGG + Intergenic
1006747180 6:36351344-36351366 AGCTCCTTTCTGAGAGTGAGGGG + Intergenic
1007231379 6:40349615-40349637 AGCTCAGTGGTGTGAGTGGGTGG + Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010452054 6:76014416-76014438 AGCCCATGGCAGGGTGTGGGTGG - Intronic
1010750921 6:79615221-79615243 ATCACACTTCTGAGAGTGGGAGG + Intergenic
1013603830 6:111730180-111730202 GGCGCAGTGCTGGGAGTGGGCGG + Intronic
1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG + Intergenic
1015550025 6:134402589-134402611 GATTCATTGCTGAGAGTGGGTGG - Intergenic
1018043311 6:159944206-159944228 ACCCCATGGCAGAAAGTGGGAGG - Intergenic
1019736441 7:2652286-2652308 AGCACATTGCTGTGTGTGGAGGG + Intronic
1022128896 7:27384595-27384617 AGACCGTTGCTGAGAGTAGCTGG - Intergenic
1022870434 7:34472175-34472197 GACCCACTGCTGAGAGTGGCAGG + Intergenic
1023999352 7:45180592-45180614 AGCCCATTGCTGCTATTGGAGGG - Intronic
1028968371 7:96827951-96827973 AGGGCAGAGCTGAGAGTGGGAGG + Intergenic
1034167775 7:149038976-149038998 AGCCGACTGCTGCGAGTGCGGGG + Intergenic
1035288255 7:157819754-157819776 TGCCCATGGCTGGCAGTGGGTGG - Intronic
1036628002 8:10487888-10487910 AGCCAATGGCTGAGAGTGGCAGG + Intergenic
1037549208 8:19953688-19953710 AACACAGAGCTGAGAGTGGGAGG - Intronic
1037591149 8:20313172-20313194 AGCCCAGTGCTGGGAGGGGCAGG + Intergenic
1042696290 8:71557563-71557585 CGCCCACTGCCGAGAGTAGGGGG + Intronic
1045344769 8:101284086-101284108 TGCCCATTACTAAGAGCGGGGGG - Intergenic
1045650809 8:104340196-104340218 AGCCCATTGCTGCGTGTGCCAGG - Intronic
1049313264 8:141945094-141945116 AGCCCTGTGCTGAGGGAGGGAGG - Intergenic
1050426970 9:5521590-5521612 AGACTATTGCTGAGAGGGAGAGG - Intronic
1051221482 9:14852748-14852770 AGCCCATTGCTGAGAGAACCAGG + Intronic
1053512402 9:38699618-38699640 AGCCAATTACTGAGGGTGGCAGG - Intergenic
1057439252 9:95070756-95070778 AGCCCAACTCTGAGAGTGGCCGG + Intronic
1057863957 9:98664585-98664607 AGACTGTTACTGAGAGTGGGAGG - Intronic
1060182552 9:121544512-121544534 AGCCCAGTGGTGAGAGCAGGGGG + Intergenic
1061078329 9:128355211-128355233 AGCCCCTTCCTGAGGGTTGGGGG + Intronic
1061297094 9:129682626-129682648 AAGCCATTGCTGAGAGGGGGTGG - Intronic
1061964505 9:134005311-134005333 ACCCCATTGCTGAGGGCAGGTGG + Intergenic
1062045778 9:134423845-134423867 AGGCTTTTGCTGAGAGAGGGCGG + Intronic
1187449933 X:19387280-19387302 AGCCCACTGTTGAGAGGGTGTGG - Intronic
1187665935 X:21609396-21609418 ACCCCTTAGCTGAGAGTGAGAGG + Exonic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1190549534 X:51564504-51564526 AGCCCATTTCAGGCAGTGGGTGG + Intergenic
1191192035 X:57677859-57677881 AGCCCATTGCTAAGTGGTGGTGG + Intergenic
1192172601 X:68866269-68866291 AGCACATGGCAGAGGGTGGGTGG + Intergenic
1193494724 X:82197149-82197171 AGCACAGTGCTGAGGGTAGGAGG + Intergenic