ID: 1080337014

View in Genome Browser
Species Human (GRCh38)
Location 11:31209285-31209307
Sequence TGCCAGGTATGTTACCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080337014_1080337021 9 Left 1080337014 11:31209285-31209307 CCTCCGAGGTAACATACCTGGCA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1080337021 11:31209317-31209339 AATGGTAGTGATTTCTAAAAAGG 0: 1
1: 0
2: 1
3: 32
4: 345
1080337014_1080337019 -9 Left 1080337014 11:31209285-31209307 CCTCCGAGGTAACATACCTGGCA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1080337019 11:31209299-31209321 TACCTGGCAAAGGCAGGGAATGG 0: 1
1: 0
2: 1
3: 34
4: 384
1080337014_1080337022 20 Left 1080337014 11:31209285-31209307 CCTCCGAGGTAACATACCTGGCA 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1080337022 11:31209328-31209350 TTTCTAAAAAGGAGAACACAAGG 0: 1
1: 0
2: 3
3: 48
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080337014 Original CRISPR TGCCAGGTATGTTACCTCGG AGG (reversed) Intronic
903852498 1:26316541-26316563 AGCCATGTATGTAACCTCTGGGG - Intronic
907918768 1:58894274-58894296 AGCCAGCTATGTTAGCTGGGTGG + Intergenic
908668792 1:66522650-66522672 TGCTAGTTATGTCACCTGGGAGG + Intergenic
912634515 1:111279404-111279426 GGTCAGGTATGTTACACCGGGGG + Intergenic
914834393 1:151195447-151195469 TGCCAGGAATGTTACCGGGGAGG + Intergenic
920072957 1:203316348-203316370 TGCTAGGCATCTGACCTCGGTGG + Intergenic
924437134 1:244051373-244051395 CTCCAGGTCTGTTACATCGGTGG - Exonic
1074472819 10:113742760-113742782 TGTCAGGTATGTTATCCCTGAGG - Intergenic
1074662384 10:115675691-115675713 TGCCAGGTATGTAACCACAGTGG - Intronic
1080337014 11:31209285-31209307 TGCCAGGTATGTTACCTCGGAGG - Intronic
1080674777 11:34415375-34415397 TGCCAGAAATGTTAGCTCTGGGG + Intergenic
1087287950 11:96286369-96286391 TGCCAGGTTTAATACCTAGGTGG + Intronic
1087591138 11:100189188-100189210 GGGCAGGTTTGTTACCTGGGTGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088217756 11:107532347-107532369 TGCCAGTTATGTTGCCTCGTCGG - Exonic
1090232653 11:125119722-125119744 TGCCTGGTATTTTGCCTCTGAGG - Intergenic
1097346557 12:58499633-58499655 TGCCAGGTATGCTGCCTCATTGG - Intergenic
1097372578 12:58802237-58802259 TGCCAGGAATGTTTTCTGGGTGG - Intronic
1105948873 13:25212106-25212128 TGCCAGGGCTGGTCCCTCGGTGG - Intergenic
1113897879 13:113777354-113777376 TGCCAGCTATGTGACCTGGGCGG + Intronic
1124033684 15:26033919-26033941 GGCCAGTTAGGTTACCTGGGTGG - Intergenic
1124373854 15:29118326-29118348 TGACTGGTCTGTTACCTCAGCGG + Intergenic
1141112352 16:81280634-81280656 TACCAGGTATGTGACCTTGGAGG + Intronic
1155722773 18:29039433-29039455 TGCCAGGTATGTTTCTTCTAAGG - Intergenic
1165078052 19:33291666-33291688 TGCCAGGAATGCTACCACGAGGG - Intergenic
930200854 2:48551079-48551101 TTGCAGGTTTGTTACCTGGGTGG + Intronic
937882959 2:126882273-126882295 TGCCATGCATGTGACCTTGGGGG - Intergenic
1183219517 22:36503717-36503739 TGCCAAATCTGTGACCTCGGCGG - Intronic
952193134 3:31044875-31044897 TGACAGGTTTGTTATCTCTGTGG - Intergenic
954334208 3:49906669-49906691 AGCCAGCTATGTTAGCTTGGGGG - Intronic
970483077 4:16497285-16497307 TGCCAGATGTTTTACCTTGGTGG - Intergenic
971346337 4:25815149-25815171 TGGCAGGTATGGTCCCTCGGGGG + Intronic
974258025 4:59487525-59487547 TGCCAGGTTTTATACCTTGGGGG + Intergenic
974438385 4:61885765-61885787 TACCAGCTATGTAAGCTCGGGGG + Intronic
976609249 4:87012915-87012937 TGCCAGGTCTGTTGGCTCTGTGG - Intronic
978157369 4:105505322-105505344 TGCCAGGAGTGTTACCTTGAAGG - Intergenic
980081675 4:128350944-128350966 AGCCAGGCATGTTACCTCGAAGG - Intergenic
981896768 4:149810907-149810929 TGGCAGATATGTTACATAGGAGG - Intergenic
987668472 5:20976617-20976639 TGCCAGTTATCTGACCTGGGTGG - Intergenic
1014152209 6:118070343-118070365 TGGCAGTTATGTTTCCTCTGTGG + Intronic
1029515456 7:101020539-101020561 TGCCAGGGATCATGCCTCGGGGG - Intronic
1038547197 8:28434860-28434882 GGCCAGGCATGTTACCTCAAGGG + Intronic
1055087145 9:72325869-72325891 TTCCAAATATGTTACCTAGGAGG + Intergenic
1061646364 9:132005432-132005454 TGCCAGGTATTTGACCACGAAGG + Intronic
1188709598 X:33379088-33379110 TGCCAGATATGTTTCATGGGGGG - Intergenic
1200826786 Y:7653325-7653347 TGCCATGTATGATGCCTCGCCGG - Intergenic