ID: 1080337207

View in Genome Browser
Species Human (GRCh38)
Location 11:31211156-31211178
Sequence TTTAGCAATCAGACTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080337205_1080337207 10 Left 1080337205 11:31211123-31211145 CCATGACTTCATGAGCATATTCA 0: 1
1: 0
2: 2
3: 14
4: 193
Right 1080337207 11:31211156-31211178 TTTAGCAATCAGACTGAGCTTGG 0: 1
1: 0
2: 3
3: 9
4: 198
1080337204_1080337207 13 Left 1080337204 11:31211120-31211142 CCACCATGACTTCATGAGCATAT 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1080337207 11:31211156-31211178 TTTAGCAATCAGACTGAGCTTGG 0: 1
1: 0
2: 3
3: 9
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080337207 Original CRISPR TTTAGCAATCAGACTGAGCT TGG Intronic
900838748 1:5029607-5029629 TTTAGCAGGCAGTCTGAGCAAGG + Intergenic
900973058 1:6002064-6002086 ATTACCAGTCAGGCTGAGCTGGG - Intronic
901846375 1:11985391-11985413 TTTTGTAATCAGGCAGAGCTGGG - Intronic
901896216 1:12314833-12314855 TTTTGGAATCAGACAGATCTGGG + Intronic
903579973 1:24363471-24363493 CTTTGCACTCAGACAGAGCTGGG + Intronic
905070588 1:35221730-35221752 TTGAGAAATCAGACAGATCTGGG - Intergenic
906773962 1:48511805-48511827 TTTTGCAGTCAGACAGAGCAGGG + Intergenic
909496798 1:76287969-76287991 TTTAGCAATCAGCCTGCCTTGGG + Intronic
912730640 1:112099988-112100010 TTTTGGAATCAGACTGAATTAGG + Intergenic
912953594 1:114137153-114137175 CATATCAATCAGACTGAACTAGG - Intronic
913471548 1:119192435-119192457 TTTTGGAATCAGACAGACCTGGG - Intergenic
913547583 1:119884758-119884780 ATTTGCAGTCAGACTGATCTGGG + Intergenic
917598460 1:176552796-176552818 TGTGGCGATCAGACTGAGCAGGG - Intronic
917807581 1:178627619-178627641 ATTAGCTATGAGAGTGAGCTGGG - Intergenic
918662721 1:187108893-187108915 TTAAGGAATCAGACAGATCTTGG + Intergenic
920899736 1:210096193-210096215 TTTGGCAGTCAGACAGACCTGGG - Intronic
921681623 1:218039818-218039840 CTTAGGAATCAGATTGAGGTGGG + Intergenic
922546624 1:226462753-226462775 TTTAGGAATCTGACCGATCTTGG + Intergenic
924503571 1:244659431-244659453 GTTAACAATCTGAATGAGCTTGG - Intronic
1065848367 10:29765239-29765261 TTTTGCAAAAAGACTGAGATGGG - Intergenic
1065855611 10:29827711-29827733 TTTAGCTGTCAGTTTGAGCTTGG - Intergenic
1066402699 10:35090675-35090697 TTTCGCAATCACACGAAGCTTGG - Intergenic
1067852761 10:49765042-49765064 TTTAGAAATCAGGCTGGGCATGG - Intergenic
1068471799 10:57474610-57474632 TTTACCAATCAGAATGAGGGAGG - Intergenic
1068964803 10:62901404-62901426 TTTAGAAATCAGGCTGTGCGGGG + Intronic
1072220267 10:93321216-93321238 CTTCGCAATCAGACTGACCTGGG - Intronic
1072922911 10:99591727-99591749 TTAAAAAATCTGACTGAGCTGGG - Intergenic
1073333463 10:102686752-102686774 TTTGATAATCAGACTGAGCACGG - Intronic
1074868916 10:117561984-117562006 TTTAGAAATCAAACAGAACTTGG - Intergenic
1075075860 10:119349715-119349737 TTCACCATTCAGACTTAGCTGGG - Intronic
1079302381 11:19289696-19289718 TTTTGCAGTCAGTCTGAGCTGGG - Intergenic
1079324201 11:19477499-19477521 TTTTGCATTCAGACGGAACTGGG + Intronic
1079873139 11:25825144-25825166 TTCAGGAATCAGACTAACCTGGG - Intergenic
1080185988 11:29487194-29487216 GTTGGCAATCAGAGTGAGTTAGG - Intergenic
1080337207 11:31211156-31211178 TTTAGCAATCAGACTGAGCTTGG + Intronic
1080977018 11:37355487-37355509 TTTAGTAAACACACTGAACTTGG - Intergenic
1081604918 11:44521072-44521094 TTTTGGAATCAGACAGACCTTGG - Intergenic
1084431268 11:69112697-69112719 AATAGCAATCAGGCTGAGCGCGG + Intergenic
1085846505 11:80072157-80072179 TTTATCAGTCAGGATGAGCTAGG + Intergenic
1087344593 11:96955454-96955476 TTGAGCAATCAGAAGGAGTTTGG - Intergenic
1087681649 11:101224778-101224800 TTTAGCCATCAGTATGGGCTTGG + Intergenic
1088371297 11:109091063-109091085 TTTGGGAATCTGACTGAGCCTGG + Intergenic
1089017988 11:115182671-115182693 TTTGGCAAAAAGACTGACCTTGG + Intronic
1089018109 11:115183571-115183593 TTTGGCAAAAAGACTGACCTTGG - Intronic
1089627110 11:119758282-119758304 TTCAGAAAAAAGACTGAGCTGGG - Intergenic
1090175519 11:124645589-124645611 TATAGCAATCAGGCCGGGCTTGG - Intronic
1090414813 11:126533711-126533733 CTCAGGAATCAGACTGACCTGGG + Intronic
1090671009 11:128945323-128945345 TTTAACACTCAGACTGCTCTGGG - Intergenic
1091104602 11:132906845-132906867 TTTAGCAACCAGAGTGAGGCTGG + Intronic
1094098812 12:26738633-26738655 TTTACCAACAAGAATGAGCTTGG + Intronic
1100348886 12:93759733-93759755 TTCTGGAATCAGACTGAGATAGG - Intronic
1100558308 12:95720588-95720610 TTTAAAAATGAGACTAAGCTCGG - Intronic
1101075920 12:101129844-101129866 GTTAGCAACCAGGCTGGGCTTGG + Intergenic
1101581760 12:106048218-106048240 TTCAGCAACCCGAGTGAGCTTGG - Intergenic
1101827194 12:108229635-108229657 TTTTGGAATCAGACCGACCTGGG - Intronic
1102631996 12:114288999-114289021 TTTTGAAATCAGACAGACCTGGG - Intergenic
1102966241 12:117129888-117129910 TTTTGGAGTCAGGCTGAGCTGGG + Intergenic
1103176088 12:118864731-118864753 CTTGGGAATCAGCCTGAGCTGGG + Intergenic
1106422909 13:29598280-29598302 TTTAGCAATCCCACTCAGCAAGG + Intergenic
1107406701 13:40121430-40121452 TTTAGCAAACAAACTGTGGTAGG + Intergenic
1107553701 13:41499441-41499463 TTTACCAATGGGGCTGAGCTGGG - Intergenic
1108527505 13:51298561-51298583 TTTTGCAATCCGACAGATCTGGG - Intergenic
1109953010 13:69526632-69526654 TTTAGTAATGGGACTGAGTTTGG + Intergenic
1110070021 13:71163419-71163441 CTTAGCAATCAGTCTGAAGTAGG - Intergenic
1111889650 13:94065855-94065877 GTTAGGAATGAGAATGAGCTAGG + Intronic
1112740126 13:102463469-102463491 TTTAGAAAACAGTCTGGGCTGGG + Intergenic
1114788157 14:25624952-25624974 TTTAGTAATGACACTAAGCTTGG - Intergenic
1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG + Intergenic
1120689591 14:87577689-87577711 TGTAGCAATCAGGAAGAGCTCGG + Intergenic
1121362429 14:93273789-93273811 TTTCCCAATCAGACTGTGCTGGG - Intronic
1122175530 14:99915701-99915723 TTTAGGAGTCAGACTGAGCTGGG - Intronic
1124486059 15:30117680-30117702 TTTAGGATTCAGACAGACCTGGG + Intergenic
1124517516 15:30379589-30379611 TTTAGGATTCAGACAGACCTGGG - Intronic
1124541134 15:30586666-30586688 TTTAGGATTCAGACAGACCTGGG + Intergenic
1124547844 15:30648449-30648471 TTTAGGATTCAGACAGACCTGGG + Intronic
1124757524 15:32420921-32420943 TTTAGGATTCAGACAGACCTGGG - Intergenic
1124872903 15:33561282-33561304 TAAAGCAATTAGACTGTGCTGGG + Intronic
1127818325 15:62632412-62632434 TTTAGTGATCAGAGTGACCTAGG + Intronic
1130733283 15:86521802-86521824 GTTAGCAATTCCACTGAGCTTGG + Intronic
1135185902 16:20315596-20315618 TTTTGGAATCAGACTGAGCTGGG + Intronic
1139071278 16:63386430-63386452 ATTTGGAATCAGACCGAGCTGGG + Intergenic
1139295534 16:65897301-65897323 TTCAGCAAGCAGAGTGGGCTTGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141932149 16:87212955-87212977 TTTAGGAATCAGACAGATTTGGG - Intronic
1142116373 16:88358210-88358232 CTAAGCAAACAGACTCAGCTCGG + Intergenic
1143809639 17:9460777-9460799 TTTTGTCATCAGACTGATCTGGG + Intronic
1143916388 17:10296404-10296426 TTAAGCCCTCAGGCTGAGCTGGG - Intergenic
1148992801 17:51681102-51681124 CTTTGCAATCAGAAAGAGCTGGG + Intronic
1153756129 18:8285293-8285315 GTTAGGAATCAGTCAGAGCTGGG + Intronic
1155496570 18:26448513-26448535 TTGAGCAATCTGACGCAGCTGGG - Intergenic
1155776850 18:29775283-29775305 TTTAGCACTCACTCTGTGCTGGG + Intergenic
1162142913 19:8595560-8595582 CTAAGCAATCAGACAGTGCTTGG - Intronic
1166008907 19:39926862-39926884 TTTAGCAACCAGGGAGAGCTGGG - Intronic
1166327501 19:42060102-42060124 TCTAGGACTCTGACTGAGCTGGG - Intronic
1167354278 19:48993636-48993658 TTTTGCAATCGGCCTGAGCGGGG + Exonic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
925979260 2:9164025-9164047 TTTGGCATCCAGACTGAGCCTGG + Intergenic
927111330 2:19865606-19865628 TTTAGCACCCAAACTGAGATGGG - Intergenic
930807078 2:55501770-55501792 TTTATCAATCAGAGTGAGGGTGG + Intergenic
932131163 2:69188437-69188459 CTAAGCAATAAGACTGTGCTGGG - Intronic
933218985 2:79666666-79666688 TTTTGCATTGAGACTGAGCTAGG + Intronic
933576939 2:84080002-84080024 TTTAGCAATAGGACTCACCTAGG + Intergenic
938133972 2:128738684-128738706 TTTAGAAATCACAATAAGCTGGG - Intergenic
939606201 2:144257449-144257471 TTTGGCAGTCATTCTGAGCTAGG - Intronic
943772034 2:191728383-191728405 TTTACAAATCAGACTGAAATAGG + Intergenic
945827519 2:214742229-214742251 TTTAAAAATCAAACTGAGCCAGG + Intronic
947882751 2:233533680-233533702 TTTGGAAATCAGACTCAGCCTGG + Exonic
948602078 2:239112932-239112954 TTTAGGAATCAGGCTGGGCGTGG + Intronic
1170508583 20:17054329-17054351 TTTAAAAAGCAGTCTGAGCTGGG + Intergenic
1171726222 20:28623548-28623570 TTTTGCATTCAGACTGAACATGG + Intergenic
1171857292 20:30358792-30358814 TTTTGCATTCAGACTGAACATGG - Intergenic
1173546815 20:43904020-43904042 TTTAGCAAGCAGCCTGGGCCTGG - Intergenic
1174102846 20:48140239-48140261 TTCAACATTCAGACTGATCTCGG + Intergenic
1181093379 22:20489514-20489536 TTTGGGAAACAGACTGACCTGGG + Intronic
1181998845 22:26903820-26903842 TTTAGAAATCTGACTGCTCTGGG - Intergenic
1183366978 22:37412038-37412060 TTCAGAAAGCAGACTGAGGTTGG + Intronic
949780683 3:7683905-7683927 TTTAGCATTGATACTGATCTAGG + Intronic
949875871 3:8625706-8625728 CTTTGCAATCAGACAGACCTGGG + Intronic
950743617 3:15069165-15069187 TTTTGCAGTCAGACAGACCTAGG + Intergenic
950860578 3:16144524-16144546 TTTACCAATGAGACTTACCTAGG + Intergenic
953312665 3:41894756-41894778 TTTAGGATTCAGACAGACCTGGG - Intronic
954567915 3:51614477-51614499 TTGAGCAGTCAGAATGATCTTGG + Intronic
954946023 3:54425032-54425054 TTTAGAAGTCAGAAAGAGCTGGG + Intronic
955676824 3:61457551-61457573 TTTTAAAATCAGACTGAACTGGG - Intergenic
956128611 3:66034313-66034335 CTTTGGAATCAGACAGAGCTGGG + Intronic
956376363 3:68617538-68617560 TGTAGAAATCAGACTAAACTAGG - Intergenic
956491992 3:69782563-69782585 TTTAGAAATCAGACAGGACTGGG - Intronic
959698207 3:109272445-109272467 TTTAGCATTCAGATTGACATTGG + Intergenic
960853471 3:122079405-122079427 TTCAAAAATCAGACTGAGGTGGG + Intronic
961500441 3:127329036-127329058 TTTTACAATCAGACAGACCTAGG - Intergenic
961731822 3:128971031-128971053 TTTTGGAATCAAACAGAGCTGGG + Exonic
961755978 3:129127674-129127696 TTGAGCAAACAGACTGAGAGTGG - Intronic
961804560 3:129479984-129480006 TCTAGCAATGACTCTGAGCTGGG + Intronic
962031748 3:131608346-131608368 GATAGCAATCTGACTGAGCCAGG + Intronic
962115141 3:132497623-132497645 TTTACTAATCAGAATGAGTTTGG + Intronic
964622232 3:158729817-158729839 CTTAGAAATCTGAGTGAGCTTGG + Intronic
966565486 3:181376096-181376118 TTTTACAATGAGACTGAGATAGG + Intergenic
966673873 3:182563303-182563325 TCTAGTAATCAGACAGTGCTGGG + Intergenic
968079124 3:195834520-195834542 TTTTGGAATCAGACCGAGCTGGG - Intergenic
969998990 4:11344957-11344979 CTTAGGAAGCAGACTGACCTGGG - Intergenic
972333118 4:38081555-38081577 CTTCGCAATCAGACTGGGGTTGG - Intronic
976018484 4:80590341-80590363 TTTAGAACACAGAATGAGCTGGG + Intronic
976393463 4:84530422-84530444 TTTTGCAATCATAGTGAGATTGG + Intergenic
978612915 4:110564336-110564358 TTTTGAAATCAGAGTGACCTGGG + Exonic
983385991 4:167062059-167062081 ATTAGTAATTAGACTCAGCTGGG - Intronic
984389690 4:179112930-179112952 TTTTGCAATCACACTTAGCTAGG + Intergenic
985434305 4:189914153-189914175 TTTTGCATTCAGACTGAACATGG - Intergenic
986208395 5:5647602-5647624 TGTAGCACAGAGACTGAGCTTGG - Intergenic
989314596 5:40063204-40063226 TTTAGCAATATGAATGGGCTGGG - Intergenic
990715579 5:58632830-58632852 GTTAGCAATCAGACAGAAGTGGG - Intronic
995368997 5:111397172-111397194 TTTGGCAGTGAGACAGAGCTAGG + Intronic
996296631 5:121925693-121925715 TTCAGGAATCAGACAGATCTGGG - Intergenic
997906774 5:137824916-137824938 TTTTGCAATCAGATAGATCTTGG + Intergenic
998444208 5:142186125-142186147 TTTACCAATCGGTCTGACCTGGG + Intergenic
999546394 5:152633178-152633200 TATAACAGTCAGACTGACCTAGG - Intergenic
1003093539 6:3124234-3124256 TTTAGAAATCAGAGTTAGATTGG + Intronic
1003500880 6:6701814-6701836 ATTAGAAATCAGACTGATGTTGG - Intergenic
1003756677 6:9128706-9128728 TTCAGCAATGTGAATGAGCTTGG + Intergenic
1003820935 6:9896324-9896346 GTTACCAGTGAGACTGAGCTGGG - Intronic
1005153217 6:22776152-22776174 TGTATCAACCAGCCTGAGCTAGG + Intergenic
1006523577 6:34586316-34586338 CTTGGCAATCAGACAGGGCTGGG + Intergenic
1008687398 6:53941098-53941120 TTTTGCAATCACTCTCAGCTCGG - Intronic
1010924459 6:81726907-81726929 TTTAGCAAATATACTGAGTTGGG - Intronic
1015960254 6:138641201-138641223 TTTAGTAATCCCATTGAGCTGGG - Intronic
1017995938 6:159531684-159531706 CTTTGCAATCAGACAGAACTGGG + Intergenic
1020537044 7:9412898-9412920 TTTAGAAATCAGACTGAAGAAGG - Intergenic
1021227849 7:18049480-18049502 TTTTGCAATCAGACAAAACTGGG + Intergenic
1022748106 7:33193485-33193507 TTGAGCAATCAAGCTTAGCTTGG + Intronic
1022757476 7:33308985-33309007 CTTTGGAATCAGAGTGAGCTTGG + Intronic
1022813519 7:33892239-33892261 TTAAGGAATCAGGCTGAGTTGGG + Intergenic
1023435743 7:40138981-40139003 TTTAGGAATCAGGCTGGGCGTGG + Intronic
1023742703 7:43294719-43294741 TTTTGAAGTCAGACTGACCTGGG - Intronic
1028014397 7:85688221-85688243 TTGAGTAATCTGACAGAGCTAGG - Intergenic
1031070900 7:117160464-117160486 TTTTGCAATCAGATAGATCTGGG - Intronic
1032144330 7:129365527-129365549 TTTTGGAATCAGACAGAGTTAGG - Intronic
1033274288 7:139959624-139959646 TTTAGCAGTCTGTCTGGGCTGGG + Intronic
1034060184 7:148080243-148080265 TTTATCAGTCAGGATGAGCTGGG - Intronic
1036510840 8:9398649-9398671 TTCTGAAATCAGACTGATCTTGG + Intergenic
1037925520 8:22841210-22841232 CTTCGCAGTCAGACAGAGCTGGG - Intronic
1038235807 8:25753130-25753152 TATAGCAATCCTGCTGAGCTGGG + Intergenic
1038244616 8:25843694-25843716 TTTAGAAATCAGACGGAGCTGGG + Exonic
1038530245 8:28312737-28312759 TTTAGTAATCAGCAAGAGCTAGG - Intergenic
1039372751 8:37003068-37003090 TTTATCACTCAGAATGAGCTGGG + Intergenic
1040510144 8:48085931-48085953 TTTATTAATCAGACTGAGACTGG + Intergenic
1040767668 8:50934334-50934356 TTTTACAGTCAGAATGAGCTTGG - Intergenic
1042640104 8:70924321-70924343 TTTAGAAAGTGGACTGAGCTCGG - Intergenic
1044868445 8:96595207-96595229 TTTTGTGATCAGATTGAGCTGGG + Intronic
1044916500 8:97117856-97117878 TGTAGAAATCAGAATGGGCTGGG - Intronic
1045772783 8:105763725-105763747 TTTAAAAATCAGACAGATCTGGG - Intronic
1046618406 8:116501962-116501984 CTTTGCACTCAGACTGACCTGGG - Intergenic
1046732805 8:117743781-117743803 TTTTAGAATCAGACTGACCTGGG + Intergenic
1047398599 8:124526949-124526971 TTTAGCAAACAGACAAAGCCAGG + Intronic
1051572562 9:18576933-18576955 TTTTGAACTCAGACAGAGCTGGG - Intronic
1051694754 9:19755943-19755965 TATAGCAGTCATAATGAGCTTGG + Intronic
1052021907 9:23534846-23534868 TTTAGCAGTCAGAAAGACCTGGG + Intergenic
1053723393 9:40972315-40972337 TTTTGCATTCAGACTGAACATGG - Intergenic
1054342572 9:63879681-63879703 TTTTGCATTCAGACTGAACATGG + Intergenic
1055092490 9:72377277-72377299 TTTGGAAGTCAGACTGACCTGGG - Intergenic
1055160721 9:73123662-73123684 AATAACAATCAGACTGAGCCAGG - Intergenic
1055623085 9:78146119-78146141 TTTAGGATTCAGAGAGAGCTAGG - Intergenic
1056323361 9:85457488-85457510 TTTGGAAATGAGACTGAGCCAGG + Intergenic
1058544925 9:106051133-106051155 CTTTGCAATCAGACAGACCTGGG + Intergenic
1059134881 9:111795332-111795354 TTTAGCAATCAGACAGATTCAGG + Intergenic
1059503515 9:114777307-114777329 TTTTGCAATCAGCCAGACCTTGG + Intergenic
1060695384 9:125705241-125705263 TTTAGGCATCAGACAGACCTGGG + Intronic
1062401759 9:136375902-136375924 TTTACCAAGCAGACTGGGCGTGG - Intronic
1189553610 X:42118784-42118806 CTTTGCAATCACACAGAGCTGGG + Intergenic
1194711384 X:97240971-97240993 TTTAGGAATCAGACAGACCTAGG - Intronic
1197007829 X:121524082-121524104 TTTTAGAATCAGACTGACCTGGG + Intergenic
1198711214 X:139506567-139506589 TTTTGCAATCAGAAAGATCTGGG + Intergenic
1200001587 X:153064388-153064410 ATTAACCATCACACTGAGCTGGG - Intergenic