ID: 1080341339

View in Genome Browser
Species Human (GRCh38)
Location 11:31268946-31268968
Sequence ATGTTTTAGCTCAATGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 380}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080341339 Original CRISPR ATGTTTTAGCTCAATGAAAA GGG (reversed) Intronic
900769796 1:4531575-4531597 ATGTTTTAGCTCAAGTTCAAAGG - Intergenic
901337779 1:8466010-8466032 TTGTTTTAGCTGCATGAAAGCGG - Exonic
901580296 1:10236921-10236943 ATGTGTTAGCTGCATTAAAAAGG + Intronic
902944847 1:19827739-19827761 ATATTTTATCATAATGAAAAAGG - Intergenic
903032272 1:20472465-20472487 AGGATTTAGCTAAATGGAAAGGG + Intergenic
903432379 1:23316389-23316411 CTGTTTTAGATCTAGGAAAAAGG + Intronic
904204342 1:28843259-28843281 ATATTTTATCACAATAAAAAAGG - Intronic
905586238 1:39121348-39121370 CTGTATTATCTCTATGAAAAGGG + Intronic
906233391 1:44185317-44185339 ATCTTTTTGTTCAATGAAAAAGG + Intergenic
907395086 1:54184058-54184080 GTGTTTGAGCTCAAGGAGAATGG + Intronic
908266215 1:62381858-62381880 ATTTTTTAACTGAGTGAAAATGG + Intergenic
908800928 1:67879993-67880015 ATGCATTATCTCACTGAAAATGG + Intergenic
908808705 1:67957520-67957542 ATGTCTTGGAACAATGAAAAAGG + Intergenic
908929515 1:69301955-69301977 ATATTTTACCACAATAAAAAGGG + Intergenic
909020640 1:70427133-70427155 TTGTCTTACCTTAATGAAAATGG + Intronic
909387205 1:75071677-75071699 GTGTTTTAGCTCCATGAAGAAGG - Intergenic
910055386 1:83027497-83027519 ATTCTTTAGCTAAATCAAAATGG - Intergenic
911361289 1:96880277-96880299 ATTTTTCAGATAAATGAAAATGG + Intergenic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
911802800 1:102164921-102164943 TTATTTTACCTCAATGATAAAGG + Intergenic
911897018 1:103449024-103449046 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
911969890 1:104419169-104419191 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
911993334 1:104730883-104730905 ATTTTTTAAATCAATGAATATGG + Intergenic
913328483 1:117648264-117648286 CTGTTTGAGTTCAGTGAAAAGGG - Intergenic
916782042 1:168044149-168044171 AGGTTTTAGCTGAATGTCAAAGG + Intronic
917284802 1:173412904-173412926 AAGTTTGAGTTCAATAAAAAAGG + Intergenic
917432134 1:174981262-174981284 ATGTTTTGGCTTATTTAAAAGGG + Intronic
918214395 1:182380602-182380624 CTTTTTAAGCTCAATAAAAATGG + Intergenic
918289122 1:183089317-183089339 ATGTTTGCTCTCAATGTAAAGGG + Intronic
918434200 1:184494701-184494723 ATGTTTTAGAGCAATGACCATGG + Intronic
918810907 1:189119092-189119114 ATGTTTTAAATCCATGAATAAGG - Intergenic
919252555 1:195075950-195075972 CAGTTTTAGCTCAAGGAATATGG + Intergenic
919660884 1:200245190-200245212 AAGTTTTATTTCAAAGAAAAGGG - Intergenic
921858059 1:220010220-220010242 ATGTTTTGGCTTAAAGACAAAGG + Intronic
922126932 1:222736846-222736868 ATTTTCTAGATAAATGAAAATGG + Intergenic
923163007 1:231333896-231333918 TTCTTTTATCTGAATGAAAATGG - Exonic
1065049521 10:21777666-21777688 ATGTTTTTGCTAAACCAAAAGGG + Intronic
1067493913 10:46744738-46744760 ATGTTATTGCTTAATGACAAAGG - Intergenic
1067600746 10:47595666-47595688 ATGTTATTGCTTAATGACAAAGG + Intergenic
1068238182 10:54265676-54265698 ATGTTATTGCTTAATGACAAAGG + Intronic
1069128793 10:64672566-64672588 ATTTTTTATCTCAATGGATATGG - Intergenic
1071802331 10:89077369-89077391 TTCATTTAGCACAATGAAAAAGG + Intergenic
1071804773 10:89106355-89106377 ATATTTTAACTGAATGACAATGG - Intergenic
1072033838 10:91546351-91546373 TTCTTTTAGCTCACTGATAAAGG - Intergenic
1072094779 10:92167350-92167372 ATGATTAAGCTTAATGAAGAAGG - Intronic
1072528402 10:96295311-96295333 ATGTTTTAACTTGGTGAAAAAGG - Intergenic
1074219754 10:111424893-111424915 ATGTTCTAGCTCAACGAGTAAGG + Intergenic
1074821585 10:117183341-117183363 CTGTTCTAGCTCAAGGAAAAGGG + Intergenic
1078876187 11:15400424-15400446 ATTTTTTAAATGAATGAAAATGG - Intergenic
1079484173 11:20916813-20916835 ATGTTCTAGGTCAATGAAACAGG - Intronic
1079594604 11:22226754-22226776 ATTTATTAGTTCACTGAAAATGG - Intronic
1080341339 11:31268946-31268968 ATGTTTTAGCTCAATGAAAAGGG - Intronic
1081217951 11:40425230-40425252 ATGTTTCAGCATAATGAAAAAGG - Intronic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1083189941 11:61042597-61042619 ATTTTTTAACTCAATAATAATGG - Intergenic
1083368113 11:62155206-62155228 ATGTGTTATCACAAAGAAAACGG + Intergenic
1083508146 11:63180347-63180369 ATAAATTAGCTCAATTAAAATGG + Intronic
1085840514 11:80006455-80006477 ATGTATTAGATAAATGGAAATGG + Intergenic
1086960734 11:92978074-92978096 GTCTTTTAGCTCAATGACCAAGG + Intronic
1087005714 11:93468791-93468813 CTCTTTTAGCTCTAGGAAAATGG + Intergenic
1087489662 11:98808664-98808686 ATGTTTTAAATGAATAAAAATGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088662072 11:112057358-112057380 ATGATTAAGCTCAATGAGTAAGG + Intronic
1091427082 12:400443-400465 ATGATTAAGCTCAGTGAAAAAGG - Intronic
1091608638 12:1982206-1982228 ATATTTTAACACAATAAAAAAGG - Intronic
1092000988 12:5032236-5032258 GTGTTTTAGCTCCATGACAGAGG + Intergenic
1093408586 12:18837888-18837910 ATGTTTTAGCTCATTAATGAGGG + Intergenic
1095168774 12:39007844-39007866 ATGATTTAGCTTAGTGAGAAAGG + Intergenic
1095863394 12:46944908-46944930 ATTTTTCAGCTCCATTAAAATGG - Intergenic
1096339519 12:50785914-50785936 ATGTTTTATCACAAGGAAATGGG - Intronic
1097652297 12:62315942-62315964 ATGTTCTAGCTAAATGAAGAGGG - Intronic
1098121341 12:67243202-67243224 ATTATTTAGCCCAATGAAACAGG - Intergenic
1098641763 12:72847199-72847221 ATTTTTTTGCACAGTGAAAAGGG + Intergenic
1098814317 12:75138669-75138691 ATGTTTTACCTATAAGAAAACGG + Intronic
1099647289 12:85374695-85374717 AAGTTTTAGCTCTATGCCAAGGG - Intergenic
1099949139 12:89281126-89281148 ATGTCTTACCTTTATGAAAAAGG - Intergenic
1100673560 12:96842543-96842565 AGAATTTAGCTGAATGAAAAAGG - Intronic
1100736980 12:97546279-97546301 ATGTTTTAAATCAAGGAAATGGG + Intergenic
1100752658 12:97716263-97716285 ATGTTTGAGATCTATGCAAATGG + Intergenic
1105747239 13:23389137-23389159 ATGTTTTAGCTAAATGGTAGAGG - Intronic
1106101789 13:26699703-26699725 TCATTTTAACTCAATGAAAATGG - Intergenic
1106149255 13:27082619-27082641 ATGATTAAGCTTAATGAATAGGG - Intronic
1106304577 13:28498217-28498239 ATGTTTAAGTTCTTTGAAAATGG - Intergenic
1106802289 13:33268672-33268694 ATGCTTTAGAGCAATGAACATGG + Intronic
1108616411 13:52137911-52137933 ATGTGTTCGCAAAATGAAAAGGG - Intronic
1108770635 13:53696384-53696406 ATGATTAAGCTTAATGAAGATGG + Intergenic
1109046318 13:57416514-57416536 ATGTTTTAGCTTAAGTAAAGGGG - Intergenic
1109109999 13:58304853-58304875 ATGTTTTTGCTTAATGGCAATGG + Intergenic
1109676980 13:65689593-65689615 AACTATTAGTTCAATGAAAAAGG + Intergenic
1109852475 13:68084761-68084783 ATTTTTTCCCTCAATAAAAATGG - Intergenic
1110134655 13:72051258-72051280 GTATTTTAGCACAATAAAAATGG - Intergenic
1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG + Intergenic
1111026530 13:82535243-82535265 ATATTTTAGAAAAATGAAAATGG + Intergenic
1111275846 13:85945953-85945975 ATGGTTTAGCTCTATGATAAGGG - Intergenic
1112145631 13:96696691-96696713 ATGTTTTTGCTCAAGTATAAAGG - Intronic
1112971859 13:105271281-105271303 ATTTTTCAGCTACATGAAAACGG + Intergenic
1113652546 13:112045953-112045975 ATGTTTTATCACAAAGCAAAGGG - Intergenic
1114831307 14:26145261-26145283 ATCTGTGAACTCAATGAAAATGG - Intergenic
1115205818 14:30902706-30902728 ATATTTTAGCACGATTAAAAAGG - Intronic
1115722342 14:36176764-36176786 CTGTTTTAGATTAATGCAAATGG + Intergenic
1115778477 14:36742572-36742594 CTCTTTTGCCTCAATGAAAATGG - Intronic
1116014041 14:39385522-39385544 TTGGTTTATCACAATGAAAATGG - Intronic
1118222271 14:63865870-63865892 ATCTTCTAGCTCATTAAAAAAGG + Intronic
1118959927 14:70519778-70519800 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1120528381 14:85603964-85603986 ATGTTTTAACACAGTAAAAATGG - Intronic
1120544139 14:85789491-85789513 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1120738620 14:88083102-88083124 ATGTTTTAGCTGAAAGCCAAAGG + Intergenic
1121550719 14:94797638-94797660 ATCTTTTAGTTAAGTGAAAATGG - Intergenic
1122318622 14:100840184-100840206 ATTTTTAAGCTCAAAGAAATTGG - Intergenic
1124699138 15:31895967-31895989 TTGATTTAGCTCAATGAGATCGG - Intergenic
1124950352 15:34313150-34313172 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1125081103 15:35674193-35674215 ATATTTAAGTTCAATCAAAAAGG + Intergenic
1125350752 15:38764981-38765003 ATGTTTTAGAGTAAGGAAAATGG - Intergenic
1127197924 15:56610107-56610129 ATATTTTACCACAATAAAAAGGG + Intergenic
1128050306 15:64658176-64658198 ATTTTTAAGGTAAATGAAAAGGG - Intronic
1128604157 15:69023442-69023464 ATTTTTTAGCCCAAAGTAAATGG - Intronic
1128949798 15:71866128-71866150 TTGTGTCAACTCAATGAAAAAGG + Intronic
1129000198 15:72326922-72326944 ATGTTTTCCCTCAATTAAAGAGG + Intronic
1130914234 15:88292055-88292077 ATGCTTTAGGTCCATGAAAGGGG + Intergenic
1131600244 15:93840122-93840144 ATGTTTTGACTTAATGAAAATGG - Intergenic
1137378234 16:47973364-47973386 ATGTTATACCTTAATAAAAATGG - Intergenic
1137699863 16:50489632-50489654 ATGTTCCACCTCAAAGAAAAAGG + Intergenic
1138165477 16:54797462-54797484 ATGTCTCAGCTCAAGGAAAGAGG + Intergenic
1138921663 16:61537700-61537722 ATGATATAGACCAATGAAAAAGG + Intergenic
1138927240 16:61607446-61607468 ATATTTTAGCTCAATTAAATTGG - Intergenic
1144350289 17:14388664-14388686 ATATTTTATCACAATAAAAAAGG - Intergenic
1145124081 17:20286108-20286130 ATGTTATACCTCAATTAAAAAGG - Intronic
1145356644 17:22162917-22162939 ATTTTTTATCTCAGTGTAAATGG + Intergenic
1146235398 17:31155544-31155566 ATGTTTGAGTTCAATGGATAAGG + Intronic
1146379163 17:32315796-32315818 ATCTTTTAGCTCAAAAAAGAGGG - Intronic
1146691991 17:34883059-34883081 ATGTTATACCACAATAAAAAAGG - Intergenic
1150662623 17:67096960-67096982 ATGGTTAAGCTTAGTGAAAATGG - Intronic
1153857513 18:9165331-9165353 ATATTTTACCACAATAAAAAAGG - Intronic
1154504725 18:15024488-15024510 ATGTTGTAGCTTACTGAACAAGG + Intergenic
1154959459 18:21293623-21293645 CTGTTTTGGCTGAATAAAAAGGG - Intronic
1155853716 18:30805408-30805430 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1156675383 18:39521830-39521852 ATGTTTTATCTCAAAGAGAAAGG + Intergenic
1156956070 18:42964952-42964974 CTGTTTTTGCTCAAGCAAAATGG - Intronic
1157822753 18:50785743-50785765 ATATTTTACCACAATCAAAAAGG - Intergenic
1158025556 18:52892805-52892827 ATGCATTTGCACAATGAAAATGG - Intronic
1158243515 18:55404670-55404692 ATCTTTTAGGTCAATGGCAATGG + Intronic
1158246390 18:55437451-55437473 AATTTTTAGATCAAAGAAAATGG - Intronic
1158819367 18:61141705-61141727 ATGTTATAACTAAATGAATATGG + Intergenic
1159609385 18:70509321-70509343 ATGGTTTAGCTCTCTGAAACTGG + Intergenic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1159902802 18:74063853-74063875 ATGTCTTAAATCAATGAAACTGG - Intergenic
1162597994 19:11643918-11643940 ACATTTTAGATCAAGGAAAATGG - Intergenic
1164837629 19:31367455-31367477 ATATTTTATCTCAAGGAAAAAGG - Intergenic
1166041519 19:40205712-40205734 CTGTGTTAGCTCAAAGAAAGGGG - Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166983443 19:46645627-46645649 ATGTGTTACCTCAAGGAAAAGGG + Intergenic
925503870 2:4538754-4538776 ATGTTTTGGCTGAATAATAAAGG - Intergenic
925509952 2:4614629-4614651 ATATTTTACTTCAATAAAAATGG + Intergenic
926547393 2:14258783-14258805 AAGTTTTAGGTAAAGGAAAAGGG + Intergenic
929016459 2:37502056-37502078 ATGTCTTAGGTCAGTGGAAATGG - Intergenic
929324881 2:40597376-40597398 ATGTTGTTGTTAAATGAAAAAGG + Intronic
929678249 2:43960627-43960649 ATGCTTTATCTCCAGGAAAATGG - Exonic
929815396 2:45227172-45227194 CTGTTCTAGTTCCATGAAAAAGG - Intergenic
930431586 2:51283601-51283623 AGCTTTTAGCACATTGAAAAGGG + Intergenic
930482240 2:51963577-51963599 ATGTTTTAGCTTGATACAAAGGG + Intergenic
930507172 2:52297866-52297888 ATTATTCAGCTTAATGAAAAGGG + Intergenic
931279593 2:60777634-60777656 AAGATTAAGCTCAGTGAAAAAGG - Intronic
931563962 2:63594048-63594070 ATGTTTTGGCTCAATGTAAATGG + Intronic
932786379 2:74607862-74607884 ATGTTTTTGATCCATGAAGAGGG + Intronic
933128274 2:78638550-78638572 ATGTTTCAGTTCAATTCAAAAGG - Intergenic
935228347 2:101074072-101074094 ATGATTAAGCTTAATGAGAAAGG - Intronic
935355357 2:102193959-102193981 ACGTTATACTTCAATGAAAAGGG - Intronic
938503914 2:131854694-131854716 ATGTTGTAGCTTACTGAACAAGG + Intergenic
938678628 2:133665261-133665283 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
938837648 2:135123178-135123200 AAGTTTTAGCTGAATTAAAAAGG - Intronic
939271873 2:139949523-139949545 ATGTTTTAGTTGCAAGAAAATGG - Intergenic
939357623 2:141124511-141124533 AGGTCTTAGCACAATGAAAAAGG - Intronic
939518063 2:143193712-143193734 AAGTGTTAACTCACTGAAAATGG - Intronic
939640215 2:144631612-144631634 ATGATTAAGCTCAATGAAGAAGG + Intergenic
939653349 2:144791243-144791265 ATGTTTAAGCTTAGTGAGAAAGG - Intergenic
940297121 2:152138211-152138233 ATGTTTTACATAAATGTAAATGG - Intronic
941061160 2:160848968-160848990 ATATTTTACCACAATAAAAAAGG + Intergenic
941111406 2:161422209-161422231 ATGTGTGAGCTAAATAAAAAGGG + Intronic
941640869 2:167986963-167986985 ATGTTTGACAGCAATGAAAAGGG + Intronic
942044474 2:172091369-172091391 TAGTTTTAGCTCAACGAAAACGG + Intergenic
942118553 2:172753369-172753391 AGGTTTTAGTTCAACTAAAATGG - Intronic
942179634 2:173367529-173367551 ATGTTATAACTCAATAAAAATGG + Intronic
942438597 2:176007243-176007265 ATTTTTGAGCTCTATGTAAATGG + Intergenic
942592792 2:177563620-177563642 TTGTTTTAGCTTTATGAAAAGGG + Intergenic
943666782 2:190617371-190617393 ATGCTTTAGGACAATCAAAATGG + Intergenic
943754576 2:191544735-191544757 AGCTTTTAGCATAATGAAAATGG + Intergenic
944344860 2:198650785-198650807 ATTTTGTAGCTAAATGCAAATGG + Intergenic
944478762 2:200133335-200133357 TTGTTTTATCTCAGAGAAAAGGG + Intergenic
944652864 2:201849089-201849111 ATTTTCTAGCTAAATGAACATGG + Intronic
944955805 2:204807296-204807318 ATGTTTCACCTCAGTAAAAATGG + Intronic
946059073 2:216926308-216926330 ATGCTTTGCCTCAAGGAAAAAGG - Intergenic
946449449 2:219767270-219767292 ATGTTTTATCTCATTTAAACTGG + Intergenic
947018035 2:225643319-225643341 ATGTTTAAGCACAAGGAACATGG - Intronic
947079428 2:226379654-226379676 ATGATGTAGCTCAAGGAAAGAGG - Intergenic
947195126 2:227556504-227556526 ATATTTTCCCTCAATGAAAAGGG - Intronic
947512465 2:230769501-230769523 ATATTTTGGGTCAAAGAAAAAGG + Intronic
948552830 2:238785950-238785972 ATATTTTACCACAGTGAAAAAGG + Intergenic
948552844 2:238786090-238786112 ATGTTTCACCACAATAAAAAAGG - Intergenic
1168803112 20:656335-656357 GTGAATTAGCTTAATGAAAATGG + Intronic
1169596333 20:7203881-7203903 ATGTTTTATGGCAAGGAAAATGG - Intergenic
1170171023 20:13412709-13412731 ATGTTTTATCTTCATGAAGATGG - Intronic
1170209366 20:13833154-13833176 ATGTTTCATCACAGTGAAAATGG - Intergenic
1170289425 20:14751751-14751773 TTGTTTTAGCCAAAAGAAAAAGG - Intronic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1170502083 20:16984625-16984647 ATGATTTAGCTCAGTAAAGAAGG + Intergenic
1172312705 20:33930610-33930632 ATGTTTTACCTCAAAAGAAAAGG - Intergenic
1172743778 20:37190708-37190730 AGACTTTAGCTCAATCAAAATGG + Intronic
1177196970 21:17913634-17913656 ATATTCTAGCTCTAAGAAAAAGG - Intronic
1177992517 21:28055470-28055492 ATGTTGTAGCTTACTGAACAAGG - Intergenic
1182603400 22:31485229-31485251 ATTTTTTAGCTTAATGACAGTGG - Intronic
1183430663 22:37763583-37763605 ATGTTTAAGGTCATTAAAAAGGG - Intronic
949539467 3:5020779-5020801 ATGTTCTAGCTCACTGGGAAGGG - Intergenic
949623218 3:5839349-5839371 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
950166553 3:10805037-10805059 ATATTTTACCACAATAAAAAAGG + Intergenic
950240169 3:11362393-11362415 AGGTGTTAGCTCAGTTAAAATGG + Intronic
951169126 3:19518420-19518442 TTGCTTTAGCTCATTAAAAATGG - Intronic
951277550 3:20707151-20707173 AGGATTTTGCTAAATGAAAAAGG - Intergenic
951373324 3:21880693-21880715 ATGATTAAGCTTAATGAAGAAGG + Intronic
951415660 3:22418643-22418665 ATGTTTTGGGGCAATGAAAAAGG + Intergenic
951739921 3:25910240-25910262 GTGTTGCAACTCAATGAAAACGG - Intergenic
951783736 3:26394265-26394287 ATGATTTATTTCAATGAAAATGG + Intergenic
951895319 3:27604484-27604506 AAGTTTTATCTCAGTGAGAATGG - Intergenic
955073047 3:55588007-55588029 ATGTGTCTGGTCAATGAAAAAGG - Intronic
956412939 3:68997210-68997232 GTGTTTCAGCTCACTGTAAAGGG - Intronic
956474076 3:69600735-69600757 ATTTTTTTCCTCAATAAAAAAGG + Intergenic
956990886 3:74763452-74763474 ATGTTATAGCTCAATACAAAAGG + Intergenic
957292837 3:78299092-78299114 AAATTTCAGCTGAATGAAAAGGG - Intergenic
957715650 3:83927216-83927238 ATGTGGTAGCACAGTGAAAAAGG + Intergenic
958060237 3:88470371-88470393 ATATTTTAACTGAATTAAAATGG - Intergenic
958436426 3:94102072-94102094 ATTTGTGAGCTCATTGAAAAAGG + Intronic
958959702 3:100497382-100497404 ATATTTTACCACAATAAAAAAGG - Intronic
959707977 3:109357007-109357029 ACATTTGAGCTGAATGAAAAGGG - Intergenic
959886159 3:111503046-111503068 ATATTTTAACTGAATGACAATGG + Intronic
960458274 3:117900564-117900586 ATGTTTTATCTCTCTGAGAAGGG - Intergenic
960621775 3:119643984-119644006 ATGTTTTATCTGCAAGAAAAGGG - Intronic
962145616 3:132836642-132836664 TGGTTTTAGCTCAGTGAAAAGGG - Intergenic
963370288 3:144391118-144391140 ATATTTAAGCTCAAAGAAAATGG - Intergenic
963462190 3:145629857-145629879 ATTTCTAAGCTCAATAAAAAAGG - Intergenic
963507379 3:146203968-146203990 ATGATTTAGCTTAATGAGGAAGG - Intronic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965527724 3:169739366-169739388 TTGTTTAAACTCAATGAAAGAGG + Intergenic
966631217 3:182077073-182077095 ATTTTTTAGCTCTTTGAGAAAGG - Intergenic
970479211 4:16456676-16456698 ATGATTTAGCTCAGTGAGGAAGG - Intergenic
970876160 4:20872601-20872623 ACTTTTTAGGCCAATGAAAATGG + Intronic
971795833 4:31227106-31227128 ATGCTTTAGCAAAATGTAAATGG - Intergenic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974200370 4:58630761-58630783 ATTTTTAACCTCAGTGAAAAGGG + Intergenic
974272221 4:59665115-59665137 AGGTTTTAGTTAAAAGAAAATGG - Intergenic
974496886 4:62641173-62641195 ATATTTTACAACAATGAAAAAGG + Intergenic
974522862 4:63007945-63007967 AGATTTTAGCTCAATAAAATGGG + Intergenic
975106611 4:70574457-70574479 ATGGTTTGGTTCACTGAAAATGG - Intergenic
975618200 4:76268721-76268743 ATGGATTTGCTCCATGAAAATGG + Exonic
976714322 4:88107207-88107229 ATTTTTTAGCCCAAAGTAAATGG + Exonic
976810177 4:89092035-89092057 ATCTTTCAGCTCAAAAAAAAAGG + Intronic
977639541 4:99341050-99341072 ATGTAATAAATCAATGAAAAAGG - Intronic
977646033 4:99413603-99413625 AGGTTTTAGTTCAATAATAAAGG + Intronic
977844763 4:101755601-101755623 ATGTTTTATTTCAAATAAAATGG - Intronic
978076022 4:104530617-104530639 TTGATGTATCTCAATGAAAATGG + Intergenic
978296428 4:107210542-107210564 ATGTTTTGGCTCAAAATAAAAGG - Intronic
978320328 4:107486361-107486383 ATTTTTGAGGTGAATGAAAATGG + Intergenic
978713527 4:111814332-111814354 ACATTTTAACTCAATGAATAAGG - Intergenic
979594372 4:122517848-122517870 ATATTTTAAATCAATGAAAAAGG - Intergenic
979875604 4:125887168-125887190 TTTTTTTACCTCAGTGAAAATGG + Intergenic
979956765 4:126962737-126962759 ATGTTTGAGATGAATGAGAATGG - Intergenic
980174347 4:129326426-129326448 ACGTTTTATTCCAATGAAAAGGG + Intergenic
980697306 4:136376386-136376408 ATCTTTTAGCTTAAGGAAAAAGG + Intergenic
980992857 4:139753142-139753164 ATATTTTACCCCAATGAAAAGGG - Intronic
981048236 4:140285708-140285730 ATGTCTTGGTTCATTGAAAAGGG - Intronic
981352554 4:143749776-143749798 ATATTTTAGTTCAGTAAAAATGG + Intergenic
983313135 4:166092024-166092046 CTGTCTTAACTGAATGAAAAGGG - Intronic
984129461 4:175856054-175856076 ATCTTTTAGTTCAAGAAAAAAGG + Intronic
984563872 4:181304113-181304135 ATGCTTCACCTCAATGAGAATGG + Intergenic
987095916 5:14549758-14549780 ATGATTGAGCTTAGTGAAAAAGG - Intergenic
987686668 5:21213504-21213526 ATTTTTTCTCTGAATGAAAAAGG - Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
987875072 5:23671380-23671402 ATGGTTTAGTTCAAAGAACATGG + Intergenic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990823661 5:59872868-59872890 ATGGGTACGCTCAATGAAAATGG + Intronic
990885949 5:60593629-60593651 ATGATTGAGCTTAATGAGAAAGG + Intergenic
990930441 5:61084293-61084315 ATACTTTACCACAATGAAAAGGG - Intronic
991234522 5:64378416-64378438 ATGTTTTAGCTCAAGGAGTTAGG - Intergenic
991429399 5:66528505-66528527 ATGTTTGAGCTAAATTCAAAAGG - Intergenic
992469138 5:77038434-77038456 AAATATTAGCACAATGAAAATGG - Intronic
993252162 5:85542322-85542344 ATACTTTACCGCAATGAAAATGG - Intergenic
993559133 5:89381899-89381921 ATGTTTCAACTTAATTAAAAGGG - Intergenic
993568164 5:89501395-89501417 ATGTTTTAAATCAATGTAAATGG + Intergenic
994112927 5:96027426-96027448 ACCTTTTAGATCATTGAAAATGG + Intergenic
994625939 5:102219099-102219121 ATGTTTGAGCTTAGTGAAGAAGG - Intergenic
994856797 5:105131905-105131927 ATGTTTTATCACAATTAAAAAGG - Intergenic
995334665 5:110985365-110985387 ATGTTTTATGTCATTGTAAATGG - Intergenic
995616290 5:113967898-113967920 AAGTTGTAGCTCAAATAAAAAGG - Intergenic
997936405 5:138115141-138115163 ATTTTTTGGTACAATGAAAATGG - Intergenic
998608600 5:143663402-143663424 ATGGATTAGCTTAAAGAAAATGG - Intergenic
999902511 5:156100200-156100222 ATGTGTTAGCTCCATGAATTTGG + Intronic
1001656380 5:173354029-173354051 ATATTTTACCACAATTAAAAGGG - Intergenic
1002973477 6:2049533-2049555 ATGTTATACCTCAAAGCAAAAGG + Intronic
1003260807 6:4513767-4513789 ATGTTCTAGATCAAAGGAAATGG + Intergenic
1003475738 6:6480788-6480810 ATATTTTAACTAATTGAAAATGG - Intergenic
1003478125 6:6504107-6504129 ATGTTTTAGCTGGAGGAATAAGG + Intergenic
1003750620 6:9051113-9051135 ATGTTTTTACTTAATGATAAAGG + Intergenic
1004016888 6:11739789-11739811 ATGTGTTACCTCAATGATTAAGG - Intronic
1004561060 6:16751276-16751298 AAGTGTCAGCTGAATGAAAAAGG - Intronic
1005914203 6:30338295-30338317 ATGTTTAAGCTTAGTGAGAAAGG - Intronic
1006097813 6:31666628-31666650 ATGTTTAACTTCAAAGAAAAGGG + Intronic
1006807608 6:36798766-36798788 ATGTTATACCTCATTAAAAATGG + Intronic
1009335346 6:62482227-62482249 ATGTTTAAAATCACTGAAAATGG + Intergenic
1009579079 6:65508711-65508733 ACTTTCTATCTCAATGAAAATGG - Intronic
1010195238 6:73233026-73233048 ATATTTTAGAGCAATAAAAAAGG + Intronic
1010196978 6:73249517-73249539 ATATTTTAGAGCAATAAAAAAGG + Intronic
1010693120 6:78933967-78933989 ATGATTAAGCTTAGTGAAAAAGG - Intronic
1010851744 6:80785163-80785185 TTGTTTTATCTCAATAGAAAAGG - Intergenic
1010863385 6:80941412-80941434 ATGTTTTTGTTCCATGAAATAGG - Intergenic
1011285808 6:85721397-85721419 ATCTTCCAGCTCCATGAAAAGGG + Intergenic
1011786522 6:90852166-90852188 ATGTTTTATTTGAATGTAAAAGG + Intergenic
1012258952 6:97065341-97065363 ATGTTTTAGATCTATAAAAATGG - Intronic
1013778014 6:113700607-113700629 ATGTGTTAGCTCTATGGAACAGG - Intergenic
1014129584 6:117815623-117815645 AAATTTTATCTCAATAAAAATGG - Intergenic
1014465169 6:121748140-121748162 AAGTTTTAGTTGAGTGAAAAGGG + Intergenic
1014489767 6:122047241-122047263 ATGTTTATGTGCAATGAAAAAGG - Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014976901 6:127898233-127898255 ATGTTTTACTTCAATTAAGAGGG - Intronic
1015198902 6:130555972-130555994 ATATTTTAACTCCATGAATATGG + Intergenic
1015333465 6:132007914-132007936 ATTTTTTAGCTGAATGTGAAGGG - Intergenic
1016241481 6:141936475-141936497 ATGTATAAGGTAAATGAAAACGG - Intergenic
1016489090 6:144576774-144576796 ATGTTGTAGGTCAATACAAAAGG - Intronic
1017304724 6:152903823-152903845 AGGTTTCAACTTAATGAAAAAGG - Intergenic
1018426173 6:163684295-163684317 ATTGTTTATCTTAATGAAAATGG + Intergenic
1019861652 7:3664422-3664444 ATTTATAAGCACAATGAAAAAGG - Intronic
1020859778 7:13477072-13477094 ATGATTAAGCTTAATGAGAAAGG - Intergenic
1021191524 7:17625751-17625773 ATGTTTTGAATCAATGAATAAGG + Intergenic
1021335534 7:19397474-19397496 ATGTTTTAGCTCAAGTCTAAAGG + Intergenic
1021594361 7:22299159-22299181 ATGTCTTAGATCAATGATCAGGG - Intronic
1022573393 7:31474887-31474909 ATGTTTTATCCCAACGAAAAAGG - Intergenic
1023233136 7:38054561-38054583 ATGTTATACCTCAATGGAGATGG + Intergenic
1024795575 7:53015564-53015586 ATGTTGCAGCTCAAAGCAAAAGG + Intergenic
1024801450 7:53085135-53085157 ATGGTTTAGTTGAATGAAAATGG + Intergenic
1026578140 7:71591600-71591622 ATCTTTTGGCTCATTGGAAATGG + Intronic
1026995921 7:74616539-74616561 ATTTTCTAGCTTAATGAAAATGG - Intergenic
1027479209 7:78673536-78673558 ATGTTTCAGCTTAATGACAAAGG + Intronic
1027573458 7:79901769-79901791 ATGTTTAAGCTTAGTGAGAAAGG + Intergenic
1028082509 7:86596189-86596211 ATGTGTTAGCTAAATGAAAATGG + Intergenic
1028296643 7:89140913-89140935 ATGATTAAGCTCATTGAAGAAGG - Intronic
1029674181 7:102055758-102055780 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1030263920 7:107596719-107596741 ATTCTTTAGCTCTAAGAAAATGG + Intronic
1030335319 7:108319149-108319171 ATATTTTACCACAATAAAAAAGG + Intronic
1031076359 7:117216773-117216795 TTTTTTGAGCTCAATGCAAATGG + Intronic
1031378664 7:121058948-121058970 ATTTTAGAGCTTAATGAAAATGG + Intronic
1031470836 7:122167360-122167382 ATGTTGGAGATTAATGAAAAAGG - Intergenic
1031998270 7:128247086-128247108 ATCTTTTAACTCTAAGAAAATGG + Intronic
1032448981 7:132010355-132010377 GTGTTTAAGCTCACTGTAAAAGG - Intergenic
1032504961 7:132427834-132427856 ATGTTTTTGCAAAAGGAAAATGG + Intronic
1032707044 7:134430137-134430159 AGGTTGTAGCTAAAAGAAAAAGG + Intergenic
1033930652 7:146516394-146516416 CTGTTTTTGTTAAATGAAAAAGG + Intronic
1034527706 7:151676148-151676170 ATGTTTTACCTCAATAAATAAGG - Intronic
1034756318 7:153624074-153624096 ATATTTTAGCTCAATGCAGTTGG - Intergenic
1036153479 8:6320308-6320330 GTGTTTTAGGGCACTGAAAAAGG + Intergenic
1036225623 8:6955196-6955218 GTGTTTAAGCTCAATGCCAATGG + Intergenic
1036274800 8:7341223-7341245 ATATTTTTCCTCAATAAAAAAGG - Intergenic
1036346554 8:7969123-7969145 ATATTTTTCCTCAATAAAAAAGG + Intergenic
1036841882 8:12129876-12129898 ATTTTTTTCCTCAATAAAAAAGG + Intergenic
1038235009 8:25744830-25744852 ATGTTTATGATCAAGGAAAAAGG + Intergenic
1038619569 8:29127443-29127465 GTTTTTTAGCTCACTTAAAAGGG - Intronic
1040443697 8:47471705-47471727 ATGTTTTATGACAATAAAAATGG + Intronic
1040601867 8:48892483-48892505 ATATTTTAGCTCAATATAAATGG + Intergenic
1040751042 8:50708498-50708520 CTCTTTTAGTTTAATGAAAATGG + Intronic
1042508465 8:69586566-69586588 ATAGTTTAACTCACTGAAAATGG - Intronic
1042626210 8:70760471-70760493 ATATTTTACCCCAATAAAAAAGG - Intronic
1042894994 8:73656893-73656915 TTGTACTAGCTTAATGAAAACGG + Intronic
1043281787 8:78477141-78477163 ATGTTTAAGATCATGGAAAATGG - Intergenic
1043303638 8:78766539-78766561 ATTTTTTAACAAAATGAAAAAGG - Intronic
1043379651 8:79688941-79688963 ATGGATGAGCTCAAGGAAAAAGG - Intergenic
1043493136 8:80769868-80769890 ATGTCTTAGCAGCATGAAAATGG - Intronic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1044172055 8:89066144-89066166 ATTTTGTATCTCAGTGAAAAGGG - Intergenic
1045635029 8:104175140-104175162 ATCTTTTGGCTTAACGAAAATGG - Intronic
1045865947 8:106865745-106865767 ATGTTTTAGAATAGTGAAAACGG + Intergenic
1046130328 8:109959730-109959752 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1047243173 8:123112773-123112795 ATGTTTTCTCTAATTGAAAAGGG - Intronic
1047823863 8:128551757-128551779 ATGTTTCCTCTCAATGAACAAGG - Intergenic
1047992315 8:130298665-130298687 ATGTTATAGCTAAAGGATAATGG - Intronic
1048298206 8:133231510-133231532 ATGTGTTTGCTCAATGTGAAGGG + Intergenic
1050308109 9:4326705-4326727 ATATTTTATCACAATAAAAATGG + Intronic
1050910395 9:11061660-11061682 GTGTGTTTGCTCAATGATAAAGG - Intergenic
1051403437 9:16708225-16708247 TTCTTTTGGCTCAAGGAAAATGG - Intronic
1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG + Intergenic
1055418629 9:76111609-76111631 GTGTTTCAGCTAAATGAATAGGG + Intronic
1055639306 9:78307008-78307030 ATATTTTATCCCAATTAAAAAGG - Intronic
1058009797 9:99964489-99964511 ATGGTTTAGCTCATTGTTAAAGG + Intronic
1058463488 9:105205836-105205858 ATGTTTTAGATCTAAGAAAGGGG - Intergenic
1058942002 9:109822108-109822130 ATGAGCTAGCTCAAGGAAAAAGG + Intronic
1059764237 9:117368565-117368587 GTGTGTTAACTCAATGATAATGG - Intronic
1059917498 9:119119642-119119664 TTGTTTTGTCTCAATGAATAAGG - Intergenic
1186422058 X:9434234-9434256 ATGTTTCAGCTCAATTCCAAAGG + Intergenic
1186559178 X:10592118-10592140 ATAATTTGGCTGAATGAAAATGG + Intronic
1187001241 X:15181320-15181342 ATTTTTTAACTGAATGAAACTGG - Intergenic
1187167684 X:16820011-16820033 ATTTACCAGCTCAATGAAAAAGG - Intronic
1187234721 X:17456565-17456587 ATGTTTTAGCCTAATTAAAATGG - Intronic
1187317537 X:18210535-18210557 ATGGTTAAGCTTGATGAAAATGG - Intronic
1187488497 X:19727139-19727161 ATGCTTTACCACAATAAAAAAGG - Intronic
1187858793 X:23662540-23662562 ATATTTTACCACAATAAAAAAGG + Intergenic
1188178338 X:27022385-27022407 CTGTCTTAGCTCTAAGAAAATGG + Intergenic
1188447390 X:30270081-30270103 ATGTATTAAATAAATGAAAATGG - Intergenic
1191816603 X:65252691-65252713 CTGTATTAGATCAATGTAAATGG - Intergenic
1192639762 X:72850575-72850597 ATGTTTTAAATCTATGAACAGGG - Intergenic
1192641949 X:72870230-72870252 ATGTTTTAAATCTATGAACAGGG + Intergenic
1192789621 X:74368551-74368573 ATGTTTTAGCTCAATGTGTTAGG - Intergenic
1192872967 X:75202538-75202560 ATGTTTTATGTCAGAGAAAATGG + Intergenic
1193807631 X:86013431-86013453 ATGTTTTAAAACAATGAAATAGG + Intronic
1193807755 X:86014683-86014705 ATGTTTTAAAACAATGAAATAGG + Intronic
1193934280 X:87596667-87596689 ATGTTTTAGCTCAGTTAGAAAGG - Intronic
1194062714 X:89224152-89224174 AAATTTTAGCACAATGTAAATGG - Intergenic
1194209771 X:91057887-91057909 ATACTTTAGCTCAATGAAAATGG + Intergenic
1194321414 X:92451338-92451360 ATGTTTTACCAAAATTAAAAAGG + Intronic
1194820034 X:98494161-98494183 ATGTTTTGCTTCAATTAAAATGG + Intergenic
1195048071 X:101072331-101072353 AGGTTTAAGCAAAATGAAAAGGG + Intergenic
1195344100 X:103931574-103931596 GTGTTTTATCTCTATGACAATGG + Intronic
1195653192 X:107308833-107308855 ATGTTTCAGCTCAAGTACAAAGG + Intergenic
1196270249 X:113701566-113701588 AAGTTTTACCCCAATAAAAATGG - Intergenic
1199100602 X:143795233-143795255 ATGTTTTAGCTCATTGGACATGG + Intergenic
1200557981 Y:4662331-4662353 GTATTTTAGTTCAATGATAATGG - Intergenic
1200629584 Y:5564809-5564831 ATGTTTTACCAAAATTAAAAAGG + Intronic
1200716584 Y:6553131-6553153 AAATTTTAGCACAATGTAAATGG - Intergenic
1201645604 Y:16227508-16227530 ATGACTTAGATCAAGGAAAAGGG - Intergenic
1201657209 Y:16357806-16357828 ATGACTTAGATCAAGGAAAAGGG + Intergenic