ID: 1080344358

View in Genome Browser
Species Human (GRCh38)
Location 11:31307817-31307839
Sequence CTGAATGCACGAGTCTGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080344354_1080344358 -6 Left 1080344354 11:31307800-31307822 CCCTTCTGATACTGCTGCTGAAT 0: 1
1: 0
2: 1
3: 24
4: 238
Right 1080344358 11:31307817-31307839 CTGAATGCACGAGTCTGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 88
1080344353_1080344358 -1 Left 1080344353 11:31307795-31307817 CCTGACCCTTCTGATACTGCTGC 0: 1
1: 0
2: 1
3: 7
4: 202
Right 1080344358 11:31307817-31307839 CTGAATGCACGAGTCTGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 88
1080344355_1080344358 -7 Left 1080344355 11:31307801-31307823 CCTTCTGATACTGCTGCTGAATG 0: 1
1: 0
2: 1
3: 6
4: 179
Right 1080344358 11:31307817-31307839 CTGAATGCACGAGTCTGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080344358 Original CRISPR CTGAATGCACGAGTCTGTTG GGG Exonic
901202920 1:7476722-7476744 CTGCATGCACTGGTCTGGTGAGG - Intronic
901830407 1:11888736-11888758 CTGAGAACACGAATCTGTTGGGG - Intergenic
901929287 1:12586448-12586470 CTGGATGGACGGGGCTGTTGTGG - Intronic
903430098 1:23290370-23290392 CTGAATGCTCAAGTTTGCTGTGG + Intergenic
906800171 1:48730190-48730212 CTGAGTGTCCCAGTCTGTTGGGG - Intronic
910225848 1:84935261-84935283 CTGAATGTACAAGTCAGTTGGGG - Intronic
914987551 1:152473307-152473329 CTGTATTCATGAGTCTGATGTGG + Intergenic
921292422 1:213670896-213670918 CTGAAGCCACAAGACTGTTGAGG - Intergenic
1075620133 10:123921085-123921107 CTGAATGCACCAGGTTGTTAGGG + Intronic
1076482808 10:130795987-130796009 CTGAAAGCACCAGTCTGCAGGGG + Intergenic
1080344358 11:31307817-31307839 CTGAATGCACGAGTCTGTTGGGG + Exonic
1080466017 11:32497944-32497966 CTTAAGGCACAAGTCTGTTAAGG + Intergenic
1081381827 11:42425833-42425855 ATGAATGCATGAGTTTCTTGTGG - Intergenic
1087176116 11:95097390-95097412 CTGGAGGCATGAGTGTGTTGAGG + Intronic
1090309683 11:125724171-125724193 CTGAATGCTCAGGTCAGTTGGGG + Intergenic
1091748563 12:3008677-3008699 ATGAATGAATGAGTCTGGTGTGG - Intronic
1091820266 12:3470751-3470773 CTGAATTCACCAGGCTGGTGTGG - Intronic
1094307591 12:29037955-29037977 CTGAATGTAAGAGTGTGTTTGGG - Intergenic
1094379554 12:29828579-29828601 CTGAATAAATGGGTCTGTTGAGG + Intergenic
1101265779 12:103085480-103085502 CAGAATGCACAATTCTTTTGAGG + Intergenic
1101528445 12:105553036-105553058 CTGGAGGCAAGAGTGTGTTGGGG + Intergenic
1102855203 12:116287460-116287482 CTGACTGCAAGAGTCTATCGTGG + Intergenic
1107295226 13:38900626-38900648 CTGACTGCATTAGGCTGTTGAGG - Intergenic
1110938739 13:81322758-81322780 GTGAATGCACCACTCTGTTATGG + Intergenic
1111076960 13:83249217-83249239 CAGAAGGAAAGAGTCTGTTGTGG + Intergenic
1117162244 14:53001194-53001216 CTGAATGCACATGTCTGCAGTGG - Intergenic
1122868732 14:104623838-104623860 CTGAATGCATGAATCTGTCTTGG + Intergenic
1130326951 15:82888991-82889013 CTCAAAGCAGGAGGCTGTTGTGG - Intronic
1137443833 16:48519855-48519877 ATGAATGTACCAATCTGTTGGGG + Intergenic
1142580080 17:936530-936552 CTGAAAGCAGGATTCTGCTGCGG + Intronic
1144031335 17:11325926-11325948 CTGAATCAACAAGTCTTTTGGGG - Intronic
1144801390 17:17930529-17930551 CTGATTGCAAGAGGCTGCTGGGG - Intronic
1145797202 17:27662619-27662641 CTGCATGCAAGAGCCTGTTAGGG - Intergenic
1145811601 17:27767560-27767582 CTGCATGCAAGAGCCTGTTAGGG - Intronic
1146841950 17:36162400-36162422 CTGCATGCAAGAGTCTGTTAGGG - Intergenic
1146854261 17:36250360-36250382 CTGCATGCAAGAGTCTGTTAGGG - Intronic
1146870164 17:36374252-36374274 CTGCATGCAAGAGTCTGTTAGGG - Intronic
1146877521 17:36425333-36425355 CTGCATGCAAGAGTCTGTTAGGG - Intronic
1147073045 17:37974876-37974898 CTGCATGCAAGAGTCTGTTAGGG - Intergenic
1147084567 17:38054414-38054436 CTGCATGCAAGAGTCTGTTAGGG - Intronic
1147100514 17:38178380-38178402 CTGCATGCAAGAGTCTGTTAGGG - Intergenic
1147912453 17:43864191-43864213 CTGATTGCAAGGGTCTGGTGGGG - Intergenic
1150083362 17:62260894-62260916 CTGCATGCAAGAGGCTGTTAGGG + Intergenic
1150083454 17:62261426-62261448 CTGCATGCAAGAGTCTGTTAGGG - Intergenic
1150825231 17:68468579-68468601 CTGAATGCACCAGTTTATTTTGG + Intergenic
1150975719 17:70084288-70084310 CTGAATGGACGTGTCAGATGTGG - Intronic
1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG + Intergenic
1155395133 18:25378816-25378838 CTGAATCCACAGGTCTGGTGGGG - Intergenic
1161676262 19:5651737-5651759 CTGAATGCAGGAGGCTGTTTGGG - Intronic
1162920248 19:13897387-13897409 CTGAATGCATGATTAGGTTGGGG - Intronic
1165408957 19:35646797-35646819 CTGAATGCAAGAATTTCTTGTGG - Intergenic
1167587125 19:50381544-50381566 CTGAATGAACAAGTCAGTTTTGG + Intronic
928977151 2:37100185-37100207 CTGAGTGCAAAAGCCTGTTGAGG + Exonic
932161351 2:69463124-69463146 CTGAATGCCCAATTCTATTGCGG - Intronic
935930364 2:108117714-108117736 ATGGATGCACATGTCTGTTGTGG + Intergenic
936394459 2:112111151-112111173 CTGAAGGCATGTGTCTTTTGTGG + Intronic
936497316 2:113033731-113033753 CTGAATGCAAGACTGTGTTCCGG - Intronic
937080102 2:119134706-119134728 CTGTGTGCACGAGCCCGTTGTGG + Intergenic
937880756 2:126862861-126862883 CTGAAAGCAGGAGTCTGGGGTGG - Intergenic
944650899 2:201829291-201829313 CTGAATGCTGGTGTCTGTTAAGG + Intronic
944902443 2:204229387-204229409 CTGAATTCACTTGTCAGTTGTGG - Intergenic
948230557 2:236346060-236346082 CTGAATGTCCGTGTGTGTTGGGG - Intronic
1179298896 21:40089301-40089323 CTGAATCCACAAGGCTGTGGTGG - Intronic
1179718712 21:43303406-43303428 CTGCATGCTGGAGTCTGATGTGG + Intergenic
949200504 3:1372828-1372850 CTGTCTGCAGGAATCTGTTGGGG + Exonic
949229024 3:1728874-1728896 ATAAATGAACGGGTCTGTTGGGG + Intergenic
951757935 3:26112693-26112715 CTGAATGCTGGAGTCTACTGGGG + Intergenic
952731902 3:36646368-36646390 CTGAATGCATGAGTGTGAGGAGG - Intergenic
955147314 3:56332682-56332704 CTGAATGAGCGAATCTGTTTAGG + Intronic
959338688 3:105099460-105099482 ATGTATGCACTAGTCTGTTAGGG - Intergenic
961679451 3:128589341-128589363 CTAAATGCACCACTCTGGTGGGG - Intergenic
962107389 3:132405698-132405720 CTGACTGCACTAGTCAGTTAGGG - Intergenic
966589161 3:181661026-181661048 CTGAATGGATTAGTCTGTTGTGG + Intergenic
966832209 3:184019189-184019211 ATGGATGCACCAGTCTGTTTGGG - Intergenic
978182306 4:105814012-105814034 ATTAATGAACTAGTCTGTTGAGG + Intronic
986485676 5:8234009-8234031 CTGAAAGGAAGAGTCTATTGTGG - Intergenic
986793939 5:11191198-11191220 TTCAATTCAGGAGTCTGTTGAGG + Intronic
990919185 5:60944585-60944607 ATGAATGAACGAGTCCGTGGAGG + Intronic
991559673 5:67936400-67936422 CTGACTGCAGGAGACTGCTGTGG + Intergenic
995030985 5:107481251-107481273 CTGAATACAGGAGTGAGTTGGGG + Intronic
995655592 5:114422590-114422612 CTGAATGTACAAGTCTGTTATGG + Intronic
996434272 5:123416981-123417003 CTTAATGCATGAGCCAGTTGAGG - Intronic
1008403792 6:51096282-51096304 CTGAATACATGAATCTGTTAGGG + Intergenic
1009872354 6:69467666-69467688 CTGGATGCCTGAGTCTGGTGGGG + Intergenic
1010269014 6:73900551-73900573 AGGAATGCAGGAGTTTGTTGAGG - Intergenic
1017005990 6:150028399-150028421 CTGAATGAATGAGACAGTTGTGG + Intergenic
1019905065 7:4056601-4056623 CGGATTGCAGGAGTCTGTGGTGG - Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1032184016 7:129707724-129707746 CTGTAGGCAGGAGACTGTTGGGG + Intronic
1032317455 7:130852653-130852675 ATGAATGCAAGAGGCTGTTGTGG + Intergenic
1034337756 7:150334370-150334392 CTGAATGAACGAGTCTGTGAAGG - Intronic
1034877870 7:154741381-154741403 CTGAATGCACGGATGTGCTGGGG - Intronic
1043383004 8:79723018-79723040 CTGAATGCACCATTCTGCTTGGG - Intergenic
1043781689 8:84344418-84344440 GTGAATAAATGAGTCTGTTGGGG + Intronic
1044374342 8:91451696-91451718 CTGAATCCAAGGGTATGTTGGGG - Intergenic
1049668104 8:143857385-143857407 TTGACTGAGCGAGTCTGTTGTGG - Exonic
1050059421 9:1690023-1690045 CTAAATGCAAGAGTCTGGTCTGG - Intergenic
1050894340 9:10868122-10868144 CTAAATACAAGAGTATGTTGGGG - Intergenic
1052268327 9:26600283-26600305 CTGAATGGCCAAGTCTGTGGAGG + Intergenic
1056739002 9:89236496-89236518 CTGATTGCAGGAGTCTTTGGAGG - Intergenic
1187002971 X:15201039-15201061 CTGCATGCACAAGCCCGTTGAGG + Intergenic
1191093854 X:56654463-56654485 CTGAATGCACCAGTATGAAGTGG + Intergenic
1200035049 X:153321396-153321418 CTGGCTGCAGGAGTCTGGTGGGG - Intergenic