ID: 1080346283

View in Genome Browser
Species Human (GRCh38)
Location 11:31329357-31329379
Sequence CTTTCTTTGCTTAAGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080346280_1080346283 14 Left 1080346280 11:31329320-31329342 CCTCTTTAGTTTCCTACGTACAT 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG 0: 1
1: 0
2: 4
3: 32
4: 245
1080346279_1080346283 17 Left 1080346279 11:31329317-31329339 CCACCTCTTTAGTTTCCTACGTA 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG 0: 1
1: 0
2: 4
3: 32
4: 245
1080346281_1080346283 2 Left 1080346281 11:31329332-31329354 CCTACGTACATAAGCCAACAATT 0: 1
1: 0
2: 1
3: 4
4: 82
Right 1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG 0: 1
1: 0
2: 4
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080346283 Original CRISPR CTTTCTTTGCTTAAGCTAGT TGG Intronic
901474120 1:9477372-9477394 CCTTCTGTACTTAAGTTAGTTGG + Intergenic
902260949 1:15224419-15224441 CTATCTTTCCTTAAGCAAGTTGG + Intergenic
904097994 1:27996784-27996806 CTTTCTTAGCTAAGGCTAGTGGG + Intronic
905808718 1:40896414-40896436 CATTTTTTGCTTAAACTAGCTGG - Intergenic
907692464 1:56683095-56683117 TTTTTTTTGCTTAAGCAACTGGG + Intronic
908540915 1:65121228-65121250 CTTTCTTTGCTTGAAGTAGTAGG - Intergenic
908614945 1:65909846-65909868 CTTTTTGTCCTTACGCTAGTAGG + Intronic
909119718 1:71586467-71586489 GTTTCATTGCTTAAGAAAGTTGG + Intronic
909923698 1:81413207-81413229 CTTTCATTGCTAAATCTAGCAGG - Intronic
911472198 1:98332672-98332694 ATTTTTTTGTTTAAGCTACTGGG + Intergenic
912122282 1:106486434-106486456 CTCTCTTTGCTGCAGCTATTAGG + Intergenic
912872007 1:113316170-113316192 CTTTCGTTGCCTATGCTTGTGGG - Intergenic
914312991 1:146484287-146484309 CTTTCTTTGGATAAGCGACTTGG + Intergenic
914501359 1:148249089-148249111 CTTTCTTTGGATAAGCGACTTGG - Intergenic
918034633 1:180855774-180855796 CTCAATTTTCTTAAGCTAGTAGG - Intronic
918249537 1:182689566-182689588 CTTTCTTTCCTTCTGTTAGTGGG - Intergenic
918606499 1:186433198-186433220 CTTTATTTTCTTAACTTAGTTGG + Intergenic
919601497 1:199628697-199628719 CCTTTATCGCTTAAGCTAGTTGG - Intergenic
921295702 1:213700078-213700100 CTTTGGTTGCTTGAGCTTGTAGG + Intergenic
921421214 1:214951038-214951060 CCTTCTTTGCTTAAAGTATTTGG - Intergenic
921771096 1:219040821-219040843 CTTTCTTTGCTTAGGATAAATGG + Intergenic
921997113 1:221432327-221432349 CTCTTTTTGTTTAAGCTATTTGG + Intergenic
922931226 1:229391101-229391123 CCCTCTTTGCTTAAGCCAGCTGG + Intergenic
923236238 1:232035975-232035997 TTTTCTTTTCTTAAGCTGTTGGG - Intronic
1064189131 10:13189958-13189980 CTTTCTTTTTTTAAGCTTATAGG - Intronic
1065560198 10:26956362-26956384 CTTTCTATGTTTATGCTATTTGG - Intergenic
1066789995 10:39051675-39051697 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1066791004 10:39063461-39063483 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1066794497 10:39104315-39104337 CTTTTTTTGATTAAGCAGGTTGG + Intergenic
1066795670 10:39117608-39117630 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1066796606 10:39128788-39128810 CTTTCTTTTCTTCAGCAGGTTGG + Intergenic
1066931424 10:41764964-41764986 CTTTCTTTGATTAAGCAGTTTGG + Intergenic
1069643807 10:69976658-69976680 CTTTCCTTGCTGAAACTATTTGG - Intergenic
1069725463 10:70574844-70574866 CCCTCTTTGCTTAAGCTAGCTGG - Intergenic
1071213090 10:83366968-83366990 CCTACTTTGTTTAAGCTAGAAGG + Intergenic
1075062089 10:119264278-119264300 TTTGTTTTGCTTAAGCTAGTTGG - Intronic
1075988237 10:126807320-126807342 CTTGCTTTGATTAAGCTGGCTGG - Intergenic
1078040167 11:7853853-7853875 CTTTCTTTGCTTGGGCGTGTTGG + Intergenic
1078527136 11:12110077-12110099 CTTGCTTGGCTAAAGCTAGTGGG - Intronic
1080083721 11:28253266-28253288 CTTTCTTGGCCTAAGCAACTGGG - Intronic
1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG + Intronic
1080586716 11:33689380-33689402 CTCTCTTTACTTAAGCCAGGAGG - Intergenic
1082297813 11:50464681-50464703 CTTTCTTTGATTCAGCATGTTGG + Intergenic
1087931918 11:103987695-103987717 CTTTCTTTATTTTAGCTACTAGG - Intronic
1088632651 11:111788843-111788865 CTTTCTTTACTAAAGCTTATAGG - Intronic
1088970677 11:114772329-114772351 CCTTTTTTGCTTTAGCTACTAGG - Intergenic
1089133414 11:116230305-116230327 GTTTCTTTGCATATGCTAATTGG - Intergenic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1089796968 11:120988599-120988621 CTCACCTTGCTCAAGCTAGTGGG + Exonic
1089950113 11:122517870-122517892 CTTTGCTTGCTTAAGCCAGATGG - Intergenic
1090680744 11:129054856-129054878 CTTTCTTTTCTTAAACTTCTGGG - Intronic
1093191498 12:16080004-16080026 CTTTCTCTTCTTAAGACAGTTGG + Intergenic
1093365507 12:18291877-18291899 TTTTTTTTGCTTAAGCTAGCAGG - Intronic
1093808173 12:23460858-23460880 TTTTTTTTCCTTAATCTAGTTGG + Intergenic
1093810102 12:23482118-23482140 CTTTTTTTGCTTAAGCTGTTGGG - Intergenic
1094827440 12:34281192-34281214 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1094860250 12:34457431-34457453 CTTTCTTTGATTCAGCAATTTGG - Intergenic
1094883607 12:34834640-34834662 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1095029513 12:37251355-37251377 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1095057569 12:37632225-37632247 CTTTCTTTGATTGAGCTGTTTGG - Intergenic
1095067643 12:37799986-37800008 CTTTATTTGATTAAGCTGATTGG + Intergenic
1097327267 12:58291225-58291247 CTCTTTTTGCTTAAGCCAGTAGG - Intergenic
1097730314 12:63121756-63121778 CTTTCTTAGCTTAAACTATTTGG - Intergenic
1098401554 12:70081777-70081799 CATTTTTTTCTTAAGCTAGTTGG - Intergenic
1098706564 12:73698682-73698704 CATTCATTTCTTAAGATAGTTGG + Intergenic
1098719219 12:73874053-73874075 CTTTTTTTGCTCAGGTTAGTTGG + Intergenic
1101407798 12:104443990-104444012 CTCTTTTTGTTTAAGCTAGTTGG + Intergenic
1103981614 12:124740474-124740496 CTTTTTTCCCCTAAGCTAGTTGG + Intergenic
1104872194 12:132007894-132007916 CTCTCTCTCCTTAAGCTACTTGG - Intronic
1106478144 13:30115290-30115312 CTTTCATTCCTTAAGCCTGTGGG - Intergenic
1108051084 13:46440163-46440185 CTTTCTTAGTTTAAGATACTGGG - Intergenic
1108196088 13:47996711-47996733 TTTTCTTTGCTTAAAATAGAAGG - Intronic
1108237491 13:48423234-48423256 CTTTCACTGCTTAAGCTGCTGGG + Intronic
1109209649 13:59520115-59520137 CTCTCTCTGTTTAAGCTAATTGG - Intergenic
1109377478 13:61515825-61515847 CTTACTTTTCTGAAGCTAGTTGG - Intergenic
1109543642 13:63813784-63813806 CTTTCTTAGTTTAAGATACTGGG - Intergenic
1109559901 13:64033115-64033137 CTTTCTTGGCTTTTGCTGGTAGG - Intergenic
1112508035 13:99987065-99987087 CTTTCTTTCTTTCAGCTATTTGG + Intergenic
1112691615 13:101902293-101902315 CTTTCTTTTTTTAAGCTTCTTGG + Intronic
1114716984 14:24837350-24837372 CTTTCTTTACTTAAGTTCGGGGG + Intronic
1115418495 14:33165314-33165336 GTTTCATTGCATAATCTAGTAGG + Intronic
1118151819 14:63197578-63197600 CTCTTTTAGCTTAAGCTAGTTGG + Intergenic
1118206042 14:63724560-63724582 CTTCCTTTGCTTCAGCTGTTTGG - Intronic
1118336317 14:64856158-64856180 CTTTGTCTGCTTAAGCCAGCAGG - Intronic
1118397333 14:65348759-65348781 CCTTCTTTGCCTAAGCTAGTTGG - Intergenic
1119723957 14:76910602-76910624 CTCTTTTTGCTTAAGCTAGTTGG + Intergenic
1121177460 14:91901476-91901498 CCTTCCTTGCTCAAGCTAATGGG + Intronic
1121179447 14:91917640-91917662 GTTGTTTTGCTTAAGCTACTTGG + Intronic
1126497587 15:49309300-49309322 TCTTTTTTGCTTAAGGTAGTTGG + Intronic
1126850425 15:52793564-52793586 TTTTCTTTGCTGAACCTGGTAGG - Intergenic
1128916714 15:71569648-71569670 CTTTCTTTGCTTTGGCTGCTAGG - Intronic
1130065204 15:80597159-80597181 CTTTCTCGGCTAAAGCTAGAAGG - Exonic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131796953 15:96028935-96028957 CTTTCTTTGCTAATGCTACAAGG - Intergenic
1133428352 16:5713181-5713203 TTTTATTTGCTTAAGCCATTTGG + Intergenic
1133851446 16:9508030-9508052 CTTTCTTAGCTTAAGTGACTAGG + Intergenic
1136140173 16:28283291-28283313 CTTTTTGTGCTTAAGTCAGTTGG - Intergenic
1136915037 16:34181108-34181130 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1137059892 16:35781894-35781916 CTTTCTTTTATTCAGCCAGTAGG - Intergenic
1137072544 16:35917106-35917128 CTTTTTTTGATTCAGCAAGTTGG - Intergenic
1137074148 16:35940865-35940887 TTTTCTTTGATTAAGCTTGTTGG - Intergenic
1137320961 16:47381576-47381598 GTTTCTATGCTCAAGCTAGGAGG + Intronic
1137359824 16:47804051-47804073 CCATCTTTGCTTAAGCTGCTTGG - Intergenic
1139187450 16:64823544-64823566 CTTTCTCTGCTTTATCTATTTGG - Intergenic
1139660534 16:68417629-68417651 CTTTCTTTGCTTTGGCTGCTAGG + Intronic
1140713340 16:77698366-77698388 CTTGCTTTTCTTAAGCAAGAGGG + Intergenic
1141102511 16:81208460-81208482 ATTTCTATGCTCAAGCAAGTCGG + Intergenic
1144058184 17:11559618-11559640 CTTTGTTTGCTTTTGCTAATAGG - Exonic
1144061192 17:11584072-11584094 CTCTCTTTTCTTGAGCTGGTGGG - Intergenic
1146004427 17:29151914-29151936 CCTCCTTTGCTTCATCTAGTTGG - Intronic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1149792147 17:59488689-59488711 CTTTCTTTGCTTAAATCAGCTGG - Intergenic
1149877307 17:60248352-60248374 CTTTCTGTGTTTAACCTAGTTGG + Intronic
1153780309 18:8489756-8489778 CTCTGTTTTCTTAAGCTAGCTGG - Intergenic
1155443886 18:25890474-25890496 CTTTGATTGCTTAAGCTTTTGGG - Intergenic
1156800051 18:41099710-41099732 TTTTCTTTCCTTAAACAAGTGGG + Intergenic
1157169513 18:45389552-45389574 CTTTCTTGGATTAAGTTAATAGG + Intronic
1158948586 18:62469832-62469854 CTTTGGTTGCTTATGCTTGTGGG + Intergenic
1159621063 18:70638917-70638939 CTTTGGTTGCTTATGCTTGTGGG + Intronic
1159770162 18:72539543-72539565 CATCCTTAGCTTAAGCTAATGGG + Intronic
1162614808 19:11790098-11790120 CTTTCATTGCCTATGCTTGTGGG - Intergenic
1164328750 19:24230396-24230418 CTTTCTTTGATTAAGCAGTTTGG - Intergenic
925536871 2:4927287-4927309 ATTTCTTTCCTGAAGCTAGGTGG - Intergenic
925666007 2:6257085-6257107 CTTGCTGTGCTTGGGCTAGTAGG - Intergenic
927419349 2:22913783-22913805 CTTTGGTTGCTTGAGCTTGTGGG - Intergenic
928776453 2:34769977-34769999 CTTTGGTTGCTTATGCTTGTGGG + Intergenic
930167571 2:48218309-48218331 CTTTGTTGGCTTAAGCTTGTGGG + Intergenic
933728881 2:85442294-85442316 CCTTTTTGGTTTAAGCTAGTGGG + Intergenic
934137597 2:89011927-89011949 GTTAATTTGCTTAAGTTAGTTGG + Intergenic
934231653 2:90188723-90188745 GTTAATTTGCTTAAGTTAGTTGG - Intergenic
935446638 2:103164266-103164288 CTTTCTTTGCTCAAGGGAGACGG + Intergenic
937964903 2:127497744-127497766 CTTACTTTAGTTGAGCTAGTTGG - Intronic
939710243 2:145508553-145508575 CTTTGGTTGCCTAAGCTTGTGGG + Intergenic
941958294 2:171227591-171227613 TTTTTTTTGTTTAAGCCAGTTGG + Intronic
943332281 2:186573973-186573995 TTTTCTTTGCTTAAGCTCAGTGG - Intergenic
943895291 2:193350177-193350199 CTTTCTTTACTCCAGCTATTGGG - Intergenic
944579309 2:201118147-201118169 CTTGCTTTACTTAAGCTTTTGGG + Intronic
945304916 2:208250300-208250322 CTTTTTTTTTTTAACCTAGTTGG + Intronic
945993612 2:216417074-216417096 TTTTCCTTTCTTAAGCTAGGGGG - Intronic
946564147 2:220944434-220944456 CTTCCTCTGCTTAAACTATTTGG - Intergenic
947042422 2:225938559-225938581 CTTTCTTTTCTCATGCTAGTTGG + Intergenic
1170891998 20:20383829-20383851 TTTTCTTTTCTTAAGCTGTTGGG + Intergenic
1171734900 20:28766908-28766930 TTTTCTTTGATTGAGCTGGTTGG - Intergenic
1174451228 20:50621801-50621823 CTTTTTTAGCTTAAGCCAGCTGG + Intronic
1175475803 20:59273280-59273302 CCTTCAATGCTTAAGCAAGTCGG + Intergenic
1176320345 21:5311923-5311945 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1176759019 21:10756093-10756115 CTTTCTTTGATTGAGCTGCTTGG - Intergenic
1177708075 21:24735403-24735425 ATTTCTTTGCTTATGCCAGAAGG - Intergenic
1178174673 21:30082975-30082997 CTTTCATTGTTTAAGACAGTTGG - Intergenic
1183533438 22:38378497-38378519 CTTTCTTTCTTTGATCTAGTTGG - Intronic
949317930 3:2777310-2777332 CTTTCTTTACTAAATTTAGTGGG - Intronic
949772821 3:7597279-7597301 CTGTCTTTGCAATAGCTAGTGGG - Intronic
951829770 3:26913509-26913531 CTCTATTTGCTTTAGCCAGTAGG + Intergenic
952203472 3:31155525-31155547 CTTTTATTGCTTAGGCTAGTTGG - Intergenic
952793778 3:37220908-37220930 ATTTCTTTGTTTAAGACAGTTGG + Intergenic
953368914 3:42370765-42370787 CTCTCTTTGCTAAAGTTAGTGGG + Intergenic
954130375 3:48557504-48557526 CTTTCTTTGCTTTGGCTGCTGGG + Intronic
955661164 3:61300714-61300736 CTTTCTTTGCTTCACGTATTTGG - Intergenic
956222551 3:66919950-66919972 CTTTCTTTTTTTAAGCCACTAGG - Intergenic
956962724 3:74421496-74421518 CTTTCTTTGCTTACTCTGTTAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961756572 3:129130776-129130798 CTTTTTTTACTTAATCTTGTGGG - Intronic
961758408 3:129146064-129146086 TTTTTTTTTCTTACGCTAGTGGG - Intronic
962468525 3:135684001-135684023 CTTTGGTTGCCTAAGCTTGTGGG - Intergenic
963252097 3:143113135-143113157 CTTTTTTTTTTTAAGATAGTAGG - Intergenic
963670794 3:148249333-148249355 CTTTTCCTGCTTAAGCCAGTTGG + Intergenic
964362396 3:155912353-155912375 TTTTCTCTGTTTAAGCTAGGGGG + Intronic
967075309 3:185996548-185996570 CTTTCTTTGCTTAAGTCATATGG - Intergenic
967731371 3:192909990-192910012 CTTTCTTTGCTTAGGCTCTTAGG - Intronic
971993582 4:33933794-33933816 CTTTCTTTGCTTAATCTCTGTGG - Intergenic
972046828 4:34676287-34676309 CTTTCTTTGCTTAATATTTTAGG + Intergenic
973533994 4:51862310-51862332 CTTTCTCTTCTAAAGCTTGTTGG - Intronic
975081752 4:70288642-70288664 CTTTGTTTCCTGAAGCTACTGGG + Intergenic
975734615 4:77369203-77369225 CTTGCTTTGCAGAAGCTACTTGG + Intronic
975961141 4:79906941-79906963 CTTTATTTGCTTAGCCTGGTGGG + Intronic
977243413 4:94601500-94601522 TTTTCCTTGCTTAAGTAAGTGGG + Intronic
977715263 4:100175054-100175076 CGTCCTTTGCTTATGCTATTTGG - Intergenic
977910395 4:102528006-102528028 CTTTCTTGGCTTGAGCTTGGTGG + Intronic
978919788 4:114169540-114169562 CTTTTTCTGCTTAAACTAGCTGG - Intergenic
979749709 4:124263996-124264018 CTTGCTTTCCTTAAGCTACCTGG - Intergenic
986399013 5:7361349-7361371 GTTTCTTTGATGAAGGTAGTCGG - Intergenic
987208876 5:15658264-15658286 TATTTTTTGCTTAAACTAGTAGG + Intronic
987531079 5:19120241-19120263 CTTTTTTTGCTTATGCTCATTGG - Intergenic
988353318 5:30141232-30141254 CTTTCATTGCATATGCTTGTGGG + Intergenic
989563937 5:42882271-42882293 CTCTGTTTGCTTAAGCTAATTGG + Intronic
989617098 5:43348058-43348080 CTTTTTCTGCTTAAACCAGTCGG + Intergenic
992669902 5:79048935-79048957 ATTTCTTTGCTGAAACTTGTGGG - Intronic
993229659 5:85217635-85217657 CTGTCTTTGCTTATGCCAGATGG - Intergenic
993440574 5:87952128-87952150 CTTTCTTCTCTTACCCTAGTAGG + Intergenic
996171398 5:120296108-120296130 CTTTCTTTGCTAACACTAATAGG - Intergenic
996386739 5:122916763-122916785 CTTTCTTTACATAAGCTGCTTGG + Intronic
997395658 5:133557822-133557844 CTCTTTTTGTTTGAGCTAGTTGG + Intronic
999179447 5:149658759-149658781 CCTTCTTTACTTAAGCCAGTTGG - Intergenic
1000681867 5:164194986-164195008 GTTTCTTTGCATAAGATGGTGGG + Intergenic
1001922934 5:175614887-175614909 CTTTCTTTGCATGTGCTTGTTGG - Intergenic
1002100431 5:176855026-176855048 TTTTTTTGGCTGAAGCTAGTTGG - Intronic
1005416830 6:25608750-25608772 CTTATTTTGGTTAAGCAAGTAGG + Intronic
1005429409 6:25739105-25739127 GTTTGTTTGTTTAAGCTACTTGG - Intergenic
1006261516 6:32876682-32876704 CTTTCTGTGCTTAATCTCTTTGG - Intergenic
1008235224 6:49038453-49038475 CTTTCTCTGTTTAAGAGAGTTGG + Intergenic
1008320302 6:50103975-50103997 CTTTCTTTGCTTGTGCTTCTTGG - Intergenic
1008468405 6:51855819-51855841 CTTTCTTTGTTTGAGATAATGGG - Intronic
1008518109 6:52337242-52337264 CTCTTTTTGCTTAAGCTCTTTGG + Intergenic
1010303757 6:74291813-74291835 CTTTGTTTGCCTATGCTTGTGGG + Intergenic
1011846234 6:91566349-91566371 CTATCTTTGCTGAAGCTCTTTGG - Intergenic
1012324312 6:97895986-97896008 CTTTCTTTGCTTGCCCTAGTAGG + Intergenic
1012483179 6:99690341-99690363 CTTTGTTTGCTCAAGGTTGTAGG - Intergenic
1015778597 6:136840227-136840249 GTTTCATTTCTTAAGCTAGATGG - Intronic
1016612401 6:146006047-146006069 CTTTAGTTGCTTATGCTTGTGGG - Intergenic
1017086087 6:150714322-150714344 CTTTCTTTGATTAGGATACTTGG - Intronic
1020856469 7:13431930-13431952 TTTCCTTTGCTTAAGTTAGTTGG + Intergenic
1021015976 7:15534107-15534129 CTTTCTTCTCTTACGCTAATGGG - Intronic
1021091886 7:16493561-16493583 CTTTTTCTGCTTAATCTAGCTGG + Intronic
1021376231 7:19910505-19910527 CTTTCATTGCTTGTGCTTGTAGG - Intergenic
1021711778 7:23422943-23422965 CTATCTTTACTAAAGTTAGTGGG - Intronic
1022959370 7:35411925-35411947 CATTCTTTTCTCAAGCAAGTAGG + Intergenic
1023173692 7:37414709-37414731 CTTTTATTGTTTAAGCCAGTCGG + Intronic
1023518068 7:41022787-41022809 CTTTCTTTCCTTCACCTATTGGG - Intergenic
1024304753 7:47919307-47919329 CTTTCCTGACTTAAGCTAGGAGG - Intronic
1025534162 7:61927562-61927584 CTTTCTTTGGTTCAGCATGTTGG + Intergenic
1028004782 7:85551032-85551054 CTTTCTTTCCTTTACCTGGTTGG - Intergenic
1028176491 7:87666250-87666272 CTTTCTTTTCATATGCTTGTGGG + Intronic
1030881465 7:114885789-114885811 CTCTTTTTACTTAAGCAAGTTGG - Intergenic
1032689963 7:134275967-134275989 CTTTCTTTGCTTTGGCTACCAGG - Intergenic
1033173381 7:139103450-139103472 CTTTTTTGGCTTATGCCAGTCGG - Intronic
1034237975 7:149587418-149587440 CTTGCTTTGTTTAAACTGGTAGG + Intergenic
1036030802 8:4969840-4969862 CTCTCTTTACTTAAACAAGTAGG + Intronic
1036732543 8:11278680-11278702 CTTTCTTTGCTTAACTTATAAGG - Intergenic
1036752381 8:11451372-11451394 CCTTTTTTGCTTCAGCTACTTGG + Intronic
1037301292 8:17454414-17454436 CTCTCATTCCTTAAGCTACTGGG - Intergenic
1038587999 8:28808710-28808732 CTTTCTTTTCTGAAGACAGTGGG + Intronic
1040114579 8:43601608-43601630 CTTTTTTTGATTCAGCAAGTTGG + Intergenic
1040115056 8:43607824-43607846 CTTTCTTTTTTTAAGCAGGTGGG + Intergenic
1040115214 8:43609699-43609721 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1040117745 8:43643742-43643764 CTTTCTTTGATTCAGCAGGTCGG + Intergenic
1040120797 8:43683357-43683379 TTTTCTTTGATTCAGCAAGTTGG + Intergenic
1040127854 8:43758903-43758925 CTTTCTTTTATTAAGGAAGTTGG + Intergenic
1040128736 8:43769426-43769448 CTTTCTTTGATTCAGTTGGTTGG + Intergenic
1040133608 8:43826799-43826821 TTTCCTTTGATTCAGCTAGTGGG + Intergenic
1040133646 8:43827143-43827165 CTTTCTTTGATTAAGCAGGTTGG + Intergenic
1040137736 8:43874900-43874922 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1040320410 8:46292246-46292268 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1040326534 8:46345552-46345574 CTTTCTTTGATTCAGCTGGTTGG + Intergenic
1042725825 8:71875727-71875749 CTTTATTTTCATAAGCTTGTTGG + Intronic
1047190557 8:122675315-122675337 CCTTTTTTGCTTAAGCTAGCTGG + Intergenic
1047773785 8:128052059-128052081 CTTTCTTGGCCAAAGCTAATTGG - Intergenic
1047853581 8:128885360-128885382 CCTTTTTTGCTTCAGCTATTTGG - Intergenic
1048221205 8:132543729-132543751 CTCTCATTCCTTAAGCTACTTGG + Intergenic
1049775774 8:144403844-144403866 CTTTATTTGATTAAGGAAGTTGG - Intronic
1050838029 9:10109066-10109088 GTTTCTTTTTTTATGCTAGTTGG - Intronic
1052420736 9:28240754-28240776 CTTTCGTTGCTTATGCTTGTGGG - Intronic
1054926358 9:70592549-70592571 CCTTCTAGGCTTAAGCTAGTTGG + Intronic
1056403630 9:86252994-86253016 CTTTTTTTTTTTAAGCTATTGGG + Intronic
1057877116 9:98766458-98766480 CTTTCTTTGCCTTTGCTACTAGG - Intronic
1058400774 9:104616593-104616615 CTTTCTTTGCTTTAACTTATAGG - Intergenic
1058557947 9:106190450-106190472 CTTTGTTTGCCTATGCTTGTGGG + Intergenic
1059341213 9:113598554-113598576 CTGTCTTAGATTAAGCTAGATGG + Intergenic
1060446604 9:123694364-123694386 CTTTCTTTGCCTCACCTGGTTGG - Intronic
1060835237 9:126750882-126750904 CCTTTTTTGCTTAAGCTAGTAGG - Intergenic
1061297405 9:129684248-129684270 CCTAGTTTGCTTAAGCTAGCTGG - Intronic
1203396786 Un_KI270519v1:25665-25687 CTTTCTTTGATTGAGCTGTTTGG - Intergenic
1186591726 X:10937207-10937229 CTTTCTTTGCTTAACTTATTTGG + Intergenic
1187162054 X:16773980-16774002 ATTTCTGTGCTTAACATAGTAGG + Intergenic
1187368286 X:18682632-18682654 CTAGCTTTGCTTAAGCCAGCTGG + Intronic
1188569281 X:31562908-31562930 CTTACATTGCATAAGCTAGGAGG + Intronic
1191023063 X:55883671-55883693 CTTTCTTTTCATATGCTTGTTGG - Intergenic
1191260870 X:58319225-58319247 CTTCCTTTGATTCAGCAAGTTGG + Intergenic
1191260946 X:58320425-58320447 CTTCCTTTGATTCAGCAAGTTGG + Intergenic
1191577059 X:62717538-62717560 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1192698599 X:73444792-73444814 CTTTCTTTGCTCAAGCTTTCAGG - Intergenic
1192846575 X:74912045-74912067 CTCTCTTTGCTTAGATTAGTGGG - Intronic
1193176285 X:78398800-78398822 CTTTCTTTGCCTGTGCTTGTGGG - Intergenic
1193982057 X:88193642-88193664 CTTTTGTTGCCTAAGCTTGTAGG - Intergenic
1196053063 X:111325984-111326006 CCTTCTTTTCTGAAACTAGTAGG - Intronic
1197312101 X:124917327-124917349 TTTTTTTCTCTTAAGCTAGTTGG + Intronic
1197921544 X:131599547-131599569 CTTTTTATGCTTAAGGAAGTAGG + Intergenic
1199410484 X:147516911-147516933 CTTTTTTTGCCTAAGCTTTTGGG + Intergenic
1201447674 Y:14076016-14076038 TTTGTTTTACTTAAGCTAGTTGG - Intergenic
1201775143 Y:17654264-17654286 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1201779082 Y:17698563-17698585 CTTTCTTTGGTTTAGCAGGTTGG - Intergenic
1201822474 Y:18207429-18207451 CTTTCTTTGGTTTAGCAGGTTGG + Intergenic
1201826413 Y:18251725-18251747 CTTTCTTTGATTCAGCAGGTTGG + Intergenic