ID: 1080351095

View in Genome Browser
Species Human (GRCh38)
Location 11:31386572-31386594
Sequence TGTTGGGCCTTGAACATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080351091_1080351095 16 Left 1080351091 11:31386533-31386555 CCAGTTCTAGCAGGATTCATCAC 0: 2
1: 21
2: 136
3: 306
4: 520
Right 1080351095 11:31386572-31386594 TGTTGGGCCTTGAACATCACTGG 0: 1
1: 0
2: 2
3: 46
4: 479
1080351092_1080351095 -6 Left 1080351092 11:31386555-31386577 CCAGCTGACTAAAGAGATGTTGG 0: 1
1: 2
2: 31
3: 224
4: 496
Right 1080351095 11:31386572-31386594 TGTTGGGCCTTGAACATCACTGG 0: 1
1: 0
2: 2
3: 46
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080351095 Original CRISPR TGTTGGGCCTTGAACATCAC TGG Intronic
900904730 1:5547122-5547144 AGTTGAGCTTTGAACAACACAGG + Intergenic
902568230 1:17329679-17329701 AGTTGACCCTTGAACAGCACAGG - Intronic
903073953 1:20747212-20747234 AGTTGTCCCTTGAACAACACAGG + Intronic
904087681 1:27921219-27921241 AGTTGACCCTTGAACAACACAGG - Intergenic
904257720 1:29266848-29266870 AGTTGGCCTTTGAACATCACAGG + Intronic
905099194 1:35503691-35503713 AGTTGGCCCTTAAACAACACAGG + Intronic
906398052 1:45484058-45484080 AGTTGGCCCTTGAACAAAACAGG - Intronic
907124946 1:52041361-52041383 AGTTGAGCCTTGAACAACATGGG - Intronic
907228132 1:52968736-52968758 AGTTGGCCCTTGAACAACAGGGG + Intronic
907327506 1:53649967-53649989 AGTTGACCCTTGAACAGCACAGG - Intronic
907643431 1:56215885-56215907 AGTTGGCCCTTGAACAACATGGG - Intergenic
908113381 1:60918535-60918557 TCTTGGGCCGTGAACATCACAGG + Intronic
908662029 1:66447124-66447146 TTTTGAGCCCTGAACATCATAGG - Intergenic
908922271 1:69210178-69210200 AGTTAGCCCTTGAACAACACAGG + Intergenic
908963057 1:69725347-69725369 AGTTGACCCTTGAACAACACAGG - Intronic
909320093 1:74274382-74274404 AGTTGACCCTTGAACAACACAGG - Intronic
909614172 1:77588145-77588167 AGTTGACCCTTGAACAACACAGG - Intronic
910028594 1:82688617-82688639 AGTTGACCCTTGAACAACACAGG - Intergenic
910274900 1:85438553-85438575 AGTTGACCCTTGAACAGCACAGG - Intronic
910306695 1:85772200-85772222 TGTTGGACATTCATCATCACTGG + Intronic
910733710 1:90427961-90427983 AGTTGACCCTTGAACAACACAGG - Intergenic
911076601 1:93881622-93881644 AGTTGACCCTTGAACAACACGGG + Intergenic
911463170 1:98215798-98215820 TGTTGCTCCTTGAACATGCCAGG - Intergenic
911590566 1:99743317-99743339 AGTTGACCCTTGAACAACACAGG + Intronic
913296364 1:117324587-117324609 AGTTGACCCTTGAACAACACAGG + Intergenic
913310340 1:117484008-117484030 AGTTGACCCTTGAACAACACAGG + Intronic
913647273 1:120870292-120870314 TGTTGCCCCTTGAACAACATAGG - Intergenic
914174271 1:145261113-145261135 TGTTGCCCCTTGAACAACATAGG + Intergenic
914299179 1:146363746-146363768 TGTTGACCCTTGAACAACATAGG + Intergenic
914528935 1:148502297-148502319 TGTTGCCCCTTGAACAACATAGG + Intergenic
914637457 1:149564811-149564833 TGTTGCCCCTTGAACAACATAGG - Intergenic
915067292 1:153235939-153235961 AGTTGGCCCTTCAACATCAAGGG + Intergenic
915336592 1:155146619-155146641 TGTTTGGCCTTGGATAGCACTGG + Intergenic
915948605 1:160172511-160172533 GGGTGGGCCTTGAACTTCATGGG + Intronic
916784543 1:168076395-168076417 AGTTGGCCCTTGAACAACACAGG - Intergenic
918170518 1:181992435-181992457 AGTTGACCCTTGAACAACACAGG + Intergenic
918766321 1:188488975-188488997 CGTTGACCCTTGAACAACACAGG - Intergenic
919010475 1:191954846-191954868 GGTTGGCCCTTAAACAACACAGG - Intergenic
919423002 1:197394473-197394495 AGTTGACCCTTGAACATCATGGG - Intronic
920008274 1:202849441-202849463 AGTTGACCCTTGAACAACACAGG - Intergenic
920249360 1:204613031-204613053 TGTTGGGCCCTGTAGACCACTGG - Intergenic
920413509 1:205781480-205781502 AGTTGACCCTTGAACAACACGGG - Intergenic
920533532 1:206722677-206722699 TGTTGGCCCTTGAACAACCCAGG - Intronic
920788720 1:209067728-209067750 AGTTGACCCTTGAACAACACAGG - Intergenic
920985297 1:210883344-210883366 TGTTGGCCCTTGATCACCAGAGG + Intronic
921068481 1:211639691-211639713 TGCTGGGGCTCAAACATCACTGG - Intergenic
921155628 1:212436137-212436159 AGTTGACCCTTGAACAACACAGG - Intronic
921269417 1:213453820-213453842 AGTTGGCCCTTGAACAACACAGG + Intergenic
921339175 1:214117425-214117447 TGTTGTGCCTTGAACACTTCAGG - Intergenic
921484116 1:215696366-215696388 AGTTGACCCTTGAACAACACAGG - Intronic
921545569 1:216470760-216470782 AGTTGTTCCTTGAACAACACGGG - Intergenic
921589825 1:216990484-216990506 TGTTGACCCTTGAACAACATGGG + Intronic
921944250 1:220876059-220876081 TGCTGGGCCTTGTATATTACAGG - Intergenic
923089944 1:230732453-230732475 AGTTGATCCTTGAACAGCACTGG + Intergenic
923199790 1:231700187-231700209 AGTTGACCCTTGAACAACACGGG + Intronic
923202161 1:231723287-231723309 GGTTGACCCTTGAACAACACGGG - Intronic
923815265 1:237370598-237370620 AGTTGACCCTTGAACAACACAGG - Intronic
923872461 1:238010929-238010951 AGTTGATCCTTGAACAACACAGG - Intergenic
924226298 1:241924481-241924503 AGTTGGCCCTTGAACAACACGGG + Intergenic
924599692 1:245477707-245477729 TGCTGTTCCTTGAACATGACAGG - Intronic
1063883104 10:10551197-10551219 AGTTGACCCTTGAACAACACTGG - Intergenic
1064491517 10:15862186-15862208 CATGGGGCCTTGAACATCACTGG + Intergenic
1064902100 10:20306450-20306472 AGTTGGCCCTTGAACAACAAGGG - Intergenic
1064993273 10:21275033-21275055 AGTTAGCCCTTGAACAACACAGG - Intergenic
1065309222 10:24398007-24398029 AGTTGACCCTTGAACAACACAGG + Intronic
1065628178 10:27652559-27652581 AGTTGACCCTTGAACAACACAGG - Intergenic
1065948346 10:30627299-30627321 TGCTGACCCTTGAACATCATGGG + Intronic
1067933463 10:50587151-50587173 AGTTGACCCTTGAACAACACTGG + Intronic
1068011623 10:51458772-51458794 AGTTGTCCCTTGAACAACACAGG + Intronic
1068680294 10:59811874-59811896 AGTTGACCCTTGAACAACACGGG - Intronic
1069096476 10:64265541-64265563 AGTTGGCCCTTTAACAACACAGG - Intergenic
1069184126 10:65401027-65401049 GGTTGCGCCTTGAACAGCACAGG - Intergenic
1069266039 10:66458938-66458960 AGTTGGCCCTTGAACAACATGGG + Intronic
1069677890 10:70261516-70261538 TGTTGACCCTTGAACAACATGGG - Intronic
1070002577 10:72391603-72391625 AGTTGGCCCTGGAACAACACAGG + Intronic
1070262021 10:74865901-74865923 AGTTGACCCTTGAACAACACAGG + Intronic
1070811728 10:79301473-79301495 TGTTGGGCCCTGATCTTCAGGGG - Intronic
1071816385 10:89235921-89235943 AGTTGGTCCTTAAACAACACAGG + Intronic
1072687144 10:97544476-97544498 AGTTGGCCCTTGAACAACGCAGG + Intronic
1073172032 10:101518696-101518718 TCTTGTTCCTTGAACATCCCAGG + Intronic
1074176736 10:111013726-111013748 TGTTGGGACTTGAACTTTAAAGG + Intergenic
1074910195 10:117901439-117901461 TGTTGACCCTTGAACAACACAGG + Intergenic
1074991153 10:118709288-118709310 AGTTGACCCTTGAACAACACGGG - Intronic
1075218329 10:120559566-120559588 AGTTGACCCTTGAACAACACAGG + Intronic
1075288377 10:121206763-121206785 GGTTGACCCTTGAACAACACAGG - Intergenic
1076265023 10:129103039-129103061 TGCTGCTCCTTGAACATCCCAGG - Intergenic
1077165824 11:1137672-1137694 AGTTGGCCCTTGAACAACATGGG + Intergenic
1077845022 11:6014122-6014144 TGCTGGGCTTTGAGCATCAGTGG - Intergenic
1077870185 11:6255880-6255902 TAATGTGCCTTGAACATCATAGG + Intergenic
1078477836 11:11647958-11647980 AGTTGACCCTTGAACAACACAGG + Intergenic
1078562198 11:12382516-12382538 AGTTGATCCTTGAACAACACAGG - Intronic
1078781035 11:14439739-14439761 AGTTGGCCCTTGAACAACATGGG + Intergenic
1079192162 11:18288121-18288143 TATTGGGCCTTGCACATAATAGG - Intronic
1079338037 11:19588634-19588656 TGGAGGGCCTAGAAGATCACTGG + Intronic
1079979219 11:27131725-27131747 TGTTTGGTCTTGAGCTTCACTGG - Intergenic
1080232383 11:30032462-30032484 TGTTGGTCCTTGAACGACACAGG + Intergenic
1080272480 11:30465719-30465741 AGTTGACCCTTGAACAACACAGG + Intronic
1080351095 11:31386572-31386594 TGTTGGGCCTTGAACATCACTGG + Intronic
1081441261 11:43084056-43084078 AGTTGGCCCTTTAACAACACAGG - Intergenic
1081479773 11:43475106-43475128 AGTTGACCCTTGAACAACACAGG - Intronic
1082299513 11:50489312-50489334 TACTGAGACTTGAACATCACAGG - Intergenic
1084137606 11:67198175-67198197 AGTTGATCCTTGAACAACACTGG - Intronic
1084432244 11:69117576-69117598 AGTTGGGTATTGAACGTCACAGG + Intergenic
1086689423 11:89771970-89771992 TGTTGACCCTTGAATAACACTGG + Intergenic
1086716434 11:90067984-90068006 TGTTGACCCTTGAATAACACTGG - Intergenic
1087252378 11:95917479-95917501 AGTTGACCCTTGAACAACACAGG + Intronic
1088208350 11:107422165-107422187 GGTTGACCCTTGAACAACACAGG + Intronic
1088244922 11:107808564-107808586 TGTTTGGTCTTGAACAAGACAGG + Intronic
1088940617 11:114451706-114451728 AGTTGAACCTTGAACAACACGGG - Intergenic
1089532775 11:119142275-119142297 TATTGGGACTTGAACATCTGTGG + Intergenic
1090711973 11:129395320-129395342 TGCTGGTCCTCGAACATCACTGG - Intronic
1091268542 11:134289463-134289485 AGTTGAACCTTGAACAACACAGG - Intronic
1092266762 12:6987177-6987199 AGTTGAGCCTTGAACAGCGCAGG - Intronic
1092345919 12:7714449-7714471 AGTTGACCCTTGAACAACACGGG - Intronic
1092938464 12:13385891-13385913 AGTAGGGCCTTGGAAATCACAGG - Intronic
1093120409 12:15264708-15264730 AGTTGATCCTTGAACAACACAGG + Intronic
1093575649 12:20726391-20726413 AGTTGGCCCTTGAACATGTCGGG - Intronic
1093829973 12:23743854-23743876 AGTTGACCCTTGAACAGCACAGG - Intronic
1093959866 12:25260465-25260487 TATTGTGACTTGAACATCAGTGG - Intergenic
1094678516 12:32646621-32646643 AGTTGACCCTTGAACAACACAGG - Intergenic
1095460039 12:42433846-42433868 AGTTGGTCCTTGAACAATACAGG - Intronic
1095471740 12:42544150-42544172 TGTTGACCCTTGAACAACACAGG - Intronic
1095716936 12:45356351-45356373 AGTTGCCCCTTGAACAACACAGG + Intronic
1095716988 12:45356820-45356842 AGTTGAGCCTTAAACAACACAGG - Intronic
1096257257 12:50071026-50071048 TGTAGGGCCTTGAGCAGAACTGG + Intronic
1096899562 12:54861283-54861305 AGTTGGCCCTGGAACAACACAGG - Intergenic
1098061053 12:66563095-66563117 AGTTGACCCTTGAACAACACAGG - Intronic
1098266583 12:68727915-68727937 AGTTGAGCTTTGAACAACACGGG - Intronic
1098635241 12:72775981-72776003 AGTTGGCCCTTGAACAGCACAGG - Intergenic
1098734695 12:74084588-74084610 TGTTGAACCTTGCACAACACAGG - Intergenic
1098903811 12:76140833-76140855 AGTTGACCCTTGAACAACACTGG + Intergenic
1099519908 12:83647991-83648013 AGTTGGCTCTTGAACAACACAGG + Intergenic
1099600288 12:84726822-84726844 AGTTGACCCTTGAACAACACGGG - Intergenic
1100821331 12:98433387-98433409 AGTTGACCCTTGAACAACACAGG + Intergenic
1103056070 12:117821641-117821663 AGTTGGCCTTTGAACAACACAGG - Intronic
1104135018 12:125929408-125929430 AGTTGACCCTTGAACAACACAGG + Intergenic
1106220077 13:27739396-27739418 AGTTGACCCTTGAACAACACAGG - Intergenic
1106785059 13:33099238-33099260 AGTTGATCCTTGAACAGCACAGG - Intergenic
1108349827 13:49581742-49581764 TCTGGGGACTTGAGCATCACAGG + Intronic
1108584161 13:51853609-51853631 GGTTGGCCCTTGAACAACACAGG - Intergenic
1110314268 13:74087055-74087077 AGTTGACCCTTGAACAACACAGG - Intronic
1110679574 13:78292869-78292891 GCTAGGGCCTTGAACATCACAGG - Intergenic
1111196604 13:84882673-84882695 AGTTGACCCTTGAACAACACGGG + Intergenic
1111196634 13:84883063-84883085 AGTTGGCCCTTGAACAACATGGG - Intergenic
1111276582 13:85955802-85955824 AGTTGGGCCTTGAACAACATGGG + Intergenic
1111929301 13:94497384-94497406 AGTTGACCCTTGAACATCATGGG + Intergenic
1112301680 13:98236458-98236480 AGTTGGCCATTGAACAACACAGG + Intronic
1113235899 13:108273840-108273862 AGTTGACCCTTGAACAACACAGG + Intronic
1113235938 13:108274244-108274266 AGTTGATCCTTGAACAACACAGG - Intronic
1113484796 13:110645994-110646016 TCCTGGGCCTTGCACACCACGGG - Exonic
1113863678 13:113507785-113507807 TGAAGGGCCTGGAACACCACAGG - Intronic
1115123447 14:29965321-29965343 AGTTGACCCTTGAACAACACAGG + Intronic
1116526666 14:45915094-45915116 TGGTGTACCTTGAACATCCCAGG + Intergenic
1116698737 14:48209615-48209637 AGTTGACCCTTGAACAACACAGG - Intergenic
1117282552 14:54255162-54255184 TGTTGACCCTTGAACAACACAGG - Intergenic
1117608172 14:57453573-57453595 AGTTGACCCTTGAACAACACAGG - Intergenic
1118116092 14:62778383-62778405 GGTTGGCCCTTGAATAACACAGG - Intronic
1119092437 14:71797178-71797200 AGTGGGCCCTTGAACAACACAGG - Intergenic
1119118510 14:72050684-72050706 CGTTGACCCTTGAACAACACGGG + Intronic
1119525718 14:75320816-75320838 TGTGGGGCCTTGATCTGCACAGG + Intergenic
1121148618 14:91608846-91608868 AGTTGACCCTTGAACAACACAGG + Intronic
1121393026 14:93592618-93592640 AGTTGACCCTTGAACAACACAGG - Intronic
1121576489 14:94992843-94992865 TGTTGGGCCTTTAATCCCACTGG - Intergenic
1122179061 14:99942561-99942583 AGTTGACCCTTGAACAACACAGG + Intergenic
1122222754 14:100251574-100251596 TCTTGTGCCTTGCACATAACAGG - Intronic
1123991966 15:25690020-25690042 AGTTGACCCTTGAACAACACTGG + Intronic
1124403475 15:29372116-29372138 AGTTGGTTCTTGAACAACACAGG + Intronic
1124437212 15:29660758-29660780 AGTTGACCCTTGAACAACACAGG + Intergenic
1125493941 15:40172297-40172319 AGTTGACCCTTGAACAACACAGG + Intronic
1125493978 15:40172689-40172711 AGTTGACCCTTGAACAACACAGG - Intronic
1126047261 15:44653822-44653844 AGTTGACCCTTGAATATCACAGG + Intronic
1126408683 15:48349570-48349592 TAATGGGCCTTGAACATAACTGG + Intergenic
1127990930 15:64116368-64116390 AGTTGACCCTTGAACAACACAGG - Intronic
1128974261 15:72138280-72138302 AGTTGACCCTTGAACAACACAGG + Intronic
1129026416 15:72578699-72578721 AGTTGACCCTTGAACAACACAGG - Intronic
1129325099 15:74795709-74795731 GGTTGACCCTTGAACAACACAGG + Intronic
1130065409 15:80599002-80599024 AGTTGACCCTTGAACATCATGGG - Intergenic
1130957160 15:88635947-88635969 GGTTGGCCCTTGAACAACATGGG - Intergenic
1131059477 15:89395783-89395805 AGTTTGCCCTTGAACCTCACTGG - Intergenic
1131162369 15:90115486-90115508 AGTTGAGCCTTCAACAACACAGG + Intergenic
1131568474 15:93507198-93507220 AGTTGAACCTTGAACAGCACAGG - Intergenic
1132246943 15:100304755-100304777 AGTTGACCCTTGAATATCACAGG + Intronic
1133313519 16:4867292-4867314 AGTTGACCCTTGAACAACACAGG + Intronic
1135834427 16:25811929-25811951 TGTTGACCCTTGAACAACATTGG - Intronic
1135872000 16:26159945-26159967 AGTTGGCCCTTGAACAACACGGG - Intergenic
1136462783 16:30422206-30422228 AGTTGACCCTTGAACAACACGGG - Intronic
1136866365 16:33759128-33759150 AGTTGGCCCTTGAACAACATGGG - Intergenic
1137250822 16:46739451-46739473 AGTTGGCCCTTGAGCAACACAGG + Intronic
1138944253 16:61828661-61828683 GGTTGACCCTTGAACAACACAGG - Intronic
1141079869 16:81040709-81040731 AGTTGGGACTTGAACAGTACGGG + Intronic
1142067263 16:88069792-88069814 AGTTGACCCTTGAACAACACAGG + Intronic
1203105796 16_KI270728v1_random:1357067-1357089 AGTTGGCCCTTGAACAACATGGG + Intergenic
1203127718 16_KI270728v1_random:1605301-1605323 AGTTGGCCCTTGAACAACATGGG - Intergenic
1142511709 17:399880-399902 TATTTGGCCTTGAACAACATGGG - Intergenic
1142913384 17:3113690-3113712 AGTTGACCCTTGAACAACACAGG - Intergenic
1143754953 17:9060091-9060113 AGTTGGCCCTCGAACAACACAGG + Intronic
1143981956 17:10877784-10877806 TATAGGGCCTTGATCATAACAGG + Intergenic
1144133892 17:12274381-12274403 AGTTGATCCTTGAACAACACGGG + Intergenic
1144143618 17:12375645-12375667 TGTTTGGCATTGAACAGAACAGG + Intergenic
1144187694 17:12811577-12811599 AGTTGGCCTTTGAACAACACAGG - Intronic
1144530152 17:16030351-16030373 AGTTGACCCTTGAACAACACGGG - Exonic
1145857624 17:28177256-28177278 AGTTGACCCTTGAACAACACAGG - Intronic
1147190069 17:38733321-38733343 TCTTGGGCCTTGAACTTGAGTGG - Exonic
1147330026 17:39693133-39693155 AGTTGACCCTTGAACAACACAGG + Intronic
1147808093 17:43146822-43146844 TGTTGGGGATTCAACATCCCTGG + Intergenic
1149265435 17:54922809-54922831 TGTTGAACCTTGAACAACATGGG - Intronic
1149739034 17:59025744-59025766 AGTTGACCCTTGAACAGCACAGG - Intronic
1150448869 17:65249005-65249027 AGTTGACCCTTGAACAGCACCGG - Intergenic
1150512324 17:65768423-65768445 TGTTGACCCTTGAACGACACAGG - Intronic
1150916000 17:69437524-69437546 AGTTGGCCCTTGAACATCAGGGG - Intronic
1150938297 17:69661351-69661373 TGTTGACCTTTGAACAACACAGG - Intergenic
1151332159 17:73416531-73416553 AGTTGACCCTTGAACAACACAGG + Intronic
1152370193 17:79882977-79882999 AGTTGACCCTTGAACAACACGGG - Intergenic
1153319138 18:3754345-3754367 AGTTGACCCTTGAACAACACAGG + Intronic
1153629362 18:7054644-7054666 AGTTGACCCTTGAACAACACGGG + Intronic
1153781447 18:8498650-8498672 AATTGGCCCTTGAACAACACAGG + Intergenic
1153944133 18:10003931-10003953 TGTGGGGCCTGGAATATCCCTGG + Intergenic
1155555324 18:27012163-27012185 TGTTGACCCTTGAACAATACAGG + Intronic
1156148542 18:34216059-34216081 AGTTGATCCTTGAACAACACAGG - Intronic
1157138251 18:45079957-45079979 AGTTGGCCCTTGAACAACATCGG - Intergenic
1157398953 18:47370631-47370653 AGTTGACCCTTGAACAACACGGG - Intergenic
1157837106 18:50915001-50915023 AGTTGACCCTTGAACAACACAGG + Intronic
1157879135 18:51303465-51303487 TGTTGTTCCTTGAACATGCCAGG - Intergenic
1159979934 18:74766185-74766207 TGTTGGACCTTGAAACCCACAGG + Intronic
1160667678 19:340668-340690 AGTTGGCCCTTGAACCTCACGGG - Intronic
1161943679 19:7421225-7421247 AGTCGGCCCTTGAACAGCACGGG + Intronic
1162607862 19:11725083-11725105 GGTTGACCCTTGAACAACACAGG - Intronic
1163305418 19:16474953-16474975 TGTTGAGCCTTGAAGAAAACGGG + Intergenic
1165588628 19:36945660-36945682 AGTTGGCCCTTGAACAACATGGG - Intronic
1166616972 19:44258679-44258701 AGTTGGCTCTTGAACAACACAGG + Intronic
1167968781 19:53172255-53172277 AGTTGGCCCTTGAACAGCACAGG - Intronic
1168053474 19:53847372-53847394 AGTTGATCCTTGAACAACACGGG - Intergenic
925102949 2:1265042-1265064 AGTTGGGCCTTGAACAACCCAGG - Intronic
925263580 2:2548571-2548593 AGTTGGCCCTTGAACAACATAGG + Intergenic
925439363 2:3870629-3870651 GGTTGACCCTTGAACAACACAGG + Intergenic
925520706 2:4741261-4741283 AGTTGATCCTTGAACATAACTGG - Intergenic
927397030 2:22664473-22664495 AGTTGACCCTTGAACAACACAGG + Intergenic
927858840 2:26545935-26545957 AGTTGACCCTTGAACAACACAGG + Intronic
928348757 2:30525826-30525848 TGTAGGGACTTGAACATCCATGG - Intronic
928481305 2:31687023-31687045 AGTTAGGCCTTGAACAACATGGG - Intergenic
928822715 2:35381348-35381370 GGTTGGCCCTTGAACAACATGGG - Intergenic
929127409 2:38534444-38534466 TGGTGGACCTAGAACATCAGGGG - Intergenic
929237128 2:39617232-39617254 GGTTGACCCTTGAACAACACGGG + Intergenic
929315788 2:40476761-40476783 TATAGGGCCTTGAACACCATAGG + Intronic
929474067 2:42227590-42227612 AGTTGACCCTTGAACAACACAGG + Intronic
930609936 2:53530883-53530905 AGTTGACCCTTGAACAACACAGG + Intergenic
930783780 2:55250323-55250345 AGTTGACCTTTGAACATCACGGG - Intronic
931165250 2:59740221-59740243 TCTTGGGCCTTGTTTATCACAGG - Intergenic
931225862 2:60330861-60330883 AGTTGACCCTTGAACAACACAGG + Intergenic
931331314 2:61287449-61287471 AGTTGACCCTTGAACAACACAGG + Intronic
931379563 2:61739841-61739863 AGTTGGCTCTTGAACAGCACAGG - Intergenic
931453705 2:62390026-62390048 AGTTGACCCTTGAACAACACAGG + Intergenic
931744861 2:65282882-65282904 GGTTGGGCCTTGGTCATGACTGG + Intergenic
932864131 2:75323988-75324010 AGTTGACCCTTGAACAACACAGG - Intergenic
932889538 2:75580014-75580036 TGGTGGGCCTGGAACACCAATGG + Intergenic
933022461 2:77211032-77211054 GGATGGGCCTTGAACACCACAGG - Intronic
934635059 2:95977708-95977730 AGTTGGCCCTTGAACAACATGGG - Intronic
934798571 2:97127528-97127550 AGTTGGCCCTTGAACAACATGGG + Intronic
934834859 2:97575966-97575988 AGTTGGCCCTTGAACAACATGGG - Intronic
934975023 2:98795907-98795929 GGTTGACCCTTGAACAACACGGG - Intronic
935106204 2:100046013-100046035 TGTTGACCCTTGAACAGCTCTGG - Intronic
935391283 2:102555719-102555741 AGTTGAGCCTTGAACAACATAGG - Intergenic
935406379 2:102714382-102714404 AGTTGATCCTTGAACAACACAGG - Intergenic
935556036 2:104510495-104510517 AGTTGACCCTTGAGCATCACAGG - Intergenic
937088486 2:119188690-119188712 GGTTGACCCTTGAACAACACAGG - Intergenic
937474175 2:122200158-122200180 TGTTGGCCCTTGAATAACATGGG - Intergenic
938083591 2:128383712-128383734 TGTTGACCCTTGAACAACACGGG - Intergenic
939081579 2:137668987-137669009 AGTTGACCCTTGAACAACACAGG - Intronic
939887012 2:147692025-147692047 AGTTGACCCTTGAACATAACAGG + Intergenic
940585238 2:155639830-155639852 TGTTTAGCCTTGAACAACTCTGG + Intergenic
942245783 2:174006503-174006525 AGTTGACCCTTGAACAACACAGG + Intergenic
942264044 2:174202964-174202986 AGTTGACCCTTGAACAACACAGG - Intronic
944476154 2:200108819-200108841 AGTTGACCCTTGAACAACACTGG - Intergenic
944828471 2:203508650-203508672 TGTTGACACTTGAACAACACAGG - Intronic
944972976 2:205015409-205015431 GGTTGACCCTTGAACAACACAGG - Intronic
945146169 2:206740541-206740563 TGTTGACCCTTGAACAGCATGGG - Intronic
945643916 2:212466209-212466231 TGTTGACCCTTGAACAACACAGG + Intronic
946536948 2:220640817-220640839 TGTTGTGCCTTCAAGTTCACTGG - Intergenic
947089428 2:226493620-226493642 TAATGGGCCTTGAACATAACTGG - Intergenic
947092424 2:226527318-226527340 AGTTGGCCCTTGAACACCATGGG + Intergenic
947762583 2:232614218-232614240 AGTTGGCCCTTGAACAACACAGG + Intronic
948342578 2:237266753-237266775 AGTTGACTCTTGAACATCACAGG - Intergenic
948515658 2:238501988-238502010 ACGTGGGCCTTGAAGATCACAGG - Intergenic
948926239 2:241100285-241100307 AGTTGGCCCTTGAACAACAAGGG + Intronic
1169058749 20:2645004-2645026 AGTTGACCCTTGAACAACACTGG + Intergenic
1169329005 20:4701930-4701952 TGTTGACCCTTGAACTACACAGG + Intergenic
1169451537 20:5716178-5716200 AGTTGGCCCTTGAACAACACTGG - Intergenic
1170227982 20:14013243-14013265 AGTTGACCCTTGAACAACACAGG - Intronic
1170606973 20:17882084-17882106 CGTTGGGCTTTTAACATCTCAGG - Intergenic
1170634795 20:18094794-18094816 AGTTGATCCTTGAACAACACAGG + Intergenic
1170835666 20:19882734-19882756 TGTTGACCCTTGAACAAAACAGG + Intergenic
1170846717 20:19968191-19968213 TGTGGGGCCTGGAACAGCCCTGG - Intronic
1173293852 20:41738347-41738369 TATAGGGCCTTGCACATAACAGG + Intergenic
1173560372 20:44000798-44000820 TATTGGTCCTTCAACATCACAGG - Intronic
1174839644 20:53889606-53889628 AGTTGACCCTTGAACAACACAGG - Intergenic
1174859209 20:54074656-54074678 AGCTGACCCTTGAACATCACGGG - Intergenic
1175474164 20:59257866-59257888 TGGTGAGTCTTGAACATCATGGG - Exonic
1175605523 20:60309337-60309359 AGTTGAGCCTTGAACAACAGGGG + Intergenic
1177074020 21:16549650-16549672 AGTTGGTCCTTGAACATCACAGG + Intergenic
1177499098 21:21927833-21927855 AGTTGGCCCTTGCACAACACAGG + Intergenic
1183114826 22:35683347-35683369 AGTTGAGCCTTGAACAACATGGG + Intergenic
1183651748 22:39159327-39159349 AGTTGATCCTTGAACAACACAGG + Intergenic
1184008403 22:41728191-41728213 AGTTGACCCTTGAACAACACAGG - Intronic
949335619 3:2971287-2971309 AGTTGACCCTTGAACAACACGGG - Intronic
949365230 3:3273428-3273450 AGTTGACCCTTGAACAACACGGG - Intergenic
949587367 3:5454961-5454983 AGTTGGCCCTTGAACAACATGGG - Intergenic
949684806 3:6556632-6556654 AGTTGACCCTTGAACAACACAGG + Intergenic
952388178 3:32858170-32858192 AGTTGACCCTTGAACAACACGGG - Intronic
952908372 3:38159663-38159685 AGTTGACCCTTGAACAACACAGG - Intergenic
953268669 3:41418128-41418150 AGTTGACCCTTGAACAACACAGG + Intronic
953268702 3:41418470-41418492 AGTTGACCCTTGAACAACACGGG - Intronic
953361154 3:42298029-42298051 AGTTGACCCTTGAACATCATGGG + Intergenic
953955125 3:47226112-47226134 AGTTGACCCTTGAACAACACGGG - Intergenic
954772395 3:52983481-52983503 AGTTGACCCTTGAACAACACAGG - Intronic
954775069 3:53009615-53009637 AGTTGACCCTTGAACAACACAGG + Intronic
954884554 3:53860617-53860639 AGTTGACCCTTGAACAACACAGG + Intronic
955574113 3:60340654-60340676 AGTTGACCCTTGAACAACACAGG + Intronic
955959587 3:64326521-64326543 AGTTGACCCTTGAACATCGCAGG + Intronic
957427191 3:80052733-80052755 AGTTGATCCTTGAACAACACAGG - Intergenic
958784167 3:98578959-98578981 AGCTGAGCCTTGAACAACACAGG + Intronic
959596993 3:108139621-108139643 CGTTGACCCTTGAACAACACAGG + Intergenic
959603255 3:108212861-108212883 AGTTGACCCTTGAACAACACGGG + Intronic
959668447 3:108947437-108947459 AGTTGACCCTTGAACAACACAGG - Intronic
959768724 3:110067207-110067229 AGTTGACCCTTGAACATCATGGG - Intergenic
960095934 3:113689898-113689920 TGTTGGGCCTTGGAACTCAAAGG - Intronic
960755781 3:121010546-121010568 AGTTGACCCTTGAACAACACGGG + Intronic
961014331 3:123455911-123455933 AGTTGAACCTTGAACAACACGGG + Intergenic
961207028 3:125092421-125092443 AGTTGTGCCTTGAGCATCAGAGG - Intronic
963335316 3:143968779-143968801 CGTTGTCCCTTGAACAACACAGG - Intergenic
965347475 3:167569727-167569749 AGTTGATCCTTCAACATCACTGG - Intronic
965877691 3:173347836-173347858 AGTTGGCCCTTGAACAACATGGG + Intergenic
966171558 3:177087157-177087179 AGTTGACCCTTGAACAACACAGG - Intronic
966699775 3:182835236-182835258 AGTTGACCCTTGAACAACACAGG - Intronic
967232555 3:187354081-187354103 AGTTGACCCTTGAACAGCACAGG - Intergenic
967429314 3:189363314-189363336 AGTTGGTCATTGAACAACACAGG + Intergenic
967720049 3:192806472-192806494 GGTTGACCCTTGAACAACACAGG - Intronic
967999230 3:195191582-195191604 AGTTGGCCCTTGAACAACATGGG - Intronic
968242171 3:197100047-197100069 AGTTGACCCTTGAACAACACAGG - Intronic
969649475 4:8455787-8455809 AGCTGGCCCTTGAACAACACGGG + Intronic
970127845 4:12834374-12834396 TGTTCACCCTTGAACAACACAGG + Intergenic
970393487 4:15641283-15641305 AGTTGACCCTTGAACAACACAGG + Intronic
971032639 4:22657666-22657688 AGTTGAGCCTTGAACACCATGGG + Intergenic
971174109 4:24264247-24264269 AGTTGAGCCTTGAACAACATGGG - Intergenic
971238403 4:24864759-24864781 AGTTGATCCTTGAACAACACAGG + Intronic
971862789 4:32129765-32129787 AGTTGGCCCTTGAACAACATAGG + Intergenic
971862982 4:32132456-32132478 AGTTGACCCTTGAACATCATGGG - Intergenic
972166867 4:36297234-36297256 AGTTGGCCCTTGAACAACATAGG - Intronic
972268777 4:37488864-37488886 AGTTGACCCTTGAACAACACAGG + Intronic
972392821 4:38629181-38629203 AGTTGACCCTTGAACAGCACAGG + Intergenic
972766549 4:42156696-42156718 TGCAGGTCCTTGTACATCACGGG + Intergenic
972913907 4:43852333-43852355 AGTTGACCCTTGAACAGCACAGG - Intergenic
974178655 4:58358116-58358138 TGTGGAACTTTGAACATCACAGG + Intergenic
974853819 4:67435268-67435290 AGTTGACCCTTGAACAACACAGG + Intergenic
975443909 4:74440843-74440865 AGTTGAGCCTTGAACATTATGGG + Intergenic
975795249 4:78000243-78000265 AGTTGACCCTTGAACAACACAGG - Intergenic
975852878 4:78590617-78590639 TGATGGGCACTGCACATCACAGG + Intronic
977011067 4:91633901-91633923 TGTTGGGTCTTCCACATGACAGG + Intergenic
977099892 4:92797819-92797841 AGTTGGCCCTTGAACAACATGGG - Intronic
977232090 4:94463709-94463731 AGTTGACCCTTGAACAACACAGG - Intronic
977566957 4:98590302-98590324 TGTTGTGCCTGGCACATCATAGG - Intronic
978243588 4:106546126-106546148 AGTTGACCCTTGAACAACACAGG - Intergenic
978556331 4:109984675-109984697 GGTTGACCCTTGAACAACACGGG - Intronic
979096311 4:116555177-116555199 AGTTGGCCCTTGAACAATACAGG + Intergenic
979315890 4:119262730-119262752 AGTTGGCCCTTGAACAACACAGG - Intronic
979564299 4:122136828-122136850 AGCTGGCCCTTGAACAACACAGG - Intergenic
979579428 4:122338802-122338824 AGTTGACCCTTGAACACCACAGG - Intronic
980211487 4:129794091-129794113 TGTTGACCCTTGAAGAACACTGG + Intergenic
981666631 4:147234341-147234363 AGTTGACCCTTGAACAACACAGG - Intergenic
982411889 4:155086892-155086914 AGTTGACCCTTGAACAACACAGG + Intergenic
982768740 4:159376634-159376656 GGTTGAGCCTTGAACAACATGGG - Intergenic
982837384 4:160137327-160137349 AGTTGACCCTTGAACAACACGGG - Intergenic
983145730 4:164212673-164212695 TGAAGGGACTTGAACATCAGTGG - Intronic
983279140 4:165658582-165658604 AGTTGAACCTTGAACAACACAGG - Intergenic
983539589 4:168895036-168895058 AGTTGGACCTTGAACAACACGGG + Intronic
984408218 4:179362083-179362105 TGATGGGAGCTGAACATCACAGG - Intergenic
984424933 4:179571358-179571380 AGTTGCCCCTTGAACAACACAGG - Intergenic
984669213 4:182463126-182463148 GGTTGACCCTTGAACAACACAGG - Intronic
985223114 4:187729396-187729418 AGTTGATCCTTGAACAACACAGG + Intergenic
986088388 5:4477100-4477122 TGATGGGCCTGTAACATAACAGG - Intergenic
986366944 5:7041942-7041964 AGTTGACCCTTGAACAACACAGG + Intergenic
986920002 5:12668672-12668694 TGTTGGTCTTTGAATCTCACAGG + Intergenic
987964075 5:24849900-24849922 AGTTGACCCTTGAACAACACAGG - Intergenic
989039750 5:37215564-37215586 AGTTGACCATTGAACATCACAGG - Intronic
989714457 5:44444861-44444883 AGTTGATCCTTGAACAACACTGG + Intergenic
989978537 5:50613686-50613708 TGTTGCCCCTTGAACAACATAGG - Intergenic
990363518 5:55046011-55046033 AGTTGGCCTTTGAACAACACAGG + Intergenic
990390429 5:55314279-55314301 GATTGGGACATGAACATCACTGG - Intronic
990403080 5:55459711-55459733 TGTTAGCCCTTGAACAACTCAGG + Intronic
990997849 5:61751118-61751140 TGTTGACTCTTGAACAACACAGG - Intronic
991398499 5:66229220-66229242 AGTTGAGCCTTGAACAACACAGG - Intergenic
991711978 5:69416978-69417000 TGTAGGGCCTTGAAAACCACTGG - Intronic
992359740 5:76024889-76024911 AGTTGACCCTTGAACAACACAGG - Intergenic
992499737 5:77330221-77330243 TGTGTGGCCTTGAACATTTCTGG - Intronic
993322214 5:86485700-86485722 AGTTGACCCTTGAACAACACAGG - Intergenic
993673553 5:90791223-90791245 TGTTGGGCTTCGAATATCATCGG + Exonic
993935484 5:93995663-93995685 AGTTGACCCTTGAACAACACAGG - Intronic
994187505 5:96831469-96831491 AGTTGGCCCTTGAACATCATGGG - Intronic
994478353 5:100299693-100299715 AGTTGGCCCTTGAACAACATAGG - Intergenic
994703426 5:103167025-103167047 AGTTGACCCTTGAACACCACAGG - Intronic
994727710 5:103455927-103455949 AGATGACCCTTGAACATCACAGG + Intergenic
995739576 5:115341229-115341251 AGTTGGCCCTTGAACAACACAGG + Intergenic
998100984 5:139434277-139434299 AGTTGGCCTTTGAACAACACAGG - Intronic
998701888 5:144712214-144712236 AGTTGACCCTTGAACAACACAGG + Intergenic
1001132587 5:169076995-169077017 AGTTGACCCTTGAACAACACAGG + Intronic
1001285485 5:170420145-170420167 AGTTGAGGCTTGAACAACACAGG + Intronic
1001564777 5:172692738-172692760 TGCTGTGCCTGGCACATCACTGG - Intergenic
1001655528 5:173345933-173345955 AGTTGGCCCTTGAACAACTCGGG + Intergenic
1002817132 6:691707-691729 AGTTGACCCTTGAACAACACTGG - Intronic
1003666375 6:8115488-8115510 CATCTGGCCTTGAACATCACAGG - Intergenic
1003781963 6:9439316-9439338 AGTTGGCCCTTGAACAACACAGG - Intergenic
1003853422 6:10248144-10248166 AGTTGACCCTTGAACAACACGGG + Intergenic
1003947022 6:11085258-11085280 AGTTGCCCCTTGAACAACACAGG + Intergenic
1004364617 6:15001190-15001212 AGTTGAACCTTGAACAACACAGG - Intergenic
1005881470 6:30065264-30065286 AGTTGACCCTTGAACAACACAGG + Intergenic
1007036130 6:38675464-38675486 AGTTGGCCCTTGAACAACATAGG - Intergenic
1007732603 6:43957126-43957148 TATTGACCCTTGAACAACACAGG + Intergenic
1008778398 6:55069770-55069792 TGTTGTGTCTTGAACATGCCAGG - Intergenic
1010516455 6:76777914-76777936 TGTTTGGCCTGGATCTTCACAGG - Intergenic
1010547878 6:77180969-77180991 TGTTGTGCCTTCAAAATAACAGG + Intergenic
1011623317 6:89263050-89263072 AGTTGACCCTTGAACAACACAGG + Intronic
1012107211 6:95178216-95178238 AGTTGACCCTTGAACAACACAGG - Intergenic
1012421269 6:99068245-99068267 TGCTGACCCTTGAACAACACAGG + Intergenic
1013504391 6:110785265-110785287 AGTTGATCCTTGAACAACACAGG + Intronic
1013788038 6:113804535-113804557 AGTTGGTCCTTGAACAACACAGG - Intergenic
1013891235 6:115030433-115030455 TGTTGAACCTTGAACAACATGGG + Intergenic
1014670374 6:124297135-124297157 TGTTGATCCTTGAACAACATAGG + Intronic
1015327183 6:131936382-131936404 AGTTGGTCCTTGAAAAACACAGG + Intergenic
1016062168 6:139642404-139642426 TGATGGGCAATGATCATCACTGG - Intergenic
1016543643 6:145195736-145195758 AGTTGACCCTTGAACAACACAGG + Intergenic
1017354338 6:153484750-153484772 AGTTGACCCTTGAACAACACAGG - Intergenic
1017961045 6:159220908-159220930 AGCTGGTCCTTGAACAACACAGG - Intronic
1018017336 6:159724488-159724510 AGTTGACCCTTGAACAACACTGG + Intronic
1018584558 6:165342298-165342320 AGTTGACCCTTGAACAACACGGG - Intronic
1018703166 6:166443982-166444004 AGTTGGCCCTTGAACAACACGGG - Intronic
1019228548 6:170536829-170536851 AGTTGAGCCTTGAACAACACGGG - Intronic
1020158357 7:5746642-5746664 TGTTGGACCTTGTATATCTCAGG - Intronic
1020589068 7:10111395-10111417 AGTTGACCCTTGAACAACACAGG - Intergenic
1020970935 7:14937673-14937695 AGCTGGCCCTTGAACAACACAGG + Intronic
1021089769 7:16469780-16469802 AGTTGACCCTTGAACAACACAGG + Intronic
1023296783 7:38723234-38723256 AGTTGACCCTTGAACAACACAGG - Exonic
1023386202 7:39660638-39660660 AGTTGACCCTTGAACAACACAGG + Intronic
1023425220 7:40028985-40029007 GGTTGACCCTTGAACATCATGGG + Intronic
1023441671 7:40190962-40190984 AGTTGGCCCTTGAACAACAGGGG - Intronic
1023752240 7:43383698-43383720 AGTTGGCCCTTGAACAACACAGG + Intronic
1024581882 7:50807294-50807316 AGTTGACCCTTGAACAACACTGG - Intergenic
1024927862 7:54636780-54636802 AGTTGTCCCTTGAACAACACAGG + Intergenic
1025936510 7:66042140-66042162 TGTTGGGCTTTCATCCTCACTGG - Intergenic
1025947658 7:66116783-66116805 TGTTGGGCTTTCATCCTCACTGG + Intronic
1027242310 7:76339585-76339607 TGTTGACCCTTGGACAACACAGG + Intronic
1027875297 7:83760863-83760885 AGTTGGCCTTTGAACAACACAGG + Intergenic
1028030455 7:85905550-85905572 AGTTGGCCATTGAACAACACAGG + Intergenic
1028394406 7:90351644-90351666 AGTTGACCCTTGAACAACACTGG - Intronic
1029253195 7:99251317-99251339 TGCTGTGCCTTCAACATCTCTGG - Intergenic
1029684290 7:102135085-102135107 AGTTGACCCTTGAACAACACAGG + Intronic
1030008969 7:105146902-105146924 AGTTGAACCTTGAACAACACAGG + Intronic
1030129128 7:106182071-106182093 AGTTGACCCTTGAACAACACGGG + Intergenic
1030558515 7:111056535-111056557 AGGTGACCCTTGAACATCACAGG + Intronic
1032343257 7:131095334-131095356 TGTTGGGTCTTGGACATTGCAGG - Intergenic
1032359942 7:131245974-131245996 GCTTGGGCTTTGACCATCACAGG - Intronic
1032765099 7:134984316-134984338 AGTTGAGCCTTGAACAACTCGGG - Intergenic
1033041444 7:137922609-137922631 AGTTGGTCCTTGAACAACACGGG + Intronic
1034047917 7:147949413-147949435 AGTTGATCCTTGAACAACACAGG - Intronic
1034238809 7:149593843-149593865 GGTTGACCCTTGAACAACACAGG - Intergenic
1034643063 7:152620354-152620376 TATTGGGACTTTTACATCACAGG - Intergenic
1034823567 7:154239305-154239327 AGTTGACCCTTGAACAACACGGG + Intronic
1034952619 7:155310579-155310601 TGTTGACCCTTAAACAACACAGG - Intergenic
1035837564 8:2770809-2770831 TGTTGGGACTTCAACCCCACGGG - Intergenic
1037701954 8:21283421-21283443 AGTTGACCCTTGAACAACACGGG + Intergenic
1037749291 8:21669943-21669965 AGTTGAGCCTTGAACAACACAGG - Intergenic
1038346006 8:26733211-26733233 AGTTGGCCCTTGAACAACATGGG + Intergenic
1039218044 8:35295469-35295491 GGTTGGCCCTTGAACAACACAGG - Intronic
1041332900 8:56747853-56747875 TATTGGGCATTTAAAATCACTGG - Intergenic
1041458851 8:58089953-58089975 AGTTGGCCCTTGAATAACACAGG + Intronic
1041779254 8:61559403-61559425 ATTTGGCCCTTGAACAACACAGG - Intronic
1043077811 8:75723691-75723713 AGTTGACCCTTGAACAACACTGG - Intergenic
1044172078 8:89066649-89066671 AGTTGACCCTTGAACAACACAGG - Intergenic
1044489057 8:92790424-92790446 AGTTGACCCTTGAACAACACAGG - Intergenic
1045430981 8:102114812-102114834 TGTTGGCCCTTCCACATCCCTGG - Intronic
1045674663 8:104593793-104593815 AGTTGACCCTTGAACAGCACAGG - Intronic
1046765598 8:118066094-118066116 AGTTGGCCCTTGAACAACATAGG + Intronic
1047018225 8:120746078-120746100 AGTTGAGCCTTGAACAACATAGG + Intronic
1047018256 8:120746488-120746510 AGTTGACCCTTGAACAACACGGG - Intronic
1047113146 8:121813344-121813366 AGTTGACCCTTGAACAACACAGG - Intergenic
1047217621 8:122889649-122889671 AGTTGACCCTTGAACAACACGGG + Intronic
1047320288 8:123773057-123773079 GGTTGGCCCTTGGACAACACGGG - Intronic
1049012916 8:139899582-139899604 AGTTGACCCTTGAACAACACAGG - Intronic
1049411245 8:142474917-142474939 TGTGAGGCCTTGATCACCACTGG + Intronic
1050002406 9:1092035-1092057 AGTTGACCCTTGAACAACACGGG + Intergenic
1050383803 9:5062079-5062101 AGTTGACCCTTGGACATCACAGG + Intronic
1050511584 9:6401878-6401900 AGTTGATCCTTGAACAACACAGG + Intergenic
1050708075 9:8426581-8426603 AATTGGCCCTTGACCATCACTGG - Intronic
1050916842 9:11146576-11146598 ACTTGGCCCTTGAACAACACAGG + Intergenic
1050957513 9:11683457-11683479 AGTTGGCCCCTGAACAACACAGG - Intergenic
1051128033 9:13826921-13826943 TGCTGGCCCTTGAACAACACAGG - Intergenic
1051589063 9:18757612-18757634 TGCTGGGCCTTGACCAGCACAGG - Intronic
1052094661 9:24369658-24369680 TGTTGGCCCACGAACATCTCTGG + Intergenic
1054860452 9:69947658-69947680 AGTTGTTCCTTGAACAACACGGG + Intergenic
1057301348 9:93886824-93886846 CGTTGACCCTTGAACATCATGGG - Intergenic
1057736450 9:97666067-97666089 AGTTGGCCCTTGAACAATACAGG - Intronic
1058695680 9:107557260-107557282 AGTTGACCCTTGAACAACACAGG - Intergenic
1059232156 9:112730699-112730721 GGTTGACCCTTGAACATCATGGG - Intergenic
1060290572 9:122299032-122299054 TGCTGTTCCTTGAACATCCCAGG - Intronic
1061435661 9:130559813-130559835 AGCTGAGCCTTGAACACCACGGG - Intergenic
1061718924 9:132539571-132539593 GGTTGGCCCTAGAACATCATAGG - Intronic
1062061652 9:134499962-134499984 AGTTGACCCTTGAACAACACGGG + Intergenic
1186019774 X:5241076-5241098 AGTTGACCCTTGAACAACACAGG - Intergenic
1186749704 X:12608875-12608897 TGTTGACCCTTGAACAACATGGG + Intronic
1186749741 X:12609294-12609316 AGTTGGCTCTTGAACAACACAGG - Intronic
1187342797 X:18436382-18436404 AGTTGACCCTTGAACAACACAGG - Intronic
1187538839 X:20170401-20170423 AGTTGACCCTTGAACAACACAGG + Intronic
1187776195 X:22760788-22760810 AGTTGAGCCTTGAACAACAGGGG + Intergenic
1188143904 X:26586481-26586503 TGTTGGGCCATGAAACTCCCAGG + Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189763779 X:44348430-44348452 AGTTGGCCTTTGAACAACACAGG + Intergenic
1189834897 X:45009638-45009660 TTTTGGGCTTTAAACATCATTGG + Intronic
1191672628 X:63762680-63762702 TGTTGACCCTTGAACAACACAGG + Intronic
1192609534 X:72553870-72553892 AGTTAGCCCTTGAACAACACAGG - Intronic
1193077038 X:77365123-77365145 TGTAGGGCCCTGACCACCACTGG + Intergenic
1193570469 X:83135546-83135568 AGTTGGCCCTTGAACAACATGGG - Intergenic
1194752237 X:97697739-97697761 AGTTGACCCTTGAACAACACAGG - Intergenic
1195207304 X:102615040-102615062 AGTTGACCCTTGAACAACACAGG - Intergenic
1195309249 X:103614907-103614929 AGTTGACCCTTGAACAACACAGG + Intronic
1195975796 X:110525073-110525095 AGTTGACCCTTGAACAACACAGG - Intergenic
1196885080 X:120236740-120236762 AGTTGACCCTTGAACAACACAGG - Intergenic
1200820429 Y:7577126-7577148 AGTTGACCCTTGAACACCACAGG + Intergenic
1201230770 Y:11862147-11862169 AGTTGACCCTTGAACACCACAGG + Intergenic
1201235848 Y:11910523-11910545 AGTTGACCCTTGAACAACACAGG - Intergenic
1202585621 Y:26423438-26423460 AGTTGGCCCTTGAACAACATGGG + Intergenic