ID: 1080354006

View in Genome Browser
Species Human (GRCh38)
Location 11:31420204-31420226
Sequence AGTATAAACAGACGTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080354006 Original CRISPR AGTATAAACAGACGTGTGTC TGG (reversed) Intronic
905781264 1:40712192-40712214 AGTTTAAAAAGAAATGTGTCAGG - Intronic
907123681 1:52030695-52030717 AGGATAAACAGATGTTTGCCAGG - Intronic
918477511 1:184940974-184940996 AGGATAGACTGACGTGTGTCCGG - Intronic
918910064 1:190556095-190556117 GCAATAAACATACGTGTGTCTGG - Intergenic
920906096 1:210170206-210170228 AGTATAAACACATGTCTGTGTGG + Intronic
921539499 1:216396274-216396296 AGTATAAACAGAAATGTATTAGG - Intronic
923640651 1:235756244-235756266 GGAATAAATAGATGTGTGTCTGG - Intronic
1068577023 10:58695574-58695596 AGTATAAATAGACCTGTCTTGGG + Intronic
1079575056 11:21993726-21993748 AGAATAAAAAGACCTGAGTCAGG + Intergenic
1080354006 11:31420204-31420226 AGTATAAACAGACGTGTGTCTGG - Intronic
1081841363 11:46203863-46203885 AGTATAAAATGAGGCGTGTCTGG + Intergenic
1087322557 11:96680602-96680624 AGTATAAACAGATCTGAGTTTGG + Intergenic
1090691904 11:129192281-129192303 TGTATACTCAGATGTGTGTCTGG + Intronic
1092870924 12:12805239-12805261 AGTATCAACAGACTTGGGGCCGG + Intronic
1099482416 12:83184898-83184920 AGTATCAACAAAAGAGTGTCAGG - Intergenic
1101704623 12:107210555-107210577 AGACTAAACACACGGGTGTCAGG + Intergenic
1104061074 12:125269121-125269143 AATATAATCAGAGGTGTATCTGG - Intronic
1109006806 13:56887579-56887601 AGTACAAAAAAACATGTGTCTGG - Intergenic
1110697079 13:78503756-78503778 ATTCTATACAGACCTGTGTCTGG + Intergenic
1111316307 13:86565256-86565278 TATATAAACAGAAGTGTTTCTGG - Intergenic
1124846066 15:33291837-33291859 AGCATAAACACATGTTTGTCAGG + Intergenic
1126234825 15:46371385-46371407 AAAATGAACAGAAGTGTGTCAGG + Intergenic
1128983701 15:72204054-72204076 AGTAGAAGCAGATGTGTGGCAGG + Intronic
1129952630 15:79605581-79605603 AGTACACACACACGTGTGTGTGG + Intergenic
1139498962 16:67344796-67344818 AGTATAAACAGGGTTGTGTTGGG + Intronic
1140187899 16:72790578-72790600 AGTATTAACAGCTGTTTGTCTGG - Intronic
1150944452 17:69729847-69729869 AGGAAAAACAGCCATGTGTCAGG - Intergenic
927032285 2:19133701-19133723 AGCATAAATAGAAGTGTGCCAGG + Intergenic
928060717 2:28110325-28110347 ATTATAAACACAGGTGTGGCTGG + Intronic
931327855 2:61245920-61245942 AGGATAAAAAGAAGTGTGTGTGG + Intronic
933993429 2:87650104-87650126 AGTTTGAACAGACGAGTGTGTGG + Intergenic
934966299 2:98726641-98726663 ATTATAAACAGACTTTTGGCAGG + Exonic
935316763 2:101842545-101842567 TGTCTGAACAGGCGTGTGTCAGG + Intronic
936300430 2:111300779-111300801 AGTTTGAACAGACGCGTGTGTGG - Intergenic
938855747 2:135308514-135308536 AGTATAAACTCCCCTGTGTCAGG + Intronic
940224636 2:151388846-151388868 AGTACAAACACCAGTGTGTCTGG - Intergenic
940864531 2:158804668-158804690 AGGATAAAAGGATGTGTGTCAGG - Intronic
943828308 2:192425248-192425270 AGTATAAACAATCCTGTGTTTGG - Intergenic
945548726 2:211191770-211191792 AGTATACACTGAAGAGTGTCTGG + Intergenic
947716706 2:232343471-232343493 AGGAAAAACAGTCGTGTGTCTGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1174914661 20:54642388-54642410 AGTTTAAACTGACTTGTGTTGGG - Intronic
1177320791 21:19517142-19517164 AATATAAACAGACCACTGTCAGG - Intergenic
1178080030 21:29053622-29053644 AATAAAAACAGAAGTGTCTCAGG + Intronic
1179152988 21:38824689-38824711 AATATAAACAGACATGTGACTGG + Exonic
1181841018 22:25660987-25661009 AGTATTAACAGACAGGTGACTGG - Intronic
949778910 3:7663913-7663935 AGTGTTAACAGACATGTCTCTGG - Intronic
957938171 3:86970301-86970323 AGTAAAAACAGACATGTGCAAGG + Intronic
961842089 3:129722781-129722803 AGAACAAACAGAGATGTGTCAGG + Intronic
963585325 3:147179463-147179485 ACTATAAATAGAAATGTGTCAGG + Intergenic
965156334 3:165062359-165062381 AGTATCAACAGGTGTGTTTCAGG - Exonic
965201904 3:165669867-165669889 AAAATAAACATACTTGTGTCAGG - Intergenic
969145076 4:5115495-5115517 AGCAAAGACAGAAGTGTGTCTGG + Intronic
976517075 4:85981438-85981460 ACTATAGAAATACGTGTGTCAGG + Intronic
976629040 4:87219037-87219059 AATATAAAAAGAGGTGTCTCAGG - Intronic
979826658 4:125244160-125244182 TGTATAAACACCCGTGGGTCTGG + Intergenic
984577614 4:181469821-181469843 AGTATAAAGATACGAGTCTCAGG - Intergenic
984712487 4:182897551-182897573 AATATGAACAGTAGTGTGTCGGG + Intronic
985245744 4:187978064-187978086 ACTATATACGGACCTGTGTCAGG + Intergenic
987042316 5:14074541-14074563 TGTACACACAGACGTGTGTACGG + Intergenic
987545528 5:19306750-19306772 AGGCTAAACACACGGGTGTCAGG - Intergenic
995091056 5:108177821-108177843 TGTATAAACAGAACAGTGTCTGG + Intronic
997325469 5:133016943-133016965 TGTATAAAGAGAAATGTGTCTGG - Intronic
999896617 5:156041111-156041133 AGCATAATCAGATGTGTATCTGG + Intronic
1003180477 6:3786878-3786900 AGTATAAACCCAAGTGTGTAAGG - Intergenic
1010702871 6:79072815-79072837 AGTATATACATACTTGTGCCTGG + Intronic
1011790166 6:90890442-90890464 AGTACAAACAGAGGTGTGACTGG + Intergenic
1013772746 6:113645729-113645751 AGTAAAAGCCGAGGTGTGTCAGG + Intergenic
1019672757 7:2290997-2291019 AGTATAAACAGTCTTGTAGCGGG + Intronic
1022615502 7:31926117-31926139 TGTATGTACAGACGTGTGTAGGG - Intronic
1027598465 7:80207503-80207525 AAGATAAACACACGTTTGTCAGG + Intronic
1030731741 7:112998149-112998171 AGTATCCACGGAAGTGTGTCAGG + Intergenic
1031133922 7:117865363-117865385 AGTAAAACCAGACCTGTGCCAGG + Intronic
1035411478 7:158646730-158646752 ATTATAAACATAAGTGTGTTGGG + Intronic
1037064092 8:14554539-14554561 AGTAATAGCATACGTGTGTCAGG + Intronic
1038537506 8:28364210-28364232 AGTATGAACTCACGTCTGTCTGG + Intronic
1044253962 8:90038015-90038037 ATTCTAAACAGACTTGTCTCTGG + Intronic
1045040289 8:98217268-98217290 AGGAAAAACAGACATCTGTCTGG + Intronic
1051208356 9:14713928-14713950 AGTGTACACAGATGTGTGTATGG - Intergenic
1057127739 9:92632572-92632594 GGTATAAACAGCAGTGTGGCGGG - Intronic
1192603274 X:72487044-72487066 ACTATAAACTGATGAGTGTCTGG + Intronic
1196185598 X:112741665-112741687 AAAATAAAGAGACGTGTGTATGG + Intergenic
1200897384 Y:8390064-8390086 AGTATCAACAACTGTGTGTCTGG + Intergenic