ID: 1080354220

View in Genome Browser
Species Human (GRCh38)
Location 11:31422993-31423015
Sequence GGTGATTAACTTGGGAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080354220 Original CRISPR GGTGATTAACTTGGGAAAAT TGG (reversed) Intronic
900918139 1:5652601-5652623 GGTGATTATCTTGGCAGAAGCGG - Intergenic
901699533 1:11037387-11037409 GGTGATTAAAATGGGCAACTTGG - Intronic
902957905 1:19939112-19939134 ATTGTTTAACTTAGGAAAATTGG - Intergenic
903501878 1:23804952-23804974 GGTGACTGACCTGGGAAGATGGG - Intronic
904220043 1:28959771-28959793 GGTTTTGAATTTGGGAAAATGGG + Intronic
906364472 1:45195008-45195030 AGTGATTAACTTGGGAAGTGGGG - Intronic
906863725 1:49391856-49391878 GGTTTTGAACTTGGGGAAATGGG + Intronic
906871451 1:49486256-49486278 TGAGATTACCTTTGGAAAATAGG - Intronic
908662229 1:66449272-66449294 AGTGATGGACTTGGGAACATAGG + Intergenic
909842142 1:80341073-80341095 GCTTTTTAAATTGGGAAAATAGG + Intergenic
910995217 1:93097356-93097378 AGTTTTTAACTTGGGAAACTGGG - Intronic
911732725 1:101307280-101307302 GGTGATAAACTGGGGGAAATTGG - Intergenic
912184076 1:107253465-107253487 GCTGATTTTCTGGGGAAAATGGG - Intronic
912580181 1:110713998-110714020 GGTGATTATCTTTGGGAGATGGG + Intergenic
914921295 1:151849290-151849312 GTTGGCTAATTTGGGAAAATAGG + Intronic
915191083 1:154151018-154151040 GATACTTAACTTTGGAAAATTGG + Intronic
918245796 1:182657923-182657945 GGTGAACAGTTTGGGAAAATGGG + Intronic
921576763 1:216844325-216844347 GGAGATTAAGTTGGGAAAGAAGG - Intronic
921961083 1:221035001-221035023 GGTGATTAGCTGTGGAAGATGGG + Intergenic
923313244 1:232756168-232756190 GGGGATTAACTTAGAAATATGGG - Intergenic
924198781 1:241639454-241639476 AGTGATTAACTCGTGAAAGTTGG - Intronic
924486824 1:244492622-244492644 GGGTATTAAATTGGGAAAAGAGG + Intronic
924491274 1:244540185-244540207 GGGTATTAAATTGGGAAAAGAGG + Intronic
924618451 1:245636475-245636497 AGTGATCAAATTAGGAAAATTGG + Intronic
1063029079 10:2213722-2213744 GGAGAGGAACTGGGGAAAATGGG + Intergenic
1063336176 10:5216793-5216815 TGTAAGTAACTTTGGAAAATGGG + Exonic
1065673744 10:28152051-28152073 AGAAATTAACCTGGGAAAATTGG - Intronic
1066425701 10:35305958-35305980 GGAAACTAACTTTGGAAAATAGG - Intronic
1070521333 10:77256170-77256192 GGTGATTGAGTTGGGAAAGCTGG + Intronic
1072994046 10:100227759-100227781 GGAGTCTACCTTGGGAAAATAGG - Intronic
1074454256 10:113583615-113583637 GGTGATAAAGTTGGGAAGCTGGG - Intronic
1074514644 10:114154812-114154834 GTTGATGGACATGGGAAAATGGG - Intronic
1076197492 10:128529838-128529860 TGTGATTTCCTTGAGAAAATAGG - Intergenic
1078049503 11:7949879-7949901 TGTGAATGACTTGGGAAAGTTGG - Intergenic
1078318758 11:10314197-10314219 GGTAATAACCTTGGGACAATTGG - Intronic
1080354220 11:31422993-31423015 GGTGATTAACTTGGGAAAATTGG - Intronic
1084480439 11:69416714-69416736 GGTGATGGACTTGGAAAAACAGG - Intergenic
1089505336 11:118958469-118958491 GGTGTTTAAAGTGGTAAAATGGG - Exonic
1090673164 11:128964980-128965002 GGTGATTGATTTGGGGAATTAGG - Intergenic
1090838106 11:130468246-130468268 GGTGCTTCACTTGCAAAAATGGG - Intronic
1092551479 12:9506522-9506544 TCTGATTATTTTGGGAAAATTGG + Intergenic
1095590065 12:43893075-43893097 GGAGATGAATTTGGTAAAATAGG + Intronic
1097556750 12:61148371-61148393 GGTAATTAAATTAGGAAAAGAGG - Intergenic
1098086845 12:66854698-66854720 GGTGATATAGTTGGAAAAATTGG - Intergenic
1099149512 12:79091823-79091845 TGTGATTAACTTTGGTAAAAAGG - Intronic
1100726138 12:97410840-97410862 GGTAATTAACCAGGAAAAATGGG - Intergenic
1105776010 13:23661006-23661028 GGTCTCTAACTTGGGCAAATAGG + Intronic
1108909512 13:55527106-55527128 GTTGATTAACTTTGGACAGTGGG - Intergenic
1109732435 13:66432357-66432379 GGTAATTTACTTAAGAAAATCGG + Intronic
1110139736 13:72113855-72113877 GGTGATAAACTTGATAAAACAGG - Intergenic
1110798380 13:79666851-79666873 GGTGTTTCACTTGGGAATATGGG + Intergenic
1111058252 13:82978415-82978437 TGTGAATAACCTGGGAAAAGTGG + Intergenic
1114300735 14:21374939-21374961 GTTGGTTAACGTGGAAAAATTGG - Intronic
1117226762 14:53669161-53669183 GGTTATTAACTTAGTAACATGGG + Intergenic
1117759181 14:59008682-59008704 TATAATTAACTGGGGAAAATGGG - Intergenic
1118100667 14:62598110-62598132 GGTGAGTATCTCAGGAAAATGGG + Intergenic
1118191057 14:63580746-63580768 GGAAATTAACTGGAGAAAATGGG - Intergenic
1119775474 14:77245533-77245555 GGTAATTAACATAGGAAAAAGGG + Intronic
1120119800 14:80665356-80665378 GTTAATTAACTTGGGAGAAAAGG + Intronic
1120299409 14:82687276-82687298 GATGATTAAAGGGGGAAAATTGG + Intergenic
1123206379 14:106717627-106717649 GGTGATTAAAGTGGGAAACTTGG - Intergenic
1130007626 15:80115773-80115795 GCAGTTTGACTTGGGAAAATTGG + Intronic
1131006702 15:88984268-88984290 TATGATTAACTTAGGAACATTGG - Intergenic
1138992925 16:62413456-62413478 GTTGAATAACATGGGGAAATTGG + Intergenic
1143532508 17:7513470-7513492 GGTGAGTAACTTGGGGAAGTGGG - Exonic
1144001943 17:11063492-11063514 GGTGGGTAACTTGGGAATCTGGG - Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1148707463 17:49648332-49648354 GGTGATGAATTTGGTATAATGGG - Intronic
1152118133 17:78401338-78401360 GGTGATAGGCTTGGGGAAATGGG - Intronic
1153874637 18:9358215-9358237 GGTGCTTATCTTTGGAAAGTAGG + Intronic
1155853216 18:30798462-30798484 GGGCATAACCTTGGGAAAATTGG - Intergenic
1156748804 18:40424906-40424928 GGAGGTTATCTTGGGAAAACTGG + Intergenic
1158320310 18:56255072-56255094 GGTGTGTAACATGGGCAAATGGG - Intergenic
1161757337 19:6143781-6143803 GCTGATTAGCTCGGGAAAGTGGG + Intronic
1162381139 19:10332756-10332778 CAGGATTAATTTGGGAAAATGGG - Intronic
1166307119 19:41941124-41941146 GGTGACCGACTTGGGGAAATAGG - Intergenic
925260328 2:2523097-2523119 GATAATTAACTCAGGAAAATAGG - Intergenic
926923782 2:17965998-17966020 GGTGATTTACTTGAAAAAAAAGG - Intronic
927441346 2:23120103-23120125 GGTGAAGAACTTGTGAAAAATGG - Intergenic
928056298 2:28058625-28058647 AGTGATTAACCTGGGAAAGTAGG + Intronic
929217783 2:39434711-39434733 GGAGATTAACTTGCCAAAGTTGG - Intronic
930033296 2:47070985-47071007 GGGGATTCACTTGGGACATTTGG + Intronic
930481873 2:51958304-51958326 GGTGAGTAAATGAGGAAAATGGG - Intergenic
933984890 2:87582435-87582457 AGTTATTAACTTATGAAAATAGG - Intergenic
935294919 2:101640494-101640516 GGTGATTCACTTGAGAAGAAGGG + Intergenic
936308962 2:111368376-111368398 AGTTATTAACTTATGAAAATAGG + Intergenic
940499719 2:154478555-154478577 GGTAACTAACTTGGGGAAACAGG - Intergenic
942770653 2:179514337-179514359 TGTGATTACCTTGGGACCATGGG + Intronic
943248017 2:185480801-185480823 AGTGATTTACTTGAGAAAAATGG - Intergenic
948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG + Intronic
1169109696 20:3024266-3024288 GGTGCTTTACTTGGGAAGAAGGG - Intronic
1169519765 20:6358049-6358071 GGTGATTCAGTTGGGAAAAAGGG + Intergenic
1169947801 20:11008032-11008054 GGTGATTAACAGGTGAAATTGGG - Intergenic
1171160970 20:22923023-22923045 AGTGATAAACTAGAGAAAATTGG + Intergenic
1172388373 20:34549420-34549442 GGTGATGAACTCGTAAAAATGGG - Intronic
1172456417 20:35077845-35077867 GGTGATTATCTTGGGATGATGGG + Intronic
1173085535 20:39912579-39912601 GGAGATGAACTTGGAAAAGTAGG + Intergenic
1178050787 21:28745016-28745038 GGTTATTGTCTTGGGAAAATGGG - Intergenic
1179512696 21:41884413-41884435 GGTGATCAGCTTAGGAAAGTTGG + Intergenic
1179766106 21:43574299-43574321 GGTGATTATCTTGGGAGCAATGG + Intronic
1182662877 22:31937348-31937370 GGTGATGACCTTGAGAAGATGGG + Intronic
1183577014 22:38697988-38698010 AGTGATGAACTTAGGAAACTAGG - Intronic
949649301 3:6137135-6137157 TATGATTAAGTTGGTAAAATTGG - Intergenic
949743031 3:7258336-7258358 GGTGATCAAGTTGAGAAAGTAGG + Intronic
954994377 3:54867989-54868011 GGTGATTAACCTGGAAAACATGG + Intronic
955163551 3:56488669-56488691 GGGGATTAATTGGGGGAAATGGG - Intergenic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
959541074 3:107539391-107539413 GGTGATTAGGGAGGGAAAATTGG + Intronic
961064514 3:123863300-123863322 GGTGATTATCTTGGTAATTTTGG + Intronic
962896500 3:139719761-139719783 GGTGATTATCTTGGAAGAGTTGG - Intergenic
963784309 3:149517464-149517486 GTTAATTTAATTGGGAAAATGGG - Exonic
965294132 3:166921478-166921500 AAGGATTAACGTGGGAAAATGGG - Intergenic
966561678 3:181327632-181327654 GATTTTAAACTTGGGAAAATAGG - Intergenic
967647664 3:191945734-191945756 GTTAAAAAACTTGGGAAAATAGG - Intergenic
969944104 4:10765216-10765238 GATGATTTATTTGGGGAAATGGG - Intergenic
970096184 4:12465466-12465488 GGGCATTCACTTAGGAAAATAGG + Intergenic
971781491 4:31040770-31040792 GGGGATTTATCTGGGAAAATTGG - Intronic
971992518 4:33917847-33917869 AGTCATTAACTTTGGCAAATAGG - Intergenic
972262552 4:37424565-37424587 AGTGATTAGGTTGGGAGAATAGG + Intronic
972294876 4:37728004-37728026 GTTGATAAAATTGGTAAAATAGG - Intergenic
974907528 4:68076657-68076679 GCTGCTAAACTTGGGATAATAGG - Intronic
977754431 4:100650375-100650397 AGTGATTAACTTGGGATTCTGGG + Intronic
978361773 4:107938463-107938485 GGTGGTGAAACTGGGAAAATAGG + Intronic
980098863 4:128521247-128521269 GCTGAATAACAGGGGAAAATGGG + Intergenic
980198878 4:129627710-129627732 GGTAATAAACTGGGGAAAACAGG - Intergenic
981514033 4:145587829-145587851 GGTGGGTACCTTGGGGAAATAGG - Intergenic
982243733 4:153327316-153327338 GGTAAGTACCTTGGGAAAGTAGG - Intronic
982479809 4:155895420-155895442 GGTTATTCACTTAGGAAAAGGGG + Intronic
982657575 4:158169368-158169390 AGTGATTTACTTAGAAAAATTGG - Intronic
983096448 4:163567944-163567966 AGTGATTATCTTGAGATAATGGG - Intronic
985726583 5:1519435-1519457 TGTGGTTAACTTTGCAAAATGGG - Intronic
986016879 5:3765410-3765432 GTTGTTTAATTTGGGGAAATAGG - Intergenic
987575391 5:19721892-19721914 TGTGATTAAGTTGGGAAGGTGGG + Intronic
988433659 5:31148802-31148824 TGTGAGTAACCAGGGAAAATAGG + Intergenic
992717312 5:79523510-79523532 TGTGGTTAACTTGAGAAAGTGGG + Intergenic
994894932 5:105691049-105691071 GGTGATTATTTTAGTAAAATTGG + Intergenic
996274378 5:121646639-121646661 GGTTATTCACTTAGGAAAAGTGG - Intergenic
998301533 5:141026267-141026289 GATGATTAATTAGGGTAAATTGG + Intergenic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000175357 5:158746880-158746902 TGTGATTATATTGGGACAATAGG + Intronic
1005143018 6:22655780-22655802 GGTGATTAATTAGTAAAAATGGG + Intergenic
1006621412 6:35367210-35367232 GGTGAGTGATTTGGGAACATGGG + Intronic
1006691267 6:35888899-35888921 GGTTATCATCTTGTGAAAATTGG - Exonic
1007487640 6:42193065-42193087 TGTGAATAACTGGGGAAATTTGG + Intronic
1007975061 6:46093260-46093282 GGTTATTGACCTGGAAAAATGGG - Intergenic
1010238836 6:73597883-73597905 GGTCATTTATTTGGGAAAAAAGG + Intronic
1011423008 6:87194060-87194082 GGTGGATAACTAGGGAGAATTGG + Intronic
1012069188 6:94590588-94590610 GGTCATTAACTTTGGAGAAATGG - Intergenic
1014722302 6:124932264-124932286 GGAAATTAACTTGGGGAAAAGGG + Intergenic
1015916740 6:138225184-138225206 GGAGATAAACTAGGGCAAATTGG - Intronic
1015947380 6:138516608-138516630 TGTTGTTAATTTGGGAAAATAGG + Intronic
1016339076 6:143041713-143041735 AGTGATTAAGTGGTGAAAATGGG + Intergenic
1017578328 6:155831489-155831511 GTTGATTAATTTGTCAAAATGGG + Intergenic
1018524905 6:164699101-164699123 GGTGATAAACTTTGAAAAACAGG - Intergenic
1018730167 6:166644089-166644111 GAGGATTAACTTGTGACAATTGG + Intronic
1021378612 7:19939245-19939267 GGTGATTACTATGGCAAAATGGG - Intergenic
1022218114 7:28284742-28284764 GGAGATTAACTTGGCAAAAGAGG + Intergenic
1022668525 7:32433084-32433106 GGTCATTAACTTGGAATCATAGG + Intergenic
1032835505 7:135668938-135668960 GGTAATTTACATGGGAAAAAGGG + Intronic
1033929054 7:146501467-146501489 TGAGATAAACTGGGGAAAATGGG - Intronic
1036713093 8:11094779-11094801 GGTAAGTAACTTGGGAATCTTGG - Intronic
1041422850 8:57688854-57688876 GGTGATTGAGTTGGGAATGTTGG + Intergenic
1041875884 8:62686365-62686387 AGAGAATAAATTGGGAAAATGGG - Intronic
1047632723 8:126725818-126725840 GGTGGGTAACATGGGAAAATGGG + Intergenic
1047991296 8:130289237-130289259 TGTAAATAACATGGGAAAATGGG + Intronic
1050983494 9:12051701-12051723 AGTCACTAACATGGGAAAATTGG - Intergenic
1052270126 9:26619765-26619787 GGTGGTTAATTTGGGACAAATGG + Intergenic
1053920077 9:42980632-42980654 GGTGATAAACATGCGAAAACAGG - Intergenic
1185663705 X:1747219-1747241 TGTCGTTAGCTTGGGAAAATAGG + Intergenic
1186732793 X:12428169-12428191 TGTGATTAAAATGGAAAAATGGG - Intronic
1186983309 X:14982592-14982614 GTTGAATAACTGGTGAAAATGGG - Intergenic
1188109874 X:26184377-26184399 GGGTATTCAGTTGGGAAAATAGG + Intergenic
1188253787 X:27934089-27934111 AGAGTTTAATTTGGGAAAATGGG - Intergenic
1196562789 X:117170827-117170849 GGAGATTATCTGGGGAAAATTGG + Intergenic
1197484104 X:127025640-127025662 GGTGATCAATCTGGGAAAGTGGG + Intergenic
1201420618 Y:13794668-13794690 GGTGATTAAGTTGGGGACAGAGG - Intergenic