ID: 1080357634

View in Genome Browser
Species Human (GRCh38)
Location 11:31470125-31470147
Sequence GGCAAATGGGCTGGGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4926
Summary {0: 2, 1: 12, 2: 108, 3: 837, 4: 3967}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080357634 Original CRISPR GGCAAATGGGCTGGGTGCAG TGG Intronic
Too many off-targets to display for this crispr