ID: 1080360632

View in Genome Browser
Species Human (GRCh38)
Location 11:31509540-31509562
Sequence GAGACCCTCAACCAGGACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 2, 2: 4, 3: 20, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080360627_1080360632 -9 Left 1080360627 11:31509526-31509548 CCCAAAGAACCCTGGAGACCCTC 0: 1
1: 2
2: 2
3: 19
4: 175
Right 1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG 0: 1
1: 2
2: 4
3: 20
4: 157
1080360626_1080360632 -8 Left 1080360626 11:31509525-31509547 CCCCAAAGAACCCTGGAGACCCT 0: 1
1: 1
2: 4
3: 16
4: 238
Right 1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG 0: 1
1: 2
2: 4
3: 20
4: 157
1080360624_1080360632 -1 Left 1080360624 11:31509518-31509540 CCTCGGGCCCCAAAGAACCCTGG 0: 1
1: 0
2: 3
3: 13
4: 175
Right 1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG 0: 1
1: 2
2: 4
3: 20
4: 157
1080360623_1080360632 3 Left 1080360623 11:31509514-31509536 CCTACCTCGGGCCCCAAAGAACC 0: 1
1: 0
2: 0
3: 15
4: 343
Right 1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG 0: 1
1: 2
2: 4
3: 20
4: 157
1080360628_1080360632 -10 Left 1080360628 11:31509527-31509549 CCAAAGAACCCTGGAGACCCTCA 0: 1
1: 0
2: 2
3: 26
4: 202
Right 1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG 0: 1
1: 2
2: 4
3: 20
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080360632 Original CRISPR GAGACCCTCAACCAGGACAC AGG Exonic
900288593 1:1914317-1914339 GAGACCCTGAGCCAGAACCCAGG + Intergenic
901779748 1:11586009-11586031 GAGCCCCTCAACCAGGGCTGAGG + Intergenic
904192302 1:28755051-28755073 GAGGGCCTGAACCAGGACAGTGG + Intronic
904797958 1:33071612-33071634 CAGAGGCTCAACTAGGACACTGG - Intronic
908304019 1:62792321-62792343 GAGAACCTCAATCAGGGTACTGG - Intronic
910114006 1:83712600-83712622 AAGACGCTCAACCTGGACAGCGG - Intergenic
912669294 1:111609300-111609322 GAGACCTTCAATCAGGTCCCTGG + Intronic
915494854 1:156274817-156274839 GACACACTCATCCAGGACACAGG + Intronic
915915438 1:159937792-159937814 GAGACCCTCAATCTGGAGAGAGG + Exonic
917355733 1:174124741-174124763 GAGAACCTCTACTAGGACAGTGG + Intergenic
919793071 1:201304808-201304830 CAGACCCTAAGCCAGGACTCAGG - Intronic
921050163 1:211505525-211505547 GAGACCCTCTGCAAGGCCACTGG + Intergenic
923035180 1:230280614-230280636 GAGCCCGTCAGCCAGGGCACAGG + Exonic
924239529 1:242027856-242027878 GAGACCCTCAGACAGGCCACTGG - Intergenic
1067449081 10:46370427-46370449 GAGACCCAACACCAGGTCACGGG - Intronic
1067588288 10:47490338-47490360 GAGACCCAACACCAGGTCACGGG + Intronic
1067635413 10:47998429-47998451 GAGACCCAACACCAGGTCACGGG + Intergenic
1067711241 10:48652871-48652893 GAGACCCTCACCAGGCACACAGG + Intronic
1070190239 10:74105587-74105609 GAGACTCTCACCCAGGCCAGAGG + Intronic
1070491383 10:76980204-76980226 CAGACCCTGACCCAGGACCCAGG + Intronic
1070687675 10:78501600-78501622 GAGACCCTCACCAAGAACAAAGG + Intergenic
1074987824 10:118673004-118673026 GAGACCCTCAGACAGTCCACAGG + Intergenic
1076467753 10:130696800-130696822 GAGAACCCAAACCAAGACACAGG - Intergenic
1076734487 10:132452620-132452642 GAGGTCCCCAGCCAGGACACAGG - Intergenic
1076831761 10:132998942-132998964 GACACCCTCAGGCAGGAAACAGG - Intergenic
1077333027 11:1991657-1991679 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1077362156 11:2145532-2145554 GGGACCCCCAAACAGGTCACTGG - Intronic
1078549338 11:12269612-12269634 GAAGCCCTCATCCTGGACACTGG - Intergenic
1078782269 11:14450447-14450469 GAGAGTCTAAACCAGGACAATGG + Intronic
1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG + Exonic
1083556387 11:63632036-63632058 AGGACCCTCAACCAGGACACAGG - Intronic
1085026109 11:73237610-73237632 GAGCCACTCCACAAGGACACAGG + Intergenic
1090256065 11:125285205-125285227 CAGAGCCTGAACCAGGACTCAGG + Intronic
1091279290 11:134372963-134372985 GGGACCCTCAACAAGGGCTCAGG - Intronic
1202816010 11_KI270721v1_random:46835-46857 CAGCCCCTCAACCTGGACCCCGG - Intergenic
1091656755 12:2351725-2351747 ATGACCCTAAGCCAGGACACAGG - Intronic
1092001129 12:5033147-5033169 GAGACTCTCAACCAGCTCCCGGG + Intergenic
1093175751 12:15911493-15911515 GGGACCCACAGCCAGGGCACTGG - Intronic
1094048034 12:26188552-26188574 GAATAACTCAACCAGGACACAGG - Intronic
1095638255 12:44456705-44456727 GAGACCCTAATCCAGAAGACTGG + Intergenic
1098338953 12:69432066-69432088 GGGACACTCAACCAGGAAATAGG + Intergenic
1102447611 12:113015534-113015556 AAGACCCTCAACCAGGACACAGG - Intergenic
1104108753 12:125687069-125687091 GAGACCCTCAATATGGCCACAGG - Intergenic
1105327848 13:19386487-19386509 GGGCCCCTCAGCCAGGCCACCGG + Intergenic
1111515452 13:89325199-89325221 GAGACCCTCAACCATAACAAGGG + Intergenic
1112806410 13:103167822-103167844 TAGACCTACAACCAGGACACAGG + Intergenic
1116204696 14:41848774-41848796 GAGCCCCTCAACCAAGACACTGG + Intronic
1117051790 14:51867593-51867615 GAGGGCCTCAACTAAGACACCGG - Intronic
1119442451 14:74637427-74637449 GAGCCCCCCAAGCAGGAGACAGG + Intergenic
1119658906 14:76436776-76436798 GAGATTCTCAACCAGGGGACTGG + Intronic
1121411074 14:93748611-93748633 GAGCCCCTCACCCAGGGCTCAGG - Intronic
1122714939 14:103690531-103690553 GACAGCCTCACACAGGACACTGG - Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1123206097 14:106714916-106714938 GAGACCTTCACCGAGGACCCAGG + Intergenic
1123211181 14:106762326-106762348 GAGACCTTCACCGAGGACCCAGG + Intergenic
1123758625 15:23416086-23416108 GCCACCATCAACCAGGAGACGGG + Intergenic
1130890093 15:88126320-88126342 GAGAACCACCAACAGGACACAGG + Exonic
1132230978 15:100184077-100184099 GTGCTCCACAACCAGGACACTGG - Intronic
1139453748 16:67054172-67054194 GAGACCGTAAACCAAGAAACAGG - Intronic
1139694732 16:68666060-68666082 GATACCCTCAACAAAGACTCAGG - Intronic
1140128886 16:72140358-72140380 GAGACCCTCAATCAAGACATGGG - Intronic
1141370448 16:83481654-83481676 GAGACTTTCAACCAGGAACCTGG + Intronic
1142143970 16:88485038-88485060 GACACCCTCACCCAGCACAAAGG - Intronic
1142408686 16:89905140-89905162 GGGACCCTCATCCCAGACACGGG + Intronic
1146136223 17:30323238-30323260 GAGACCATAAAACAGGACAAGGG - Intronic
1148169641 17:45508267-45508289 GAGATCCTCAACAGGGACCCTGG - Intergenic
1149602509 17:57902448-57902470 CAGACCCACAGCCCGGACACGGG + Intronic
1150206979 17:63416554-63416576 CAGACCCTAAACCCTGACACTGG + Intronic
1150657627 17:67050757-67050779 GATGCCCTTAACCAGAACACTGG + Intronic
1150942447 17:69707509-69707531 AAGACCCTCAGCCAGGACACAGG + Intergenic
1151353618 17:73545834-73545856 GAGACCCTCTCCCAGGCCCCAGG - Intronic
1151406423 17:73890055-73890077 CAGACCCTCTTCCTGGACACAGG - Intergenic
1152739844 17:82014083-82014105 GGGACCGTCTGCCAGGACACAGG + Intronic
1152939019 17:83156016-83156038 GAGACCAACAACCAAGCCACAGG - Intergenic
1154220463 18:12448965-12448987 GAGACACTGAACCAGGGCACTGG + Exonic
1154358268 18:13639300-13639322 GAGACCCCCAACCTAGACAAGGG + Intronic
1157494477 18:48145433-48145455 GAGACCCGCAATCAGGGCAGGGG - Intronic
1160126467 18:76177169-76177191 CAGACCAGCAACCAGGACAAGGG - Intergenic
1160379035 18:78436015-78436037 GACATCCTCAAGCAGGGCACTGG + Intergenic
1160785132 19:896786-896808 GAGACCCTGAGCCCCGACACAGG + Exonic
1160889393 19:1369277-1369299 GAGGACTTCAACCAGGACATCGG + Exonic
1161351737 19:3796715-3796737 GAGACCCACACCCAAGAAACAGG - Intronic
1163236048 19:16031351-16031373 GGGCCCCTCCTCCAGGACACAGG - Intergenic
1163562376 19:18027305-18027327 GACATGCTCAACCTGGACACAGG - Intergenic
1163626275 19:18391757-18391779 GAGACCCCCAACAAGGGGACAGG - Exonic
1163860062 19:19738135-19738157 GGGCTCCTCATCCAGGACACAGG - Intergenic
1164005189 19:21142141-21142163 GAGACCCACAGCTAAGACACCGG + Exonic
1164634481 19:29782214-29782236 CAGAGCCTCCACCAGGACCCTGG - Intergenic
926297899 2:11581830-11581852 GAGATCCTCCACCAGCACAGTGG - Intronic
928160967 2:28924200-28924222 GTGTCCATCAACCTGGACACTGG + Intronic
928681897 2:33711160-33711182 GAGAACCTTAGCCAGGCCACTGG + Intergenic
929604529 2:43226068-43226090 GAGAAACTCAACCGCGACACCGG + Intronic
934556328 2:95288870-95288892 CAGACCCTCAGCCCTGACACAGG - Intronic
935179425 2:100676685-100676707 GAGACACTCACCCAGGTCATAGG + Intergenic
935638136 2:105266267-105266289 GACACCCCCATCCAGCACACGGG + Exonic
937220422 2:120340126-120340148 GAGTCCTTCCATCAGGACACAGG - Intergenic
939250194 2:139672807-139672829 GTGACCTTCAACCAGGACCCTGG - Intergenic
942074242 2:172342267-172342289 GTGGCCCTCTGCCAGGACACAGG + Intergenic
946591285 2:221250834-221250856 GAGTCCATCAACCTGGAAACAGG - Intergenic
948882523 2:240867489-240867511 GAGACCATCAAGCAGGCCCCAGG + Intergenic
949022861 2:241751393-241751415 GGGACCTGCAAGCAGGACACAGG - Intronic
949023963 2:241756325-241756347 GAGACCCGCATCCCGGACTCCGG - Intronic
1171212532 20:23327846-23327868 GAGACCCTCAACCAGCGCCACGG + Intergenic
1175582721 20:60112936-60112958 GAGAGCCTCTACCAGGAAACAGG - Intergenic
1178889374 21:36508645-36508667 GCCACCCTCTACAAGGACACCGG + Intronic
1179142793 21:38741602-38741624 GTGACTCTCAATCAGGAAACAGG + Intergenic
1179632029 21:42684564-42684586 GAGGCCAGGAACCAGGACACAGG + Intronic
1180172484 21:46067046-46067068 GAGACCCAGGCCCAGGACACAGG + Intergenic
1181087902 22:20451454-20451476 ATGACCCTCATACAGGACACTGG + Intronic
1183791378 22:40073229-40073251 GAGACTCTCAGCTAGGAAACAGG - Intronic
1184075018 22:42171202-42171224 GAGACCGACAGCCAGGTCACTGG + Intronic
1184655976 22:45942214-45942236 GAGACCCCCAGCCTGGACACGGG - Intronic
950574359 3:13822882-13822904 GTGACCCCCATCCAGGACACAGG - Intronic
954083244 3:48224627-48224649 GTGACCCTCAACCAGGCCAGGGG + Exonic
961601628 3:128066825-128066847 GAGCCCCAGAACCAGCACACAGG + Intronic
965957587 3:174389525-174389547 GAGAACCTCAACTAGGGCAGAGG - Intergenic
967407727 3:189136223-189136245 TACACCCTCCACCAGGACACAGG - Intronic
969961829 4:10952299-10952321 GTGACCCTGACCCAGGACACAGG - Intergenic
970139718 4:12968705-12968727 GAGACCCTCAAGGACGAAACTGG + Intergenic
973344109 4:49036093-49036115 GAGACCCAGAACCAGGACAAGGG + Intronic
981608159 4:146562739-146562761 GAAACCTTCAACCTGGAGACAGG - Intergenic
984840537 4:184063552-184063574 TAGAATCTCATCCAGGACACGGG + Intergenic
985251897 4:188032719-188032741 GAGACATTCAACGAGGACAGTGG + Intergenic
985656036 5:1131743-1131765 CAGATCCTCGTCCAGGACACGGG + Intergenic
986291044 5:6398963-6398985 GAGAGCCTGGACCAGGCCACAGG - Intergenic
990530809 5:56671625-56671647 GAGACCCTAAAACAAGCCACAGG + Intergenic
990873858 5:60462585-60462607 GAGTATCTCAACCAGGACACTGG + Intronic
993510240 5:88762173-88762195 CAGACCCACATCCAGGAGACAGG - Intronic
993810901 5:92474442-92474464 GAGAGCCTCCACCGGGACAATGG + Intergenic
997119108 5:131156198-131156220 GGGACCCTCAAGCAGCCCACTGG - Intergenic
998877907 5:146618993-146619015 GAGCCCCTGAACCAGGACAAGGG - Intronic
1002090987 5:176806105-176806127 GAGACCCTTAAGCAAGACATTGG - Intergenic
1003787382 6:9501712-9501734 AAGTCCTTCAACCAGGACACAGG + Intergenic
1005734280 6:28731222-28731244 GAGACCCAAACCCAGGACAGAGG + Intergenic
1007138685 6:39549086-39549108 GAGTTGCTGAACCAGGACACAGG - Intronic
1011180839 6:84618696-84618718 GAGAACCAGAACCAGAACACAGG + Intergenic
1017002749 6:150007102-150007124 GAGACCCGCAATCAGGACTCAGG + Intergenic
1018763333 6:166909429-166909451 GAGACCCTCAACCTGGTGTCTGG - Intronic
1018806917 6:167268895-167268917 GAGGGCCTCAGCCAGGACAAAGG + Intergenic
1018814283 6:167319152-167319174 TGGACCCTTAACCAGGAAACTGG - Intergenic
1019269629 7:139747-139769 GGGAGCCTCGGCCAGGACACTGG + Intergenic
1020006235 7:4785051-4785073 GAGTCCCCCACCCAGGGCACTGG + Intronic
1022063395 7:26824189-26824211 GAGACCCTCGACCAGCAAAAAGG + Intronic
1023026605 7:36056511-36056533 GAAAGCCTCAGCCAGGCCACAGG + Intergenic
1026934235 7:74243338-74243360 GAGACCCTCATTTAGGACATTGG - Intronic
1027981030 7:85222739-85222761 GCGACCCTCAGCCAGGACCTAGG + Intergenic
1029864681 7:103614607-103614629 GAGCACCTTAACAAGGACACTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1036242281 8:7091095-7091117 CAGACCCTCAGCCAGGGCTCAGG - Intergenic
1037554791 8:20011814-20011836 GAGACCCAGAAGCAGGACATGGG - Intergenic
1038443101 8:27585365-27585387 GAGACCCCAACCCAGAACACTGG + Intergenic
1040719489 8:50300380-50300402 GAAACCCTCTTCCAGGACTCTGG - Intronic
1041654886 8:60339009-60339031 GAGAACTTCAACTAGGACAAGGG - Intergenic
1043397699 8:79854790-79854812 GAGACCCACAACATGGACATGGG - Intergenic
1049435269 8:142583539-142583561 GAGACCCTGACCCAGGCCCCCGG + Intergenic
1049597799 8:143492709-143492731 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597812 8:143492744-143492766 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597826 8:143492779-143492801 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597840 8:143492814-143492836 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597854 8:143492849-143492871 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597867 8:143492884-143492906 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597880 8:143492919-143492941 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597893 8:143492954-143492976 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597906 8:143492989-143493011 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597919 8:143493024-143493046 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597933 8:143493059-143493081 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597944 8:143493094-143493116 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597957 8:143493129-143493151 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597971 8:143493164-143493186 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597985 8:143493199-143493221 GAGCCCCTGGGCCAGGACACGGG - Intronic
1050279495 9:4035543-4035565 TAGAGCCTCAACTAGGCCACTGG - Intronic
1054805617 9:69393639-69393661 GAGGCCCTCAAACAGGGCAAGGG - Intergenic
1055740342 9:79381549-79381571 AATACCTTCAACCAGGACCCTGG + Intergenic
1060969498 9:127730220-127730242 GTGACCCACAGCCAGGAGACAGG + Intronic
1061169780 9:128945957-128945979 CACACCCACAGCCAGGACACCGG + Exonic
1061192345 9:129089181-129089203 CAGCCCCTCAACCAGGACCCTGG + Exonic
1062419902 9:136475476-136475498 GAGGCCTTCAGCCAGGACCCAGG - Exonic
1062422023 9:136487265-136487287 GAGACCCTCAGCCACTACCCAGG + Intergenic
1062495584 9:136830089-136830111 GGGGCCCTGCACCAGGACACTGG - Intronic
1203793008 EBV:161548-161570 GTGACCATCAACAAGTACACGGG - Intergenic
1192268489 X:69556586-69556608 GTGTCCCTCAAACATGACACTGG + Intergenic
1192330707 X:70173153-70173175 AAGACCCTGAACCAGGACACTGG + Intergenic
1197530822 X:127623664-127623686 AAGACCCTCAACCAGGACACAGG + Intergenic
1202603990 Y:26623132-26623154 GATCCCCTCACCCAGGCCACAGG - Intergenic