ID: 1080367825

View in Genome Browser
Species Human (GRCh38)
Location 11:31597722-31597744
Sequence CAAAAGCTAGCCTGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183880
Summary {0: 2, 1: 64, 2: 2175, 3: 33044, 4: 148595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080367825_1080367829 11 Left 1080367825 11:31597722-31597744 CCACCACGCCAGGCTAGCTTTTG 0: 2
1: 64
2: 2175
3: 33044
4: 148595
Right 1080367829 11:31597756-31597778 GAGATGGCGTTTCATCATGTTGG 0: 16
1: 3024
2: 51249
3: 107032
4: 135179
1080367825_1080367830 15 Left 1080367825 11:31597722-31597744 CCACCACGCCAGGCTAGCTTTTG 0: 2
1: 64
2: 2175
3: 33044
4: 148595
Right 1080367830 11:31597760-31597782 TGGCGTTTCATCATGTTGGCTGG 0: 1
1: 51
2: 936
3: 2391
4: 3981
1080367825_1080367828 -5 Left 1080367825 11:31597722-31597744 CCACCACGCCAGGCTAGCTTTTG 0: 2
1: 64
2: 2175
3: 33044
4: 148595
Right 1080367828 11:31597740-31597762 TTTTGTATTTTTCGTAGAGATGG 0: 883
1: 209258
2: 144126
3: 66958
4: 41740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080367825 Original CRISPR CAAAAGCTAGCCTGGCGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr