ID: 1080368590

View in Genome Browser
Species Human (GRCh38)
Location 11:31608516-31608538
Sequence CCTGGTGAGCAGCTATGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 4, 2: 2, 3: 18, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080368590 Original CRISPR CCTGGTGAGCAGCTATGGAA GGG Intronic
901077904 1:6566917-6566939 CATGATGAGCAGTTAGGGAAGGG + Intronic
901387990 1:8923727-8923749 CATGGTGAGTGGCTAAGGAAGGG - Intergenic
901676626 1:10889201-10889223 CTTGGTGAGGAGCGATGGCAGGG - Intergenic
904573559 1:31486563-31486585 CCTAGTGAAAAGCTATGGGAGGG - Intergenic
904585916 1:31580517-31580539 CCTGGTGTGCAGAGAGGGAAAGG + Intronic
904696271 1:32333340-32333362 CCTGCTTAGTAGCTTTGGAAAGG + Exonic
906213436 1:44024901-44024923 CCTGGTGAACTGCTGTGGAGGGG - Intronic
906248641 1:44294550-44294572 CCTGATGAGTTGCCATGGAAAGG - Intronic
907011927 1:50970293-50970315 CCTGGTTAGGAGCAAAGGAAAGG + Intronic
907941810 1:59095586-59095608 CATGGGGAGGAGCTATGGGAGGG - Intergenic
909476109 1:76082467-76082489 CCTTGTTAGCAGCTCTGTAAAGG + Intronic
912470024 1:109900461-109900483 GCTGGTGAGGAGCAGTGGAAAGG + Intergenic
915514498 1:156405014-156405036 CAAGGTGAGGAGCTAGGGAAGGG + Intronic
918120890 1:181539251-181539273 CTTGGTGAGAAGCTATGTAGTGG - Intronic
919656021 1:200197939-200197961 TCTGATGAGCAGGTCTGGAATGG + Intergenic
920701350 1:208219964-208219986 CCTGAAGAGGAGCTGTGGAAAGG + Intronic
921917405 1:220627760-220627782 CCTGCTTAGTAGCTTTGGAAAGG + Intronic
922811413 1:228417206-228417228 CCTGTTGAGAAGCTATGAAGGGG + Intergenic
1063080699 10:2764702-2764724 CCTGGTGAGGAGCTTGGGGACGG - Intergenic
1063461166 10:6215862-6215884 CCTGGGGAGCTGCTAAGAAATGG - Intronic
1065312873 10:24433091-24433113 CATGGTGAGCTGCTGTGGAAAGG - Exonic
1067173961 10:43929572-43929594 CCCGGTGTGCATCCATGGAAAGG + Intergenic
1069940941 10:71954860-71954882 CATGGTGAGCAGCTATGGAAGGG + Intergenic
1070219206 10:74422973-74422995 GGTGATGAGCAGCTAGGGAAGGG - Intronic
1070313042 10:75287551-75287573 CCTGGTAAGTAGGTATGGGAGGG - Intergenic
1073535743 10:104275204-104275226 CCTGCAGAGCAGCGATGGAGGGG - Exonic
1074546881 10:114408169-114408191 CCAGGTGAGAAGCTATGGGGTGG + Intergenic
1076324097 10:129607708-129607730 CATGGTGAGCAGCTGTCCAAGGG - Intronic
1076583684 10:131531649-131531671 CCTGAACAGCAGCTATGGAAAGG - Intergenic
1076769816 10:132656790-132656812 CCACCTGAGCAGCTGTGGAAGGG - Intronic
1077573010 11:3355413-3355435 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1077607491 11:3621922-3621944 CCTGCTGAGCAGGTGAGGAATGG + Intergenic
1077915539 11:6609287-6609309 CCTGTCCTGCAGCTATGGAAGGG + Exonic
1078391173 11:10936808-10936830 CCTGGTGGGCAGGTTGGGAAAGG + Intergenic
1080308984 11:30867736-30867758 CCTGGTGAGCACCTGTAGAAAGG + Intronic
1080368590 11:31608516-31608538 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1083228860 11:61302434-61302456 CCAGGTGAGCAGCTCAGGGAGGG + Intronic
1083471880 11:62889496-62889518 CCTGGTGAGTATCTGGGGAAGGG + Intergenic
1084730705 11:71071742-71071764 GCTGGTGAGGAGCCATGGAAGGG + Intronic
1085202925 11:74712614-74712636 CCTGGTGAGCTGGTATGGAGTGG - Intronic
1088631097 11:111774547-111774569 CCTGGGGAACAGAGATGGAAGGG + Intergenic
1088952408 11:114584999-114585021 CCTGCTTAGTAGCTTTGGAAAGG + Intronic
1091157959 11:133391183-133391205 CCTGCTGAGCATCCATGGACAGG + Intronic
1097383069 12:58919372-58919394 ACTGGTCGGTAGCTATGGAAAGG - Intronic
1100206948 12:92360523-92360545 CCTGCAGAGCAGCTAGAGAAAGG + Intergenic
1101877077 12:108603205-108603227 CCTGGTGGGCAGCCATGGCTAGG + Intergenic
1102945025 12:116979324-116979346 CCTGCTCAGCAGCTGTGGATGGG - Intronic
1104157272 12:126145489-126145511 CCTGGAGCTCAGCTGTGGAAAGG - Intergenic
1104284996 12:127417191-127417213 CATGGTGAGCAGCATGGGAATGG - Intergenic
1104706272 12:130949812-130949834 TCTGGAAAGAAGCTATGGAATGG - Intergenic
1105479173 13:20757535-20757557 CCTGGAGAGCTGCTAAGGCATGG + Exonic
1105925691 13:25005805-25005827 CCTGGAGAGCGGCTGTGGAATGG - Intergenic
1107796682 13:44060442-44060464 CCTGGGGAAGAGCAATGGAATGG + Intergenic
1108726620 13:53190282-53190304 CTCGGAGAGCAGCTATGGAGGGG + Intergenic
1111331175 13:86763013-86763035 TATGGTGAGCAGCTATGGAAGGG + Intergenic
1111845473 13:93503086-93503108 CATGGTGAGGATGTATGGAAGGG - Intronic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1114139679 14:19895440-19895462 CCTGGTGAGAAGCAGTGGAGGGG + Intergenic
1114808996 14:25873809-25873831 TCTGGGGACCAGCTATTGAATGG - Intergenic
1115797160 14:36950946-36950968 CCTGGAGAGCAGTTGTGGAGGGG - Intronic
1121787840 14:96675825-96675847 CCTGGTGAGCAGCTACCCATGGG + Intergenic
1121946431 14:98127051-98127073 CACAGTGGGCAGCTATGGAACGG + Intergenic
1122506791 14:102236689-102236711 CGTGGTGAGTAGCTAGGGAAGGG - Intronic
1122824161 14:104361555-104361577 ACTGCTGAGCTGCTTTGGAAGGG + Intergenic
1127959841 15:63882562-63882584 GCTGTGGAGCAGCTATGGCAGGG - Intergenic
1129159383 15:73739018-73739040 CCAGGTGGGCAGCCTTGGAAAGG - Exonic
1131231834 15:90665419-90665441 CCAGGTGAGCAGCACCGGAAGGG + Intergenic
1132295314 15:100730206-100730228 CCTGGAGAGCAGGTGTGGATAGG - Intergenic
1132956891 16:2599117-2599139 CCTGGGGAGTAGCTAGGCAAAGG - Exonic
1134480660 16:14616335-14616357 CCTGGGGAGCACCTGAGGAAGGG - Intronic
1134481923 16:14627125-14627147 TCTGGTGAGGATCTATTGAAGGG + Exonic
1141360228 16:83388759-83388781 CCTGGGGAGCAAGTATGGAGAGG - Intronic
1141736137 16:85854868-85854890 CCTTGGCAGCATCTATGGAATGG + Intergenic
1142944832 17:3416210-3416232 CCTTTTTAGCATCTATGGAAAGG + Intergenic
1148865181 17:50624526-50624548 CCAGGTGAGCAGATGTGGAAAGG + Exonic
1149444488 17:56703244-56703266 CCTGGTCAGTGGCTATCGAAAGG - Intergenic
1149531367 17:57397799-57397821 ACTGGTGAGCAGCTAACCAAGGG + Intronic
1149774540 17:59346832-59346854 CCTTGTGAGGAGAGATGGAAAGG + Intronic
1152816277 17:82409995-82410017 CCTGGGGAGCATCTAGGGGAGGG + Intronic
1152900191 17:82936759-82936781 CCTGATGAGCAGCTCTGAGAGGG - Intronic
1154273408 18:12939277-12939299 CTTGGTGTGCAGCTATTGATTGG - Intergenic
1156460321 18:37318093-37318115 CCTGGAGGGCAGCTGTGGATGGG + Intronic
1156694778 18:39753455-39753477 CCTGGTGAGGAGAGATGGATTGG - Intergenic
1160981218 19:1817458-1817480 CCTGGTGAGCAGGTGGGGAAGGG + Intronic
1161227015 19:3151422-3151444 CCGGGAGAGCTGCTATGGCAGGG - Intronic
1162471934 19:10877343-10877365 CCTTGGGGGCAGCTAGGGAAAGG + Intronic
1163099031 19:15082383-15082405 CCTGGTGAGCAGGTGAGGGATGG + Intergenic
1163883487 19:19946869-19946891 CGTGGTGTGTAGCTAGGGAAGGG - Intergenic
1164393315 19:27844002-27844024 CCTAGTGAGCAGCTATGGAAGGG + Intergenic
1167113758 19:47476802-47476824 CCTGGTGGCCACCTATGGACAGG - Exonic
1167195636 19:48026206-48026228 CCTTGGGATCAGTTATGGAAGGG - Intergenic
1167865377 19:52321574-52321596 CCTAGGGAGCAGCTATGCATTGG + Exonic
1168076841 19:53985120-53985142 CTTGCTGAGCAAATATGGAAGGG - Exonic
1168239344 19:55081489-55081511 AGTGGTGAGCCGCTAAGGAAGGG + Exonic
1168463556 19:56583251-56583273 CCATGTGAGCAACAATGGAATGG - Intronic
928114944 2:28539901-28539923 CCTGGGGGGTAGATATGGAATGG - Intronic
933997864 2:87683117-87683139 CCTGGTAGGCAGTGATGGAAGGG + Intergenic
934682685 2:96296535-96296557 GATGGTGGGCAGCTTTGGAAAGG - Exonic
935101504 2:99999998-100000020 CCACATGAGTAGCTATGGAATGG + Intronic
936295986 2:111267749-111267771 CCTGGTAGGCAGTGATGGAAGGG - Intergenic
936511291 2:113149670-113149692 CCAGCTGGGTAGCTATGGAAAGG - Intergenic
938082714 2:128378733-128378755 CCTGCAGACCAGCTCTGGAAGGG + Intergenic
939119417 2:138098987-138099009 CATGGTGAGCAGATAGGGCATGG + Intergenic
940074844 2:149730024-149730046 CCTGGTAAGCAGCCATAGATAGG - Intergenic
948718853 2:239883506-239883528 CCTGGTCAGCAGCCCTGGATCGG + Intergenic
1169936071 20:10884665-10884687 ACTGGTGAACAGATCTGGAAAGG + Intergenic
1172012525 20:31853981-31854003 CCTGATGAACAGCTGGGGAAAGG + Intronic
1173127995 20:40357868-40357890 CCTGGTGAGGATTTGTGGAAGGG - Intergenic
1174196555 20:48776418-48776440 CCTGCTTAGCAGCTGTGGGAGGG + Intronic
1174238970 20:49117634-49117656 GCTGGGGAGCAGTGATGGAAGGG - Intronic
1175916808 20:62429813-62429835 CCTGGTGGGCAGCCAGGAAATGG - Intergenic
1177591182 21:23169755-23169777 GGTGGTGAGCAGCTAGGGGAAGG + Intergenic
1179627529 21:42657179-42657201 CCTGGTGAGAAGCTGCTGAAGGG + Intronic
1182833307 22:33321308-33321330 CCTGGTGGGCAGGGATGGTAGGG + Intronic
1183687174 22:39367849-39367871 CCTGGTGAGCTGCTGTGGTGGGG - Intronic
1184723419 22:46329150-46329172 GCTGGTGAGCGGGTATGGACAGG + Intronic
950349278 3:12331611-12331633 CCAGGTGGGAAGCTATGGAAAGG + Intronic
951089263 3:18553193-18553215 CTTCATGAGCAGATATGGAAAGG - Intergenic
951786343 3:26423529-26423551 ACTGGTGGGCAGCAATGGCAGGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954036636 3:47854428-47854450 ACTGGGGAGCAGAGATGGAAGGG + Intronic
956436830 3:69242417-69242439 CCTGGAGAGTAGTTAAGGAAGGG - Intronic
956580822 3:70810976-70810998 CCTGGTCAGCAGCAATGTTAAGG + Intergenic
956891929 3:73622311-73622333 CCTGGTGTGCACGTAAGGAAAGG + Intronic
959404009 3:105938649-105938671 CCTAATGAACAGCTATGGAAAGG + Intergenic
960169295 3:114439509-114439531 CCTGGTGAAAAGCTATTGGAGGG + Intronic
961712124 3:128835853-128835875 CCTGGGCAGCAGCGCTGGAAGGG - Intergenic
961843700 3:129741074-129741096 CCTGGTGGGTGGGTATGGAAAGG - Intronic
963056949 3:141193781-141193803 CCTGGTGAGGAGGAATGGATTGG - Intergenic
964379501 3:156083694-156083716 AGTGGTGAGAAGCTGTGGAAGGG - Intronic
967688182 3:192441767-192441789 TCTTGTGAGCAGATACGGAAAGG + Intronic
969993623 4:11289859-11289881 CCTGTTGAGGAGCCAGGGAAAGG + Intergenic
971083079 4:23238006-23238028 CTTGCTGAGCAGCTCTTGAAAGG - Intergenic
977926533 4:102706039-102706061 CCTGGACAGCAGGTATGGCATGG - Intronic
980215364 4:129845706-129845728 CAGGGTTAGCAGCTATAGAAGGG + Intergenic
981529816 4:145741448-145741470 CCTGGTGGGCAGCAATAGTAGGG + Intronic
982597889 4:157407807-157407829 CCTGGTATGCAGCTATTGATTGG - Intergenic
983715457 4:170776469-170776491 CCTGATGACCAGCTGTGGAGAGG + Intergenic
984777445 4:183494471-183494493 CCTGGCGAGCCAGTATGGAATGG + Intergenic
993858681 5:93107271-93107293 ACTGGTGAGCAGCTATCAGAAGG + Intergenic
994965077 5:106659265-106659287 CCTGTTGAGCAGTTAGGAAATGG - Intergenic
995371350 5:111422410-111422432 ACTGGTGAGCAACTATGCAAAGG - Intronic
999116807 5:149171549-149171571 CCTGGAGAGCAGATAGGGTATGG - Intronic
1000814627 5:165905542-165905564 CCTTGTGGGAAGCAATGGAAAGG + Intergenic
1000834034 5:166133758-166133780 CATGGTGAGCAGCTAGGGATGGG + Intergenic
1003260721 6:4513139-4513161 CATGGTGAGAAGCCATGGAGAGG - Intergenic
1005714991 6:28538612-28538634 CCTGGTGGGCAGCTCAGGATGGG - Intergenic
1008701522 6:54106163-54106185 CCTCATGAGGAGCTCTGGAATGG + Intronic
1010419422 6:75655161-75655183 CCCAGTGTGCAGCTTTGGAAGGG + Intronic
1015728012 6:136319376-136319398 CCTAGTGAAAAGCTGTGGAAGGG + Intergenic
1017519495 6:155189105-155189127 CCTGGTGAGAAGCTATATAATGG - Intronic
1019297329 7:285072-285094 CCTGGGGAGGAGCTCTGGAAGGG + Intergenic
1019337167 7:490956-490978 CCTGGCAAGGAGGTATGGAAGGG + Intergenic
1020787910 7:12592503-12592525 CATGGTGAGCAGCTACGGAAGGG + Intronic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1022729227 7:33007094-33007116 CCTGAAGAGAAGCTAAGGAAAGG + Intergenic
1024077129 7:45827211-45827233 CCTGGTGAACAGGGAGGGAAGGG - Intergenic
1024704881 7:51946182-51946204 GCTGGTGCACAGCTATAGAATGG + Intergenic
1024788212 7:52932491-52932513 AGTGGTGAGCAGCTGTGGGAAGG - Intergenic
1025044428 7:55680886-55680908 CCTGAAGAGCAGCTAAAGAAGGG - Intergenic
1025127286 7:56354210-56354232 CCTGGTGAACAGGTAGGGAAGGG + Intergenic
1025875837 7:65478986-65479008 CCTGGTGAGCAGCTATGGCAGGG - Intergenic
1026829633 7:73602978-73603000 CCTGGTGAGCAGCTCGGGCTGGG - Intronic
1034259391 7:149745341-149745363 CATCGTGAGCAGCAAGGGAAGGG + Intergenic
1037473584 8:19235792-19235814 TCTAGTGAGCAGCGATTGAACGG - Intergenic
1037610224 8:20469829-20469851 CCTGGTGAGCAGGTCTGCCATGG + Intergenic
1038288167 8:26225004-26225026 CAATGTGAGCAGATATGGAAGGG + Intergenic
1039475863 8:37839109-37839131 CGTGGTGGGCAGGCATGGAAGGG + Intronic
1040499763 8:47996216-47996238 CACGGTGAGCAGCTAGGGAAGGG + Intergenic
1042155767 8:65842301-65842323 GCTGGCGAGGAGCTAGGGAAGGG - Intronic
1046041167 8:108906567-108906589 CCTGGTGAGAAGATATGGGCAGG + Intergenic
1046743697 8:117854751-117854773 CTTGGTGTGCAGCTGTGAAATGG - Intronic
1047721997 8:127649660-127649682 GCTGTTGAGCAGCCATTGAATGG + Intergenic
1048189813 8:132277758-132277780 CCTGGTGAGGGGCTAGGGCAGGG - Intronic
1049318974 8:141985809-141985831 CATGGTGAGCAGCTACGGTTGGG + Intergenic
1051543716 9:18250464-18250486 CCTGGTGAGAACCTAAAGAATGG + Intergenic
1056971339 9:91207223-91207245 CCTGATGAGAGGTTATGGAATGG + Intergenic
1057035496 9:91809186-91809208 CCTGGTGGGGAGAGATGGAAGGG - Intronic
1058574848 9:106389591-106389613 GCTGGTGATCAGCTAAGGGATGG + Intergenic
1060047845 9:120354583-120354605 CCTGGTGAGCAGCTCTCAACTGG + Intergenic
1061818499 9:133209638-133209660 CCTGCTGAGCAGAAATGGACTGG + Intergenic
1062241952 9:135545724-135545746 CCTGCTGAGCAGAAATGGACTGG - Intergenic
1191021259 X:55862907-55862929 CCTTGTGAGCAGTTATGACATGG + Intergenic
1191778758 X:64845430-64845452 CATGGTGAGCAGCTAGGGATGGG - Intergenic
1192234988 X:69289945-69289967 CCAGGAGAGCAGGGATGGAAGGG - Intergenic
1192250504 X:69409314-69409336 CTTGGTGAGCAGTTTTAGAAGGG - Intergenic
1194800297 X:98264502-98264524 CCTGGGCAGCAGGTATGGCAAGG - Intergenic
1196989379 X:121311439-121311461 CCTGGAGAGCAGTGAGGGAAGGG - Intergenic
1197226531 X:123961040-123961062 CATGGGGGGCAGCCATGGAACGG + Intronic
1198561570 X:137856154-137856176 CCTGATGGGAAGCTATAGAAGGG - Intergenic
1201274461 Y:12285203-12285225 CCTGGTGAGCAGCTGTGGAAGGG + Intergenic