ID: 1080372695

View in Genome Browser
Species Human (GRCh38)
Location 11:31670261-31670283
Sequence AAATGTACCCTTCAAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080372692_1080372695 -3 Left 1080372692 11:31670241-31670263 CCAAACCAACTGAGCATTTAAAA 0: 1
1: 0
2: 0
3: 22
4: 315
Right 1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 259
1080372690_1080372695 20 Left 1080372690 11:31670218-31670240 CCTATCAGGATGACTAATTAAGG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 259
1080372693_1080372695 -8 Left 1080372693 11:31670246-31670268 CCAACTGAGCATTTAAAATGTAC 0: 1
1: 0
2: 5
3: 37
4: 271
Right 1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG 0: 1
1: 0
2: 1
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080372695 Original CRISPR AAATGTACCCTTCAAATTGA GGG Intronic
900202251 1:1414407-1414429 AAATGTAACCTTAAAATTTGAGG - Intergenic
901340581 1:8495223-8495245 AAATGTCCTCTGAAAATTGAAGG - Intronic
901566894 1:10124080-10124102 AATTGTACACTTCAAAATGATGG - Intronic
904449659 1:30602658-30602680 AAATCTAACCTTCAAAGTGTTGG + Intergenic
905525663 1:38637183-38637205 AACTGTATCCTTAAAACTGATGG + Intergenic
907516294 1:54995443-54995465 AAATGTCGCCTTCACAGTGAGGG - Intergenic
908623973 1:66019288-66019310 AAATGTCCCATGCAAATTGATGG + Intronic
908957222 1:69647620-69647642 AAATATAAGCTTCAAATTGAAGG - Intronic
909031907 1:70551543-70551565 AAATGTATACTGCAAATTCAAGG + Intergenic
909068067 1:70960385-70960407 GAATCTATCCTTCAAAATGATGG + Intronic
912311744 1:108629228-108629250 AATTATACCTTTCAAATTGGTGG - Intronic
912673975 1:111659792-111659814 AAATGTATACTGCAAATTCAAGG - Intronic
913177426 1:116287687-116287709 AAATGTAACATTCAAATTCTGGG - Intergenic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
916208662 1:162340179-162340201 AAATATAACCTTCACATTAAAGG + Intronic
916510058 1:165465452-165465474 AAGAGGAGCCTTCAAATTGATGG - Intergenic
919243278 1:194942421-194942443 AAAATTATCCTTCAAAATGAAGG + Intergenic
920830416 1:209459930-209459952 AAATGTAACCTCCAAGGTGATGG + Intergenic
920898099 1:210077607-210077629 AAATGTACAAGTCAAATTGCAGG + Intronic
922120059 1:222656931-222656953 AATTGTGCCTTACAAATTGAAGG - Intronic
922509851 1:226155487-226155509 TAATGTGCTCTTGAAATTGATGG + Intronic
923560455 1:235036315-235036337 AAATGTACACTGCAAATTCTAGG - Intergenic
923592765 1:235334469-235334491 AAATGTACACTTTAAATGGGTGG - Intronic
923734568 1:236592611-236592633 AAATATACTCTTCAAATAGAAGG + Exonic
924170769 1:241337822-241337844 GAGTTTACCTTTCAAATTGAAGG - Intronic
924216801 1:241830926-241830948 AAATGGCCCCTTCAAATCAATGG + Intergenic
1063249885 10:4263183-4263205 AAATTTACATTTCAAATTAAAGG - Intergenic
1065058612 10:21873514-21873536 AAAACTATCCTTCAAAATGAAGG + Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1065340242 10:24697499-24697521 AAAAGCATCCTTTAAATTGATGG - Intronic
1065357318 10:24855121-24855143 AACAGAACCCTTCAAAATGAGGG - Intronic
1067709926 10:48640624-48640646 AAATATATCCTTCAAAATGAAGG + Intronic
1068160738 10:53259820-53259842 AAATGTACCCTTAAGTTTTATGG - Intergenic
1068224340 10:54087185-54087207 AATTGTACCCTTTAAATTGGTGG - Intronic
1069740541 10:70684425-70684447 AAATGGACTCTTCCATTTGAGGG + Intronic
1070716242 10:78724075-78724097 AACTGTACCCTTAAAATGGGTGG + Intergenic
1071317765 10:84419504-84419526 AAGTGTACTCTTCATAATGAAGG + Intronic
1075624520 10:123952137-123952159 AAATGATCCCTTCAAAGTCAAGG + Intergenic
1075921813 10:126219728-126219750 TAATGTACCCGTTAAATGGATGG - Intronic
1078992315 11:16662253-16662275 AAAATTATCCTTCAAAGTGAGGG - Intronic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081430466 11:42971251-42971273 AAATGGTCCCTTCAAAGAGAAGG + Intergenic
1086153869 11:83644504-83644526 AAAGGTAATCTTCAGATTGAGGG - Intronic
1086661495 11:89424767-89424789 AAATGTAGCCTCCTAATTCAAGG - Intronic
1087322236 11:96677131-96677153 AAATGTTGGATTCAAATTGAAGG + Intergenic
1088070745 11:105781427-105781449 AAATTTAGACTTCAAATTGTGGG - Intronic
1088835245 11:113573003-113573025 AAAGGTACAGTTCACATTGAAGG + Intergenic
1091816072 12:3438866-3438888 AAATGTCCTTTTAAAATTGATGG + Intronic
1092823768 12:12377896-12377918 AAATGTATGCTTTAAATTCAGGG - Intronic
1092967695 12:13660337-13660359 AAATGTACCCTTTTAACAGAGGG - Intronic
1093373640 12:18395857-18395879 AAATATACTCTTAAAATTTAAGG - Intronic
1093555174 12:20464308-20464330 ATATATCCCCTTCAAAATGAGGG + Intronic
1095421228 12:42026485-42026507 AAAAGTACTCTTCAAAGAGATGG + Intergenic
1095859394 12:46899211-46899233 AAGTGTACTCTTTAAATTGGTGG + Intergenic
1096576008 12:52553301-52553323 ACATGAAACCTTCAAATTGCTGG + Intergenic
1098821776 12:75240436-75240458 AATTTTTCCCTTCACATTGAAGG + Intergenic
1098821778 12:75240444-75240466 AAATGTATCCTTCAATGTGAAGG - Intergenic
1104340118 12:127941152-127941174 AATTGTACCCTTTAAATGAACGG - Intergenic
1105392434 13:19992975-19992997 AAAAGTACCCTTTAAATCAATGG + Intronic
1105618012 13:22038521-22038543 ACATGTACCATTTAAAATGAGGG - Intergenic
1108162417 13:47655599-47655621 GAAAGTTCCCTTCAAACTGAGGG + Intergenic
1108286353 13:48912631-48912653 AAATGTAGCCATCATAATGAAGG - Intergenic
1108908212 13:55506077-55506099 ACATGTACCCCTGAAGTTGAAGG + Intergenic
1109453696 13:62554155-62554177 AAATATCATCTTCAAATTGAAGG - Intergenic
1110207233 13:72929602-72929624 AATTGTACACTTTAAATTGGTGG + Intronic
1110337532 13:74348874-74348896 AAATTTACCAAGCAAATTGAGGG + Intergenic
1111473387 13:88716041-88716063 AAATGTAACCTAAAAATAGAAGG - Intergenic
1111571087 13:90087260-90087282 AAGTTTACCCTTCAAAATAATGG + Intergenic
1112036054 13:95497653-95497675 AAATGTCCCCTGCAATTTCAGGG + Intronic
1113818215 13:113190437-113190459 AAATGGAGCCTTAAAAATGAAGG + Intronic
1115101032 14:29700152-29700174 AAATGTACCCTAAAATTTGTAGG - Intronic
1115713767 14:36079498-36079520 AAAAGTATCCTTCAAAGAGAAGG + Intergenic
1115746697 14:36445041-36445063 AAATGTACACTTCAAACTCCAGG - Intergenic
1118698433 14:68409135-68409157 AACTGTACACTTGAAATTGGAGG + Intronic
1119785036 14:77306712-77306734 GACTCTACCCTTCAAATTGTGGG - Intronic
1119876483 14:78064115-78064137 AAATGTAACTTTCAAGGTGATGG + Intergenic
1120187103 14:81404864-81404886 AAAAGTAGCCTTCAAAATCAAGG - Intronic
1120374368 14:83682242-83682264 AAAAGTATCCTTCAAAGTGAGGG + Intergenic
1121807440 14:96841889-96841911 AAATTTCCCCTTCAAAGGGAAGG - Intronic
1124928814 15:34098953-34098975 AAATGTACTCTACAAAATGTAGG + Intronic
1125063641 15:35456014-35456036 AAATTTGCCCTCCAAAATGATGG + Intronic
1125143074 15:36432664-36432686 AAAAGTGCCCTTTAAATTCAAGG - Intergenic
1126524387 15:49635018-49635040 AAATGTACACTTAATATTTAAGG - Intronic
1126915405 15:53460671-53460693 AAAAGTTCCCTCCAAACTGAAGG + Intergenic
1127602920 15:60556306-60556328 AAATCTACCCTCAAAATTGAGGG + Intronic
1127820510 15:62650745-62650767 AAGTGCACCCATCAGATTGATGG + Intronic
1128261730 15:66237356-66237378 AACAATACCCTTAAAATTGATGG + Intronic
1130065712 15:80603471-80603493 AAATATACCCTTTACATAGATGG + Intergenic
1131020997 15:89098656-89098678 AAATGTACCCTTCTAAATAGTGG + Intronic
1139271176 16:65684223-65684245 AAATTTACCTTTCAACTTGAAGG - Intergenic
1139316445 16:66074534-66074556 AAAAATACCCTTCAAAATGATGG + Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1144254252 17:13450342-13450364 AAATGTACCCCTTACATTGGTGG + Intergenic
1146249840 17:31329751-31329773 AAAGTTACCCTACAAACTGAAGG - Intronic
1148827924 17:50407953-50407975 CAAGGTAACCCTCAAATTGAAGG + Intergenic
1152306272 17:79522483-79522505 AAATGTACCCTGAAAATAGTTGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155761494 18:29574231-29574253 AAATGTATCTTTCACATAGATGG - Intergenic
1158921077 18:62191433-62191455 ACATGTACCCTGGAAGTTGAAGG - Intronic
1159329196 18:66967326-66967348 AAATGTATACTTCAACTTGCAGG - Intergenic
1159554946 18:69935845-69935867 AACTGTACCCTTCTTATTGTAGG - Intronic
1165676830 19:37733365-37733387 AAATGTACATTTCAAATTTAGGG + Intergenic
1166969440 19:46554807-46554829 AATTGTAACCTTTAAATGGATGG + Intronic
1167842764 19:52135504-52135526 AAATGTAGCCCCCAAAGTGATGG + Intronic
1168172873 19:54600849-54600871 GAATGTACCCTTCAGAGTGGTGG + Exonic
926510108 2:13765598-13765620 AACTGTACACTTAAAATTGGTGG + Intergenic
926543369 2:14208475-14208497 AAATGTACCCCTGACATAGAAGG - Intergenic
926573996 2:14560304-14560326 AAATGTACACTTCTAATATATGG + Intergenic
928158559 2:28899428-28899450 AAAGGTCCCCTTCCAAGTGAAGG + Intronic
928243694 2:29608794-29608816 AAATTTACCCTTCACATTTAAGG + Intronic
929333663 2:40713761-40713783 AAATATACTCTTCATATTAAGGG - Intergenic
930380033 2:50616333-50616355 AAAAGTAACTTTCCAATTGAGGG + Intronic
931972575 2:67605316-67605338 AAATGCTCCATGCAAATTGATGG + Intergenic
933021652 2:77201814-77201836 ATAAGTACTCTACAAATTGAAGG - Intronic
933386701 2:81619907-81619929 AAATGTCCCATTACAATTGATGG - Intergenic
934918764 2:98323825-98323847 AAAACTAGCCTTCAAAATGAAGG + Intergenic
935265618 2:101391299-101391321 ATATATACACTTCAAATTTATGG - Intergenic
935604868 2:104960521-104960543 AAATGTTCCCTTCACATCTATGG - Intergenic
936224734 2:110638190-110638212 AAATGTAGCCTTCAATATGCAGG + Intronic
936654892 2:114473706-114473728 CAATGTAACCTTTAAATTGATGG + Intronic
936744219 2:115554942-115554964 AAATGTTCCCTTCTAATACAGGG + Intronic
937385254 2:121424934-121424956 GACTTAACCCTTCAAATTGATGG - Intronic
938005269 2:127784738-127784760 AAAAGTTCCATTCAAATTGCAGG - Intronic
939023763 2:136987931-136987953 AAATTTCCCCTTGAAACTGAAGG + Intronic
939358262 2:141132891-141132913 AAATGTACTATTCAAATATAAGG + Intronic
939796616 2:146653503-146653525 AAATGTAGCCTTCAATTTGAAGG + Intergenic
940340058 2:152570749-152570771 AAGTGTAACTTTCAAGTTGATGG - Intronic
940499170 2:154473495-154473517 AACTGTACCCTTGAAATTCAGGG + Intergenic
941292220 2:163691160-163691182 AAATTTATCTTTCAAATTGATGG + Intronic
941295006 2:163726952-163726974 AAAGGTTCCCTTAAGATTGAAGG - Intronic
942294237 2:174502098-174502120 AAATGGAACCATCAAACTGATGG + Intergenic
943630806 2:190249905-190249927 AAATGTAGCCTTCAAAGGAATGG + Intronic
943732574 2:191318403-191318425 AAATGGAGCTTTCATATTGAAGG + Intronic
946634148 2:221706013-221706035 AAATCTACCATTAAAATTGATGG + Intergenic
947436996 2:230081311-230081333 AAATGTCCTCTGGAAATTGAGGG - Intergenic
948247161 2:236496407-236496429 AAATGTTCCTTTCAAAATGAAGG + Intronic
1169927138 20:10795036-10795058 AGATGTAGCCTTCACTTTGAAGG - Intergenic
1170371584 20:15654586-15654608 AACTGCCCCCTTCAAAATGATGG + Intronic
1170687771 20:18584907-18584929 AAACGTACCCTTAAACTTGCAGG - Intronic
1173050765 20:39559100-39559122 AAATTTACCCTTCCAAAGGAAGG - Intergenic
1174065422 20:47861193-47861215 AAATGTTCACTTAAAATTGGTGG + Intergenic
1175461930 20:59158321-59158343 AAATGCTCCCGTCACATTGACGG - Intergenic
1176702643 21:10074878-10074900 ACATGTACCCCTGAAATTAAAGG - Intergenic
1176737369 21:10563158-10563180 GAAAGTATCCTTCAAAGTGAAGG + Intronic
1178542294 21:33463599-33463621 AATTGTACACTTTAAATTGGTGG + Intronic
1179393113 21:41011894-41011916 AAATTTACACTACACATTGAAGG - Intergenic
950770046 3:15304035-15304057 AAAGGCACCCTTAAAACTGAGGG + Intronic
951736906 3:25876286-25876308 AAATGTACCTATAAAATTGTGGG + Intergenic
955028644 3:55195163-55195185 AAATGTAGCCTTGAAATGTATGG - Intergenic
955546299 3:60034485-60034507 AGATGTTCCCCTCTAATTGATGG - Intronic
957169653 3:76722063-76722085 AAATGTTTCCTAAAAATTGAAGG + Intronic
957443519 3:80284984-80285006 AAATGTAGCCTGCAAATAAAGGG - Intergenic
957961442 3:87258558-87258580 AATTTTACCCATCTAATTGATGG + Intergenic
958517419 3:95135710-95135732 AAAATTATCCTTCAAAATGAAGG - Intergenic
958774220 3:98462077-98462099 AAATGGACACTTGAAATTGGTGG + Intergenic
960119982 3:113938431-113938453 AAATATTCCCTTTAAATTTATGG - Intronic
962881643 3:139582672-139582694 AAATGTACACTTAATATTTAAGG + Intronic
962898870 3:139739612-139739634 TAATCTACCCTTCAAAATGTAGG - Intergenic
963668369 3:148219352-148219374 AAATGTAACTTTCAAAGTGGGGG - Intergenic
963702074 3:148638977-148638999 AACTGTACACTTTAAATTCATGG + Intergenic
964877642 3:161386776-161386798 AAATGAACCCTTTAAAATGAAGG - Intergenic
965207982 3:165746222-165746244 AAAAGTATCCTTCGAAATGAAGG + Intergenic
965565764 3:170116134-170116156 AAATGTCCCGCTCAAAATGAAGG - Intronic
965965593 3:174485308-174485330 ACATGTACCCCTAAACTTGAAGG - Intronic
967039323 3:185675374-185675396 AACTGTGCCCTTCACAGTGATGG + Exonic
967763223 3:193248943-193248965 AAATGGGCACTTCACATTGAAGG - Intronic
970628761 4:17918813-17918835 AAATGTTTTCTTCAAATTGGGGG - Intronic
970680750 4:18504935-18504957 AAATGTACCATTCAAATAATGGG + Intergenic
971063344 4:22998207-22998229 AAATGTAAACTTAAAATGGATGG - Intergenic
971667589 4:29510525-29510547 AAATGTATCCCTCTAAGTGAAGG + Intergenic
974399867 4:61389540-61389562 AAATTTACACTTTAAACTGAAGG + Intronic
976988407 4:91331083-91331105 AAATGTATCCTTCAAGATAAGGG + Intronic
978178472 4:105763892-105763914 GAAGTGACCCTTCAAATTGATGG - Intronic
979044412 4:115843960-115843982 CCATGTACTCTTGAAATTGAGGG + Intergenic
979649866 4:123115790-123115812 ATATAAACCATTCAAATTGATGG - Intronic
979698588 4:123641114-123641136 AAATTTACCATTCAAAATAAAGG - Intergenic
980516838 4:133875007-133875029 ATATGTACCCCTGAAATTAAAGG - Intergenic
981031524 4:140130250-140130272 ACATGAACCCTTAGAATTGAAGG + Intronic
982118696 4:152118737-152118759 AAATGTAACCTTTAATTTGAAGG - Intergenic
982403393 4:154993673-154993695 AATTGTAACCTCCAAAGTGATGG - Intergenic
983873481 4:172849360-172849382 AAATGTCTCATTCAAAATGAGGG + Intronic
983975924 4:173934388-173934410 ATATGTACTCTTCCAAATGAGGG + Intergenic
984007737 4:174333750-174333772 GAATGTATCCTTCAAATTTTAGG + Intergenic
984480354 4:180292990-180293012 TAATGTACCCTTCCATTGGAGGG - Intergenic
984545849 4:181101506-181101528 AAATGTAGCCTTGAGCTTGATGG + Intergenic
984575208 4:181439862-181439884 AAACGTATCCTTCAAATTTCTGG + Intergenic
985483657 5:136376-136398 AAAAGCAGCCTTCAAAATGAGGG + Intergenic
985906255 5:2839695-2839717 AACTGTACACTTCCAATTAATGG + Intergenic
987778389 5:22398909-22398931 AAACGTACCCTGCACATAGAGGG - Intronic
988694008 5:33601029-33601051 AGATCTACCCTTCATAATGAAGG + Intronic
989441230 5:41474532-41474554 ACCTGTACCGTACAAATTGAAGG - Intronic
989537469 5:42581471-42581493 TAATGCAACCTTCAAATTAATGG - Intronic
990342183 5:54834457-54834479 AAATGGAGCCTCCAAATTGAAGG - Intergenic
990440911 5:55844243-55844265 AAAATTATCCTTCAAAGTGAGGG + Intergenic
990509699 5:56479455-56479477 AAATCTAACCTTCAATGTGATGG - Intronic
991190926 5:63872442-63872464 AAAGGTACACTTGAAATTGGAGG + Intergenic
991308001 5:65201665-65201687 AAATGTATTCTTGGAATTGATGG + Intronic
991361460 5:65825308-65825330 AAATGTACACTTTAGATTTATGG + Exonic
991660744 5:68948535-68948557 ACATGTACCCTTGAACTTAAAGG - Intergenic
992330145 5:75708579-75708601 AAATGTACATTTGAAATTGGGGG - Intronic
994063352 5:95506332-95506354 AACTGTACCATTCAACTTTAGGG + Intronic
996068043 5:119101443-119101465 GAATTTACTCTTTAAATTGATGG - Intronic
996428439 5:123341889-123341911 AAGTTTAGCTTTCAAATTGAAGG - Intergenic
996887427 5:128374234-128374256 AATTGTACACTTTAAAGTGATGG - Intronic
997101338 5:130972406-130972428 TAATGTACACTGCAACTTGAAGG + Intergenic
998437719 5:142127337-142127359 AAATGTTTTCTTAAAATTGAAGG + Intronic
999561265 5:152805900-152805922 AAATGTATCCTTCAGCTAGATGG - Intergenic
1000896853 5:166865687-166865709 AAATGTGCAGTTCAAATTGAAGG + Intergenic
1001065336 5:168530863-168530885 AAATGTCCCCTTGGAACTGATGG + Intergenic
1001100909 5:168813618-168813640 AACTGTACCTTTCCAGTTGAAGG - Intronic
1003005051 6:2373498-2373520 AAATGTCCCCTCCAAAATAAAGG + Intergenic
1003902047 6:10663412-10663434 ATATGTACCCCTGAACTTGAAGG - Intergenic
1004966667 6:20859996-20860018 AAATGTTCCCTTCAAAAAGGTGG - Intronic
1005038532 6:21580103-21580125 AAAAATATCCTTCAAAATGAAGG - Intergenic
1005359903 6:25022039-25022061 AAATGAACCCATCACTTTGATGG + Intronic
1007440263 6:41853492-41853514 AACTGTACTCTTGAAAATGAAGG + Intronic
1010187624 6:73161715-73161737 AAATTTTACCATCAAATTGAAGG - Intronic
1011106947 6:83792610-83792632 CCATATACCCTTCAATTTGATGG - Intergenic
1012160826 6:95883873-95883895 AAATGTACCTTGTAAAATGAGGG - Intergenic
1013897677 6:115110474-115110496 AAAACTTCCCATCAAATTGATGG + Intergenic
1013970434 6:116011701-116011723 GAGTGTGCCCTGCAAATTGAAGG - Intronic
1014558921 6:122866872-122866894 AAATGTTCCCTTCAGATTTTAGG + Intergenic
1015322662 6:131893815-131893837 AAATTTACCATTCAAACTGGGGG - Exonic
1017191327 6:151656456-151656478 AAATGTGCACTTCACAGTGAGGG - Intergenic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1018174492 6:161167160-161167182 AAATGGACTCTTGAAGTTGACGG + Intronic
1022168861 7:27802667-27802689 AAATCTGCCTTTTAAATTGATGG - Intronic
1023647474 7:42333041-42333063 AAAACTATCCTTCAAAATGAAGG + Intergenic
1023679721 7:42673238-42673260 GAATGGGGCCTTCAAATTGAAGG - Intergenic
1024390298 7:48803071-48803093 AATTGTACCTTTTAAATTGGTGG + Intergenic
1026002370 7:66570860-66570882 AAATCTACCATTCAAAAAGACGG + Intergenic
1028894418 7:96024715-96024737 AAATGTACTGTTAAAAATGAAGG + Intronic
1031376709 7:121035415-121035437 AAATTTAAATTTCAAATTGATGG + Intronic
1031841748 7:126750436-126750458 AATTGTACACTTGAAATTGATGG + Intronic
1031906456 7:127465210-127465232 ACATGTACCCTAAAACTTGAAGG + Intergenic
1032778263 7:135138497-135138519 AAATGTATCCTGTAAATTCAAGG + Intronic
1034067965 7:148154948-148154970 AAATGTACATCTCAAATTGCAGG + Intronic
1034147920 7:148888574-148888596 ATATGTCACCTTCAAAATGAGGG - Intergenic
1038172387 8:25148103-25148125 AAATGTAGACTTCAACTAGATGG - Intergenic
1039831333 8:41217465-41217487 AAATATCCCTTCCAAATTGAAGG + Intergenic
1040871299 8:52102117-52102139 AAATGGACACTTGAAATTGTTGG - Intergenic
1042516127 8:69661469-69661491 AAATTTAGCCTTCAGGTTGAGGG + Intergenic
1043090588 8:75897265-75897287 AAATGAAGCCTTCAAAGTGGAGG + Intergenic
1043243539 8:77968305-77968327 AAATGTACCCTCCTAATTCAAGG + Intergenic
1046015198 8:108596710-108596732 AAATGTTATCTTAAAATTGACGG + Intergenic
1046774603 8:118150877-118150899 AAAAATACCTTTCAAAATGAAGG - Intergenic
1047158292 8:122347149-122347171 AACTGTACACTTTAAAATGATGG + Intergenic
1047293145 8:123547464-123547486 AAATTTAACCTACAAATCGACGG - Intergenic
1047317921 8:123751668-123751690 AAATGTTCCTTTCAACTTAATGG - Intergenic
1047323922 8:123818297-123818319 AACTGTAACCCTCAACTTGATGG - Intergenic
1048386643 8:133918425-133918447 AAATGTAGGCTTAAAATAGAAGG - Intergenic
1049878346 8:145042928-145042950 AAATGTACACTGCAAACTCAAGG - Intergenic
1050166444 9:2769643-2769665 AACTCTAGCCTTCAAATTTAAGG - Intronic
1053528147 9:38850110-38850132 ACATGTTCCCTTCAAAGTAATGG - Intergenic
1053639837 9:40061605-40061627 ACATGTACCCCTGAAATTAAAGG - Intergenic
1053766295 9:41403880-41403902 ACATGTACCCCTGAAATTAAAGG + Intergenic
1054200368 9:62074543-62074565 ACATGTTCCCTTCAAAGTAATGG - Intergenic
1054320589 9:63657917-63657939 ACATGTACCCCTGAAATTAAAGG - Intergenic
1054544911 9:66315036-66315058 ACATGTACCCCTGAAATTAAAGG + Intergenic
1054637986 9:67513821-67513843 ACATGTTCCCTTCAAAGTAATGG + Intergenic
1057540896 9:95969004-95969026 AAATGCAGCCTTCAGAGTGAGGG - Intronic
1057583530 9:96308908-96308930 AACTGTACACTTAAAATTGCTGG + Intergenic
1058013947 9:100009042-100009064 AATTGTACACTTAAAAATGATGG - Intronic
1059806473 9:117806346-117806368 AAATGTGCCATTCAGAATGAGGG - Intergenic
1059938384 9:119334294-119334316 TAATGTACCCCTCAATTCGAAGG - Intronic
1202787661 9_KI270719v1_random:44986-45008 ACATGTACCCCTGAAATTAAAGG - Intergenic
1185694702 X:2186327-2186349 AAATGGAACCTTCCATTTGAAGG - Intergenic
1185815963 X:3156334-3156356 AAATCCTCCCTTCAAAGTGATGG + Intergenic
1186876892 X:13826061-13826083 AAATGTACCCTTCTCAATGCTGG - Intronic
1186991899 X:15078836-15078858 AAAAATACCATTCAAATTCAGGG - Intergenic
1187315669 X:18192272-18192294 AAAAGTATCCTTCAAATATAGGG + Intronic
1188533824 X:31172522-31172544 AAAGGAATCCTTCAAATTAAAGG + Intronic
1188857664 X:35217329-35217351 AAAAGTATCCTTCAAAATGATGG - Intergenic
1189570362 X:42288984-42289006 AAAGGTATTCTTCAAAATGATGG - Intergenic
1189666413 X:43359540-43359562 AAACATACCCTTCACATTGATGG + Intergenic
1192783026 X:74313277-74313299 AAAATTACCCTACAAGTTGAAGG - Intergenic
1193443829 X:81575908-81575930 AAATGTATGCTTCAATTTAAAGG + Intergenic
1193701996 X:84774346-84774368 AATTTTACCTTTCACATTGAAGG - Intergenic
1195244201 X:102980905-102980927 AGATGGAACCTTCAAGTTGAAGG + Intergenic
1195744653 X:108104384-108104406 AAAATTAGCCTTCAAAATGAAGG - Intronic
1196393293 X:115232976-115232998 AAAAATACCCTTAAAATTGTTGG + Intronic
1196396805 X:115272482-115272504 AATTGTACACTACAAAATGAAGG - Intergenic
1196993107 X:121349200-121349222 AAATGTAACCTTAAAATTTTTGG - Intergenic
1199055669 X:143291224-143291246 AAATGTAGAGTTCAAATTCAAGG + Intergenic
1199564689 X:149202960-149202982 AAAAGTATTCTTCAAAATGAGGG - Intergenic
1199701491 X:150380387-150380409 AAAAATACTCTTAAAATTGAGGG - Intronic
1200900075 Y:8422188-8422210 AAAAGTATCCTTCAAAATGAAGG + Intergenic
1201271171 Y:12255458-12255480 AAATGTATCTATCAAATTGGTGG - Intergenic