ID: 1080376473

View in Genome Browser
Species Human (GRCh38)
Location 11:31718677-31718699
Sequence GACCTGGACTTCCTCACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080376469_1080376473 7 Left 1080376469 11:31718647-31718669 CCGGAGCACCTGTGTGTAGCCTT 0: 1
1: 0
2: 0
3: 6
4: 159
Right 1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG 0: 1
1: 0
2: 0
3: 19
4: 133
1080376467_1080376473 26 Left 1080376467 11:31718628-31718650 CCTCAACTGGAGCTGTCTTCCGG 0: 1
1: 0
2: 0
3: 2
4: 113
Right 1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG 0: 1
1: 0
2: 0
3: 19
4: 133
1080376470_1080376473 -1 Left 1080376470 11:31718655-31718677 CCTGTGTGTAGCCTTTGCATGTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG 0: 1
1: 0
2: 0
3: 19
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080376473 Original CRISPR GACCTGGACTTCCTCACACA TGG Intronic
900629085 1:3624473-3624495 GACCTGGCGTTCTTCACACACGG - Intergenic
901494890 1:9615243-9615265 GACCTCGTCTTCCTCAGAGAGGG + Intergenic
901772277 1:11536560-11536582 GACCCGGACTTCCTTCCTCAAGG + Exonic
902766612 1:18620631-18620653 AACCCGGCCTTCCTGACACATGG + Intergenic
903124267 1:21237030-21237052 GGACTGGCCTTCCACACACAGGG + Intronic
903475081 1:23613946-23613968 GAGGTAGAGTTCCTCACACAGGG + Intronic
903734573 1:25522100-25522122 GAGCTGGGCTTCCTCAAACTTGG + Intergenic
904346079 1:29870843-29870865 GAGCTGGACCTCCACACACTGGG + Intergenic
904467360 1:30716271-30716293 GACCTGGTCTTCCTCATTGACGG - Exonic
904995520 1:34628422-34628444 AACCTGGACTTCCTCCTATATGG - Intergenic
908526309 1:64990979-64991001 TATCTGGGCTTCCTCACACGTGG - Intergenic
910359706 1:86403458-86403480 GAGCAGGACTTCCTCACATAAGG + Intergenic
911125779 1:94339828-94339850 AACCTGGACTTCCGCGGACAGGG - Intergenic
911797068 1:102089013-102089035 GTCCTGGATTTCTTCACTCAAGG + Intergenic
912171457 1:107105267-107105289 GAGCAGGAATTCATCACACAAGG + Intergenic
912300366 1:108509904-108509926 GAGCAGGACTTCCTCACATAAGG - Intergenic
912385577 1:109269673-109269695 GACCCTGCCTTCCTCACACAGGG + Exonic
914446262 1:147753114-147753136 GAGCTGGACTTCCAGACTCAGGG - Intergenic
915666372 1:157448917-157448939 GACCTGGCCTGCCACACACCTGG + Intergenic
920282639 1:204855644-204855666 GGCCAGGGCTGCCTCACACAAGG + Intronic
922038726 1:221874940-221874962 GAGCTTGAATTCCTAACACAAGG - Intergenic
923465607 1:234245782-234245804 GGCCTGGGCTTCCTCACAGGAGG + Intronic
1065711444 10:28522091-28522113 GAGCAGGACTTCCTCACATAAGG + Intergenic
1066701811 10:38137574-38137596 GACCTGGCCTTCCAAACACCAGG - Intergenic
1067062156 10:43083083-43083105 GGCCTGGCCCTCCTCACCCAGGG + Intronic
1070759011 10:79011700-79011722 TGCCTGGGCTTCCTCACACATGG - Intergenic
1070801958 10:79249055-79249077 GTCCTGGCCTCCCACACACAGGG - Intronic
1070993418 10:80753345-80753367 GACCTGGTCTTCTTCCCACATGG + Intergenic
1071094965 10:81962787-81962809 GAGCTGGTCTTGCTCTCACATGG + Intronic
1071306136 10:84300151-84300173 GACCTGGTCTTCCCCAGTCAGGG - Intergenic
1073311577 10:102546592-102546614 GGTCTGGACTTCCTCACATGAGG - Intronic
1073756427 10:106585801-106585823 GTTCTGGTCTTGCTCACACATGG - Intronic
1074247486 10:111709618-111709640 GTCCTTGACTTGCTCACACACGG + Intergenic
1076761878 10:132610130-132610152 ACCCTGGGCTTCCTCACACCAGG + Intronic
1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG + Intronic
1083738206 11:64693806-64693828 GAGCTGGGCTTCCTCCCATAGGG - Intronic
1087015562 11:93551353-93551375 GACGTGGTCCTCCTCACCCAAGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089381170 11:118033588-118033610 GGCCTGCACTTACTCAAACATGG + Intergenic
1090044048 11:123315439-123315461 GACCTGGAGGCACTCACACAAGG - Intergenic
1094628664 12:32150711-32150733 GACCTGCACAACCTGACACAGGG + Intronic
1096179577 12:49543254-49543276 GACCTGCCCTGCCTCACTCAGGG + Exonic
1097141152 12:56903293-56903315 GACCAGGTCTTCCTCAAACAAGG - Intergenic
1098627071 12:72684625-72684647 GGCCTGGCCTTCCTCATACTTGG + Intergenic
1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG + Intronic
1106620704 13:31367929-31367951 GACCAGGTCCTCCTCAAACAAGG - Intergenic
1114398328 14:22387093-22387115 GAAGTGGGCTTCCTCTCACAAGG + Intergenic
1119512446 14:75222144-75222166 GTCCTGGACTTCCCCAAAAAAGG - Intergenic
1120171402 14:81249925-81249947 GGCCTGGGCTCCCTCACACATGG + Intergenic
1130903229 15:88222946-88222968 GTTCTGGACTGCCTCACACTGGG + Intronic
1132655103 16:1038588-1038610 GACCAGGACATCGTCACGCAGGG - Intergenic
1132681501 16:1144336-1144358 GGCCTGGACCTCATCCCACATGG + Intergenic
1132787241 16:1664366-1664388 ATTCTGGGCTTCCTCACACATGG - Intronic
1132954490 16:2584351-2584373 AATCTGGACTTCCTCAGTCATGG - Intronic
1132959855 16:2615812-2615834 AATCTGGACTTCCTCAGTCATGG + Intergenic
1133155581 16:3872924-3872946 GCCCTGGACTTCTGCACACGGGG + Intronic
1135207530 16:20495343-20495365 GACCAGGTCCTCCTCAAACAAGG - Intergenic
1135211355 16:20528289-20528311 GACCAGGTCCTCCTCAAACAAGG + Intergenic
1137578670 16:49620678-49620700 CCCCTGGACGTCCTCACGCAGGG - Intronic
1138578496 16:57923974-57923996 GACTTGGACTTCCTGACTGATGG - Intronic
1145255551 17:21320274-21320296 GACCTGGACCTGCTCAGCCAGGG + Intergenic
1145321061 17:21767675-21767697 GACCTGGACCTGCTCAGCCAGGG - Intergenic
1148815957 17:50328369-50328391 CACCTGGGCTTCCTCACATAAGG + Intergenic
1149338881 17:55666145-55666167 GATCTGGTCTCACTCACACATGG - Intergenic
1152664823 17:81561662-81561684 GACCTCGACCTCCTGACTCATGG + Intronic
1153428527 18:4991150-4991172 GACCAGGTCCTCCTCAAACAAGG + Intergenic
1155885619 18:31205033-31205055 GCCCTGGCGCTCCTCACACATGG - Intergenic
1156503395 18:37574220-37574242 CACCTGCACATCCTGACACAGGG + Intergenic
1156887370 18:42150972-42150994 GACCTGGACGTCAACACCCAAGG + Intergenic
1157161536 18:45318300-45318322 AACCTGGGCCTCCTCTCACATGG - Intronic
1158162575 18:54502149-54502171 GACTGGGCCTTCCTCACTCATGG - Intergenic
1158202797 18:54959256-54959278 CACCTGGACACCCACACACATGG + Intronic
1158679273 18:59552134-59552156 GGCCTGGACTTCCTCAAATGAGG + Intronic
1162157129 19:8685913-8685935 GACCTGGACACCCTCTCTCAAGG - Intergenic
1163233469 19:16018599-16018621 GACCTGTACCTGCTCACACTGGG - Intergenic
1163790098 19:19301481-19301503 GCCCTAGACTTCATCACAGATGG - Intronic
1165073419 19:33268379-33268401 GACCTGGACTTGCTGAGTCAAGG + Intergenic
1165533303 19:36421902-36421924 GAGCGCGACTTCCTCCCACAAGG + Intergenic
1167042022 19:47028051-47028073 GACCTGCTCTTCCCCATACACGG - Intronic
1167453061 19:49583616-49583638 GACCTGGAGCTGCTCACACCAGG + Exonic
925114899 2:1370107-1370129 CACCTGGGCCTCCTCACACCAGG + Intergenic
925140557 2:1547216-1547238 GTCATGGACTCCCACACACAGGG + Intergenic
925188650 2:1866133-1866155 GGCCTGTACTTCTTCCCACAAGG - Intronic
926125814 2:10271048-10271070 CACCTGGACTTCCAGACGCACGG - Intergenic
927690179 2:25202629-25202651 GACCCGGAATTCCTCAAAGAAGG + Intergenic
927789559 2:25999814-25999836 GACCTGGAGTTGCTCACAGTTGG - Intergenic
933842026 2:86295379-86295401 GACCTCACCTTCCTTACACAGGG - Intronic
937551714 2:123101116-123101138 GACCTGGACTTCGCCACATGAGG - Intergenic
938980239 2:136519461-136519483 CACCTGTAGTTCCTGACACATGG + Intergenic
941498129 2:166232581-166232603 CACTTGGACTTCCTAGCACAGGG + Intronic
942117514 2:172742780-172742802 GACCTGGACTCCCTCAGACTGGG + Intronic
944981992 2:205131914-205131936 GACCTGGAATCCGTCACACCTGG + Intronic
945249098 2:207748374-207748396 GTCATGGAGTTCCTCACAGATGG + Intronic
948453875 2:238095340-238095362 CACCTGGACTTCCACTCTCAGGG - Intronic
948591613 2:239054116-239054138 AGCCAGGACTCCCTCACACAGGG + Intronic
948594687 2:239072408-239072430 AACATGGACCTACTCACACAAGG - Intronic
948841928 2:240655531-240655553 GTCCTGGTCTGCCTCACACAGGG - Intergenic
1171946044 20:31378333-31378355 CACCTGGACTTCCACCCACCTGG + Intronic
1178615903 21:34132549-34132571 GACCTGGAAATCCTAACACTGGG - Intronic
1181009125 22:20029941-20029963 GAGCTGGACTTTCTCAGATATGG + Intronic
1181044632 22:20208722-20208744 CACCCGGACTTCTGCACACAGGG - Intergenic
1181878628 22:25959765-25959787 GCCCTGGACAACCTCACACCCGG - Intronic
1183188909 22:36309030-36309052 GCCCTTGACTTTCCCACACACGG + Intronic
1183363574 22:37395637-37395659 GGCCTTGGCTTCCTCACCCACGG + Intronic
1183551176 22:38486718-38486740 GATCTGGGCTTCCTGACTCAAGG - Intronic
950544877 3:13632320-13632342 GGCCAGGTCTTCCTCACACATGG + Intronic
952867565 3:37864004-37864026 GATCTGGACTTCCTGCCATAGGG + Intronic
956804970 3:72800552-72800574 GTCAAGGACTTCATCACACATGG - Intronic
957618680 3:82567091-82567113 TACCTCAACTTCCTCTCACATGG - Intergenic
957779925 3:84805808-84805830 CAACTGGACTTCATCCCACAGGG - Intergenic
958888813 3:99760265-99760287 GACCAGGAATTCCTCAAAGATGG - Intronic
961650797 3:128415843-128415865 TTCCTGGAGTTCCTCACAGAGGG + Intergenic
962405234 3:135094624-135094646 CAACTGTACTTCCTTACACAGGG - Intronic
966788004 3:183637389-183637411 GACCTAGAATCCCTCAAACAAGG - Intronic
969262858 4:6044497-6044519 GGCCAGCACTTCCTCAAACAAGG + Intronic
970602932 4:17654584-17654606 GCCCTGGACTCCATCACTCATGG - Intronic
971500840 4:27316436-27316458 GACCAGAGGTTCCTCACACAAGG - Intergenic
973770615 4:54203167-54203189 GACGTGTACTTCCTCACTTAAGG + Intronic
979206303 4:118042356-118042378 GACCTATACCACCTCACACATGG + Intronic
985541153 5:488376-488398 GACATGGACCTCCTCAAACACGG + Exonic
985820224 5:2154806-2154828 TCTCTGGACCTCCTCACACAGGG + Intergenic
989236531 5:39154519-39154541 GAGCTAGACTCCCTCTCACAAGG - Intronic
994244790 5:97467234-97467256 GACCAGGCCCTCCTCAAACAAGG + Intergenic
994520525 5:100828591-100828613 GCCCTGGATTTCCTCACTCATGG + Intronic
995856106 5:116594047-116594069 GAGCTGGCCTTCCTCTCACTAGG + Intergenic
998493488 5:142566884-142566906 GACCTGGAGTTCAGCACAAAGGG - Intergenic
1003742642 6:8960647-8960669 GGCCTGGGCTTCCTGCCACACGG + Intergenic
1004384374 6:15159708-15159730 GACCTGGGCTTTCTCAAACATGG + Intergenic
1006020733 6:31116254-31116276 GAGCTGGACTTGCTGCCACAAGG + Exonic
1007570691 6:42888466-42888488 GAGCAGGACTTCCTCACATAAGG - Exonic
1009243046 6:61202770-61202792 GACCAGGTCCTCCTCAAACAAGG + Intergenic
1011748811 6:90434698-90434720 AGCCTGGACCTCTTCACACAGGG + Intergenic
1015085760 6:129289437-129289459 GTCCTGGAGATGCTCACACATGG + Intronic
1017592153 6:155989505-155989527 CACCTGTCCTCCCTCACACATGG + Intergenic
1018991180 6:168675532-168675554 CACCCGGACTTCCTCCCACTCGG + Intergenic
1019170425 6:170130517-170130539 GGCCTGGAGTACCCCACACAGGG - Intergenic
1023861660 7:44220595-44220617 CACCCGGGCTTCCTCACTCACGG + Exonic
1035162660 7:156962458-156962480 AACATGGGCTTCCCCACACACGG - Intronic
1035199100 7:157248633-157248655 CAAATGGACTTCCACACACAAGG - Intronic
1037237802 8:16741151-16741173 GACTTGGCCTTCCTCTCAGAAGG - Intergenic
1037630169 8:20648799-20648821 GACTTGGAGTTCCCCACAGAGGG + Intergenic
1037892466 8:22630508-22630530 GTCCTGGTCTTGCTCACAGAGGG + Exonic
1039581170 8:38667918-38667940 GCCCTGGGTTTCCTCAAACATGG - Intergenic
1041406233 8:57502230-57502252 CACCTTGCCATCCTCACACATGG - Intergenic
1044594057 8:93941349-93941371 AACCGGGTCTTCCTCAAACAAGG + Intergenic
1047020412 8:120769592-120769614 GACCTGGGCTTCCTCCAGCATGG - Intronic
1048186557 8:132247364-132247386 GACTTGGACTTCATCAAACCTGG - Intronic
1058746998 9:108001423-108001445 GTCCAGGACTTCCTCAGGCAGGG + Intergenic
1060098162 9:120812563-120812585 GGCCTGGACTTCCTAACATCTGG + Intergenic
1061332021 9:129900690-129900712 CACGTGGACTTCCTCACATTGGG - Intronic
1189429887 X:40937018-40937040 GAGCAGGACTTCCTCACATAAGG + Intergenic
1193058458 X:77179538-77179560 GTACTGGAATTCCTCACTCATGG + Intergenic
1195282216 X:103347672-103347694 GACCTTCACTCCCTCACAAAGGG + Intergenic