ID: 1080376904

View in Genome Browser
Species Human (GRCh38)
Location 11:31723383-31723405
Sequence GTTTTGTAAGTGAAGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 19, 3: 97, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080376904_1080376906 3 Left 1080376904 11:31723383-31723405 CCCACAAACTTCACTTACAAAAC 0: 1
1: 0
2: 19
3: 97
4: 363
Right 1080376906 11:31723409-31723431 AATTCAATAATGAAATCATTAGG 0: 1
1: 0
2: 16
3: 142
4: 1671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080376904 Original CRISPR GTTTTGTAAGTGAAGTTTGT GGG (reversed) Intronic
900757535 1:4447020-4447042 GTTTTGTAAATAAATTTTGTTGG + Intergenic
903122089 1:21222903-21222925 TTTTTGTAAATGAAGTTTCTTGG - Intronic
903310031 1:22447966-22447988 TTTGTGGAAGTGAAGTTTGCTGG - Intergenic
903736757 1:25534735-25534757 GTTTTGTACATGAAGTCTGATGG - Intergenic
904296931 1:29525762-29525784 GTTTTGTAAGTGAAGTCCAGTGG - Intergenic
905132056 1:35768987-35769009 CTTTTGTAAATAAAGTTTATTGG + Intronic
905751149 1:40465181-40465203 GTTTTTTAAATGCAGTTTATGGG - Intergenic
907487008 1:54785332-54785354 ATTTGGGAACTGAAGTTTGTGGG + Intronic
908708989 1:66993974-66993996 GTTTTGTAAGTGAAAATAATTGG + Intergenic
908721384 1:67129793-67129815 GATTGGTAAGTGAAGGCTGTGGG - Intronic
909002074 1:70230202-70230224 TTTTTGGAAGTGAAGTATTTAGG + Intronic
909272788 1:73645205-73645227 GTTTAGTAAGAAAGGTTTGTAGG + Intergenic
909711267 1:78651983-78652005 GGGTTTTAAGTGAAGTTTATGGG + Intronic
909994266 1:82259880-82259902 GTTTGGGAAGTGAAATCTGTGGG + Intergenic
910054339 1:83012962-83012984 GTTTTGGAAGTGAGGTTGGTGGG - Intergenic
910556122 1:88535081-88535103 GTTTTGTAAGTTTAGTCTGATGG - Intergenic
910845802 1:91603721-91603743 GTCTTGTAAGTGAAGTCTGATGG - Intergenic
911844423 1:102732230-102732252 CTTTTCTAAGTAAATTTTGTGGG + Intergenic
912950284 1:114115988-114116010 GTTTTGAAGGTGAAATTTCTTGG + Intronic
913017089 1:114748969-114748991 GTTATGAAAGGGAAGTTTGCTGG - Intronic
915311529 1:155007973-155007995 GTTGTTTAAGTGAAATTTGGTGG + Intronic
915397392 1:155595820-155595842 GTTTTGTAAGTGGATTTCCTAGG + Intergenic
915413013 1:155717746-155717768 GTTTTGTAAGTGGATTTCCTAGG + Intronic
915647044 1:157279705-157279727 GTCTGATAAGTGAAGTTTGCTGG + Intergenic
917781145 1:178399045-178399067 ATTTTCTAAGTGAAGTTTAATGG + Intronic
918558803 1:185838618-185838640 GTTTTGTAAGTGAAGTTCAATGG - Intronic
919229756 1:194758784-194758806 TTTTTTTAAGTAAAGTTGGTGGG - Intergenic
919762570 1:201107134-201107156 GATTTGTAAGTGAAGTCCATTGG - Intronic
920137104 1:203778834-203778856 GTTTTGTAAATGAAGTCTGTTGG + Intergenic
920391983 1:205611590-205611612 GTAGTGTAAGTGAAGTGTGGAGG - Exonic
921684224 1:218071437-218071459 GTTTTGTAGGTGAAGTCTGATGG + Intergenic
921984327 1:221294575-221294597 GTTTTGCAAATGAAGTCTGATGG - Intergenic
922513358 1:226187410-226187432 GTTATGTGTGTGATGTTTGTGGG - Intergenic
922543307 1:226435225-226435247 CTTTTGTAAGTGAAGTCTAATGG + Intergenic
923057582 1:230438775-230438797 GTTTTGTGAGTGAAGTTGGTGGG + Intergenic
923803744 1:237236100-237236122 AATTTGTAAGTGAGGTTTTTTGG - Intronic
924328242 1:242917277-242917299 GTTTTGTAAGTGCAGTCTGATGG - Intergenic
1063043178 10:2364465-2364487 ATATTGTAATTGAAATTTGTAGG - Intergenic
1063210034 10:3872019-3872041 GGTTTTTAAGTGAAGCCTGTGGG - Intergenic
1064593624 10:16921003-16921025 ATTTTGCAAGGGAAGTTTGAAGG - Intronic
1066660402 10:37734074-37734096 TTTTTGTAAATGAAGTTTATTGG - Intergenic
1066999763 10:42598530-42598552 GATTTGTATGTGAAGTCTGATGG - Intronic
1067205659 10:44209926-44209948 GATTTGTAAGTGAAGTCTGATGG + Intergenic
1067668397 10:48298467-48298489 GTTTTGTGAGTGCAGTCTGATGG - Intergenic
1067723578 10:48749409-48749431 GGTGTGTAAGTGCAGTGTGTGGG - Intronic
1068143894 10:53040848-53040870 TTTTTGATAGTGAAGGTTGTTGG + Intergenic
1068409004 10:56630113-56630135 GTTTTATAATCAAAGTTTGTTGG - Intergenic
1070037097 10:72737017-72737039 GTCTTGTTAGTGAAGCGTGTGGG + Intronic
1070984653 10:80678304-80678326 GTTTATTTAGTGAAGTTTGAAGG + Intergenic
1071405630 10:85328300-85328322 ATCTTTTAAGTGAAGTTTTTAGG + Intergenic
1072125312 10:92440554-92440576 TTTTTGTCAATGAAGTTTTTTGG - Intergenic
1072511931 10:96135845-96135867 GTATTTTAAGTGAATTTTGATGG + Intronic
1073840286 10:107491265-107491287 AATTTGGCAGTGAAGTTTGTGGG + Intergenic
1073993356 10:109288936-109288958 GTTTTATAAGTAAAGTCTGCTGG - Intergenic
1074361175 10:112825124-112825146 GTTTTGTAAGTGAAGTCCAATGG + Intergenic
1074572797 10:114639755-114639777 GTTTTGTAAGTGAAGTCTGATGG + Intronic
1075069648 10:119312475-119312497 TTTTTGTAAATGAAGTTTTATGG + Intronic
1075868698 10:125751314-125751336 GTTTTGTTAGCCAGGTTTGTGGG + Intronic
1077459493 11:2701608-2701630 GTTTTAGAAGTGAAGTCTGAGGG + Intronic
1078192551 11:9103946-9103968 GTTTTGTAACTAAAGTCTGGTGG - Intronic
1078597898 11:12704241-12704263 GTTTGGTATGTGAAATTTGCCGG + Intronic
1078806054 11:14705540-14705562 GTTTTGTATTTTAATTTTGTTGG + Intronic
1079908737 11:26282873-26282895 ATTTTGTGAATGATGTTTGTGGG - Intergenic
1080376904 11:31723383-31723405 GTTTTGTAAGTGAAGTTTGTGGG - Intronic
1080424187 11:32141119-32141141 TTTTTGTAAATAAAGTTTATTGG - Intergenic
1080893367 11:36428291-36428313 GTTTTATAAGTGAAGTCTGAAGG - Intronic
1081105012 11:39056083-39056105 GTTTTGTAAGTGAAGTCAGATGG + Intergenic
1081150590 11:39625528-39625550 GTTTTGTAAATAAAGTTTTATGG + Intergenic
1081197102 11:40174936-40174958 GATTTGTAGTTGAAATTTGTGGG - Intronic
1081490067 11:43560685-43560707 GTTTTGTAAGTGAAGTCTATGGG - Intronic
1081582692 11:44363285-44363307 GTTTTGACAGTGGAATTTGTTGG + Intergenic
1082701955 11:56442890-56442912 GTTTTTTATTTGATGTTTGTAGG - Intergenic
1082832853 11:57632312-57632334 TTTTGGTAAATGAAGTTTATTGG - Intergenic
1083503933 11:63137631-63137653 GTTTTGTATGTGTATTTTGCTGG + Intronic
1085704444 11:78773708-78773730 TTTTTGTAAATCAAGTTAGTTGG - Intronic
1085913863 11:80861475-80861497 GTTTTGGAAGAGAAATTTGATGG + Intergenic
1086051860 11:82601561-82601583 GTTTTTTAAGTGTTGTTTATTGG + Intergenic
1086603751 11:88668350-88668372 AATTTGTTAGTGAAGTTGGTGGG - Intronic
1087458059 11:98412617-98412639 GCTTTGTAAGTAAACTTTGTTGG + Intergenic
1088028598 11:105218364-105218386 GTTTTGTAAGTGAAATCTGATGG + Intergenic
1088735360 11:112723884-112723906 GTTTTGTATGTGAAGTCTGATGG - Intergenic
1092815433 12:12308626-12308648 GTTTTGTCAGTGAAATTTGAAGG - Intergenic
1093078543 12:14782849-14782871 ATTTTGTAAATGAACTTTGAGGG + Intergenic
1093510116 12:19916879-19916901 GTGTTGTAAATGAAATTTGATGG - Intergenic
1093956558 12:25227075-25227097 GTTTTATAAATGAAGTTCTTGGG - Intronic
1094400823 12:30059043-30059065 GAATTGTAAGGGGAGTTTGTAGG - Intergenic
1094439786 12:30462224-30462246 TTTTTGTAAGTGAAGTTTTATGG + Intergenic
1095826472 12:46535107-46535129 GTTTTGTAAGAGACCTTTTTAGG - Intergenic
1096019398 12:48310067-48310089 GTTTTGTAAGTGAAGTCTTATGG - Intergenic
1096418984 12:51439873-51439895 GTTTTGGAAGGAAAGTTAGTTGG + Intronic
1097748080 12:63321318-63321340 GTTTTGTATGTGAAGTCTGAGGG + Intergenic
1098673436 12:73258536-73258558 GTTTTTTATGTGAAGTTTTTAGG - Intergenic
1099861645 12:88230548-88230570 GTGTTAAAAGGGAAGTTTGTTGG - Intergenic
1100484618 12:95013095-95013117 CTTTTGTAGTTGATGTTTGTTGG + Intergenic
1100888475 12:99098926-99098948 GTGTTATAAGTGAAGTCTGAAGG + Intronic
1103442269 12:120972274-120972296 GTTTAGTAAGTGCAGTAGGTAGG - Intergenic
1103851488 12:123936413-123936435 GTTTAGAAAATAAAGTTTGTTGG + Exonic
1103972309 12:124679815-124679837 GTTGTGGAGTTGAAGTTTGTAGG - Intergenic
1104239609 12:126975161-126975183 GTTTTGTAAAACAAGTATGTTGG - Intergenic
1104758234 12:131282019-131282041 GCTTTGTAAGTGAAGTTCAATGG - Intergenic
1105502753 13:20987488-20987510 GTTTTGTAAATTGAGATTGTGGG - Intronic
1105943831 13:25172981-25173003 GTTTTATAAATGACGTATGTTGG + Intergenic
1106832881 13:33603819-33603841 GTTTTTTAAATGGGGTTTGTGGG - Intergenic
1107253828 13:38398555-38398577 GATTTATAAGAGAATTTTGTTGG - Intergenic
1107263055 13:38518642-38518664 GTTTTGTAAGTGAAATATGATGG - Intergenic
1107265214 13:38545802-38545824 GTTTTGTAAGTGAAGTCCAATGG + Intergenic
1107764579 13:43720652-43720674 GTTTTGTAAGTGAAGCCTGATGG + Intronic
1107989837 13:45810091-45810113 GTTGTCTAAGTGACCTTTGTTGG - Intronic
1109161991 13:58986946-58986968 GTTTTACCAGTGCAGTTTGTTGG + Intergenic
1109633304 13:65081310-65081332 AATTTGAAAGTGAAGTTTATGGG - Intergenic
1109743779 13:66592850-66592872 GTTTAGTAAGTGAAATGTTTAGG + Intronic
1110137238 13:72083043-72083065 GTTTTGTAAGAGAAGTCAGATGG + Intergenic
1110782860 13:79486670-79486692 GTTTTGTAAATAAATTTTATTGG + Intronic
1110966907 13:81711600-81711622 GTCTTTTAAGTGAAGTGTTTAGG + Intergenic
1111314647 13:86537529-86537551 GTTTTATATCTGAAGTTTTTGGG + Intergenic
1111590356 13:90339474-90339496 GTTTTTTCAGTAAAGTTTATAGG - Intergenic
1114724702 14:24923272-24923294 GTTTTGTTCATTAAGTTTGTGGG + Intronic
1114953105 14:27781891-27781913 GTTTTGTAAGTGAACTCTGATGG + Intergenic
1115110170 14:29811773-29811795 GTTTTATAAGTGAAGTCTGGTGG - Intronic
1115757990 14:36549023-36549045 GTTATTTAAGTGAATTTTGATGG + Intergenic
1115933358 14:38523143-38523165 GTTGTGTAAGTGATGTTTGATGG - Intergenic
1116844054 14:49848172-49848194 GTTATATTAGTAAAGTTTGTAGG - Intronic
1117937895 14:60927611-60927633 GTTTTGTAAGTAAAGTCTGATGG + Intronic
1118371940 14:65144637-65144659 ACTTTGTAAGTGAAGTCTGTTGG - Intergenic
1120044923 14:79794926-79794948 GTTTTGTAAGTGAAGTTCAGTGG - Intronic
1120666950 14:87317324-87317346 GTTTTGTGAGTGAAATGTGAGGG - Intergenic
1121723523 14:96129389-96129411 TGTTTGTAAGTGAAGTCTGATGG - Intergenic
1122043193 14:99004861-99004883 GTTTTGTAAGTGAAGTTCAATGG - Intergenic
1122250487 14:100435840-100435862 GGCTTGTAAGTGAGGTTTGGGGG + Intronic
1124252627 15:28117012-28117034 GTCTGGAAAGTCAAGTTTGTGGG - Exonic
1124454323 15:29826870-29826892 GTTTTGTAAGTGAAGGTCAATGG + Intronic
1124558525 15:30749254-30749276 TTTTTGTAAATGAAGTTTTATGG - Intronic
1124622017 15:31279192-31279214 GTTTTGTAAGTGAAGTCAATGGG + Intergenic
1124672725 15:31656376-31656398 TTTTTGTAAATGAAGTTTTATGG + Intronic
1124717750 15:32081735-32081757 GTATTCTAAGTTATGTTTGTTGG - Intronic
1125243331 15:37602506-37602528 GTTTTGTTAGTGAAGTTCGATGG + Intergenic
1125517158 15:40327989-40328011 GTTTTGAAAGTGAAGTTTTGGGG + Intergenic
1126318542 15:47396949-47396971 GTTTTGTAAGGGAGGTTTGATGG - Intronic
1126528662 15:49687741-49687763 GTCTAGAAAGTGAAGCTTGTTGG + Intergenic
1127602688 15:60554018-60554040 CTTTTGTAAGTTTATTTTGTGGG + Intronic
1128026094 15:64437965-64437987 GTTTAGGAGGTAAAGTTTGTAGG + Intronic
1128058922 15:64721329-64721351 GTTTTAAAAGTGAAGTTTTTAGG + Intergenic
1130797527 15:87225739-87225761 GATTTGTGAGTGCAGCTTGTAGG - Intergenic
1130970854 15:88731086-88731108 GTTTTATAAATGAAGTCTGATGG + Intergenic
1132306916 15:100822259-100822281 GTTTTTTAAATAAAGTTTGATGG - Intergenic
1133458702 16:5967034-5967056 TTTTTGTAAATTAAGTTTGATGG + Intergenic
1134399407 16:13895269-13895291 TTTTTGTAAATGAAGTTTTATGG - Intergenic
1134480113 16:14611982-14612004 GTTTTGTAAATAAGATTTGTTGG - Intronic
1134896989 16:17897268-17897290 TTTTTATAAGTCTAGTTTGTGGG - Intergenic
1134913771 16:18052003-18052025 GTCTTGTAAATAAAGTTTATTGG + Intergenic
1140946584 16:79774010-79774032 GTTATTTAAGAAAAGTTTGTGGG + Intergenic
1143031322 17:3968942-3968964 GCTTTGTAAGTGAAGCCCGTTGG + Intergenic
1143248609 17:5505536-5505558 GCTTTGTAAGTGAAGTTTGATGG - Intronic
1143254253 17:5544044-5544066 GTTTTGTAGGTGAAGTCTGATGG + Intronic
1143382855 17:6507271-6507293 GTTTTGTGAGTGAAGTCTGACGG - Intronic
1145017356 17:19408015-19408037 GCTTTGTGAGTGAAGTCTGATGG + Intergenic
1153165442 18:2256452-2256474 GTTCTGGAAGTGAAGTGTCTGGG + Intergenic
1153263901 18:3249091-3249113 GTTTTGTAGAAGAAGTTTCTAGG + Intronic
1154008927 18:10559284-10559306 GTTTTGTAAGCTAAGTCTGATGG - Intergenic
1155197694 18:23490265-23490287 GTTTGGGAAATGAAGTTTGTAGG - Intergenic
1155371182 18:25102780-25102802 CTTTTTTAAGTGAAGGTTGGTGG - Intronic
1155448702 18:25941309-25941331 TTTTTGAAAGTGAATTTTGGGGG - Intergenic
1155483750 18:26317921-26317943 TCTTTGTAAGTGAAGTTTTACGG - Intronic
1155790936 18:29970054-29970076 GCTTTGTAAGGGAAGTGTCTGGG + Intergenic
1155861883 18:30911476-30911498 GTATTGTAGGTGAAGTCTGATGG - Intergenic
1156142759 18:34136132-34136154 TTTTTGTCAGGGAAGTATGTTGG - Intronic
1156178637 18:34576976-34576998 GTTTTGGGAGAGAAGTTTTTGGG - Intronic
1156407108 18:36793179-36793201 GTTCTGTAAGTGAAGTCTGATGG + Intronic
1156783173 18:40876970-40876992 TTTTTATAAATAAAGTTTGTTGG + Intergenic
1156966014 18:43093509-43093531 TTTTTGTAACTGGAGGTTGTTGG + Intronic
1157007712 18:43605618-43605640 ATTTTGTAAGGTAAGTTTGGTGG + Intergenic
1157458570 18:47862054-47862076 GTCTTGTAAGTGGAGTGTATGGG + Intronic
1158079433 18:53572336-53572358 TTTTTGTAAGCAAAGTTTTTTGG - Intergenic
1159453855 18:68636873-68636895 GTCTTTTAAGTGGAGTATGTAGG + Intergenic
1159520336 18:69512187-69512209 TTTTTGTAAGAGAAGGTTGGGGG - Intronic
1160321121 18:77896689-77896711 CTTTTCTAAGTGAAGTTTATCGG + Intergenic
1161034055 19:2074272-2074294 TTTTTGTAAATAAAGTTTCTGGG - Intronic
1161557576 19:4952884-4952906 TGTTCGTAAGTGAAGTTTCTGGG + Intronic
1162239713 19:9340294-9340316 GTTTTGAAAGTGTACTTTTTTGG + Intronic
1165043772 19:33087896-33087918 GTTTTGTAATGGAATTTAGTGGG + Intronic
1166119747 19:40678784-40678806 TTTTTGTATGTCAAATTTGTAGG - Intronic
1167099601 19:47396106-47396128 GAATTGTAAGGGGAGTTTGTAGG - Intergenic
925939562 2:8803646-8803668 GTTTTGAAAATGTAGTTTCTAGG - Intronic
926873796 2:17452430-17452452 GTTTTGTAAGTGAAGTCTGATGG - Intergenic
927088566 2:19693380-19693402 GTTTCGTAAGTCAAGTCTGATGG - Intergenic
927192923 2:20529079-20529101 CTTTGCTAAGTGGAGTTTGTAGG - Intergenic
927554058 2:24020285-24020307 ATTTTGTAAGTGAAATCTGATGG - Intronic
928679138 2:33680944-33680966 TTTTTGTAAGTAAAGTCTGATGG - Intergenic
929099721 2:38300081-38300103 TTTTTGTAACTGCAGATTGTAGG - Intronic
929123229 2:38500438-38500460 GTTATGTAAGGGAAGCATGTGGG + Intergenic
929306453 2:40368455-40368477 GTTTTGTATGTAAATTTTATTGG + Intronic
930998538 2:57752618-57752640 TTTTTGTAAATAAAGTTTGTTGG - Intergenic
931075326 2:58704876-58704898 GTTTTTTAAGTGTAGGTTGTAGG - Intergenic
933055491 2:77658010-77658032 GGTCTGTAAGTGAAATGTGTGGG - Intergenic
933117209 2:78489468-78489490 ATTTTGTAAGTGAAGTCTGATGG + Intergenic
933328404 2:80867346-80867368 GTTATATAGGTGCAGTTTGTGGG + Intergenic
934484225 2:94687544-94687566 GTTTTGTAAGTGAACTCTGATGG - Intergenic
935573527 2:104687123-104687145 GTTTTGTAAGTGAAGTCTGATGG + Intergenic
935927205 2:108082526-108082548 GTTTTGTAAATGAGGTATGTGGG + Intergenic
936560056 2:113529947-113529969 CTTTTTTTAGTGAAGTTTGTAGG + Intergenic
936949216 2:117960606-117960628 TTCTTGTAAGTGAAGTCTGAAGG - Intronic
937556002 2:123156750-123156772 AATTTGAAAGTGAAGTTTATTGG - Intergenic
938283370 2:130084354-130084376 TTTTTGTAAGTCAAGTATCTTGG + Intronic
938284471 2:130097983-130098005 TTTTTGTAAGTCAAGTATTTTGG + Intronic
938334002 2:130472914-130472936 TTTTTGTAAGTCAAGTATCTTGG + Intronic
938335109 2:130486549-130486571 TTTTTGTAAGTCAAGTATTTTGG + Intronic
938354716 2:130634120-130634142 TTTTTGTAAGTCAAGTATTTTGG - Intronic
938355818 2:130647753-130647775 TTTTTGTAAGTCAAGTATCTTGG - Intronic
938431136 2:131240908-131240930 TTTTTGTAAGTCAAGTATTTTGG - Intronic
938432239 2:131254537-131254559 TTTTTGTAAGTCAAGTATCTTGG - Intronic
938910347 2:135879693-135879715 TGTCTGTAAGTGAGGTTTGTAGG + Intergenic
939141580 2:138360241-138360263 GTTTTGTAAGTGAAGTCCAATGG + Intergenic
939414836 2:141882297-141882319 GTTTTGCAAGTGAAGTATAGTGG - Intronic
939603490 2:144223184-144223206 GATTTGTAAGTTAGGTTTTTTGG - Intronic
940153503 2:150628811-150628833 GCTTTGTAAGTGAAGTATGATGG - Intergenic
940365378 2:152843341-152843363 TTTTAGTAAGTGAAGTCTGCTGG + Intergenic
940499932 2:154481114-154481136 GTTTTTCAAGGGCAGTTTGTGGG - Intergenic
940753817 2:157659093-157659115 TTTTTGTAAATAAAGTTTATTGG - Intergenic
941420889 2:165281880-165281902 GTTTTGTAAGTGAAAGTCATGGG + Intronic
943165504 2:184319044-184319066 TTTTTGTAAGTGAGATTTGATGG + Intergenic
943600741 2:189918197-189918219 GTTTTGTAAGTTATGTTTAATGG - Intronic
944809342 2:203312437-203312459 GTTTTGTAAGTGAAGTCCAATGG - Intergenic
946804377 2:223455967-223455989 GTTTTGTGAATGAAGTTTTTGGG - Intergenic
946991768 2:225339207-225339229 GTTTTGTAAGTAAGTTTTCTTGG - Intergenic
947295109 2:228622005-228622027 GTTGTGCAAGTGAAGTATCTAGG - Intergenic
947790775 2:232867588-232867610 GTTTTATAAGTAAAGTCTGATGG + Intronic
947971833 2:234331393-234331415 GTTTGGGCAGTGAAGTTTGAAGG + Intergenic
948076924 2:235172293-235172315 GTTTTGTGAGTAAAGTCTGATGG + Intergenic
948295580 2:236857800-236857822 ATTTTGTGAATGAAGTTTTTTGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948515858 2:238503557-238503579 GTTTCGTAAATGAAGTCTGATGG - Intergenic
1169634290 20:7670444-7670466 TTTTTGTAAGTGGGCTTTGTAGG - Intergenic
1169921458 20:10738853-10738875 TTTTTGTAAATGAAGTTTTATGG - Intergenic
1170102973 20:12722481-12722503 GTTTTGCAATTGAGGTTTGGTGG + Intergenic
1170162866 20:13333059-13333081 ATTGTGTAAGTGAAGTCTGATGG - Intergenic
1172050447 20:32113180-32113202 GTTTTGAAAGTTAGGGTTGTGGG + Intronic
1173719537 20:45242530-45242552 ATTCTGTAAGTGAAGTTTGTTGG - Intergenic
1174916504 20:54659603-54659625 GTTTTATAAGTAAAGTCTGATGG + Intergenic
1175065954 20:56288891-56288913 GTTTTGTAAGTGAAGTCTGATGG - Intergenic
1175371079 20:58492608-58492630 CTTTTGTAAGTTAACTTTATAGG + Intronic
1175819798 20:61902667-61902689 TTTTTGTAAATAAAGTTTATTGG - Intronic
1176287706 21:5027473-5027495 GTTTTAAAAGTGAAATTTGAAGG + Intronic
1176288195 21:5030150-5030172 GTTTTAAAAGTGAAATTTGAAGG + Intronic
1177208736 21:18043326-18043348 GGTTTGTAAGTGAAGTCTGTTGG + Intronic
1177295229 21:19165086-19165108 GTGTTGGAAGTGAAGATTGAAGG + Intergenic
1179868986 21:44233325-44233347 GTTTTAAAAGTGAAATTTGAAGG - Intronic
1179869475 21:44236002-44236024 GTTTTAAAAGTGAAATTTGAAGG - Intronic
1183033215 22:35121020-35121042 GTTTTGTCAGTGAAGTAACTGGG + Intergenic
1185249797 22:49794870-49794892 TTTTTGAAAGCGAAGTTTCTAGG - Intronic
949439912 3:4069440-4069462 ATTTTTTAAGTGAAGTCTGCTGG + Intronic
951041412 3:17992597-17992619 GTTTTGTTAATAAAGTTTTTGGG - Intronic
951611898 3:24498848-24498870 GTTTTGTAAATGAAGGCTGATGG - Intergenic
953256693 3:41297411-41297433 GTTTTGCCAGTGCAGTATGTTGG - Intronic
953317682 3:41943802-41943824 ATAATGTAAGTGAAGTTTGAGGG - Intronic
953449894 3:42997239-42997261 GTTTTGTGTGTGAAGTGTCTGGG + Intronic
954894869 3:53966476-53966498 GTTTTGTAAGTGAAGTCCAAGGG - Intergenic
954974470 3:54680082-54680104 CTTTTGTAAGGGAGGATTGTAGG + Intronic
955227193 3:57070407-57070429 GTTTTGTCTGTGCAGTTTGATGG + Intronic
955556360 3:60141764-60141786 GTTTTCTTGCTGAAGTTTGTTGG - Intronic
956086634 3:65618170-65618192 GTTTGGAATATGAAGTTTGTAGG + Intronic
956369645 3:68544720-68544742 GTTTTCTCAGTGAAATTTTTGGG + Exonic
956656379 3:71556771-71556793 ATTTTGTAAGTGAATTTACTAGG - Intronic
956790135 3:72673771-72673793 GTTTTTTAAGTGAAGTCTGATGG - Intergenic
956878629 3:73488794-73488816 GTTTTGTAAGTGAAATTTGATGG + Intronic
957970063 3:87372100-87372122 GTTTTGTATGTGTCCTTTGTTGG - Intergenic
958995862 3:100904343-100904365 GTTTTGCAAGGGAAGTCTGATGG + Intronic
959129626 3:102338416-102338438 GTTTTGTAAGTGAAGTCTGAGGG + Intronic
959209597 3:103360696-103360718 GTTTTGCATGTGACGTTTGGGGG - Intergenic
960086910 3:113601209-113601231 GTTTTGTAAGCCAGCTTTGTAGG - Intronic
960247122 3:115412067-115412089 GTTTTCTAACTGAAATTTATAGG - Intergenic
961507036 3:127376890-127376912 CTTTTGTAAGTGAGGTCTGGAGG - Intergenic
961744172 3:129053104-129053126 ATTTTGTAAGGGAAGTCTGATGG - Intergenic
962604669 3:137023619-137023641 GTTTTGTAAGTGAAGTCCAATGG + Intergenic
962899869 3:139752438-139752460 GCTTTGTGTGTGAAGTTTTTAGG - Intergenic
963969351 3:151412659-151412681 GCTTTGAAATTCAAGTTTGTGGG - Intronic
965413961 3:168368959-168368981 GTTTTGTCATTGAAATTTGGTGG + Intergenic
965599998 3:170445193-170445215 ATTTTTTAAGTGAAGTCTGATGG - Intronic
967696142 3:192533321-192533343 GTTTTGTAATTCAGGTTTTTGGG + Intronic
969096598 4:4737060-4737082 GTTTTGTAAGCGAAGTCTGATGG + Intergenic
969124904 4:4939969-4939991 GTTTTGTGAGTAAAGTCTGATGG - Intergenic
969329618 4:6466277-6466299 GTTTTGTAAGCGAAATCTGATGG - Intronic
971822090 4:31570599-31570621 CTTTTGAAACTAAAGTTTGTGGG + Intergenic
973816004 4:54619653-54619675 GTTTTGTAAGTGAAGTCCAATGG + Intergenic
973850352 4:54955638-54955660 GTTTTGTAAATAAAGTTTATTGG - Intergenic
974022005 4:56699977-56699999 TTTTTGTAAGTAAAGGTTTTGGG - Intergenic
974072153 4:57133878-57133900 TTTTTTCAAGTGAAGTTAGTTGG + Intergenic
974209819 4:58756988-58757010 GTTCTCTAAGTGAAGTTCGTGGG - Intergenic
974249450 4:59364893-59364915 ATTTTGAAAGTGAAATTTGTTGG - Intergenic
975819488 4:78255048-78255070 GTTTTATAGGTGAAGTTTTGAGG - Intronic
976743532 4:88381240-88381262 CTTTTGTCAGTTAAGTTTGCAGG - Intronic
977083563 4:92564884-92564906 GTATCGTCAGTGTAGTTTGTAGG + Intronic
977125284 4:93157897-93157919 GTTTTGTAAGTGAAATCTGATGG - Intronic
978233848 4:106433323-106433345 GTCTTTTAAGAGATGTTTGTTGG - Intergenic
978632915 4:110767582-110767604 CATTTTTAAGTGAAGTTTGATGG - Intergenic
979046062 4:115866728-115866750 CTTTTGTAGGTAAACTTTGTTGG - Intergenic
979900348 4:126208041-126208063 GTTTTGTAAGTGAAGTCCTCTGG + Intergenic
980552259 4:134354659-134354681 GTTTTGTGTGTGAGGGTTGTAGG - Intergenic
980782425 4:137509076-137509098 GTTTTGTCACAGAAGATTGTAGG - Intergenic
980903413 4:138926477-138926499 GTTTTATAAGTGAAGTCTCATGG + Intergenic
981274059 4:142876984-142877006 GTTTATTAAGTGATCTTTGTTGG - Intergenic
981796119 4:148597447-148597469 GTCTTGTAAGTCAGGTTTGGTGG + Intergenic
982465653 4:155727397-155727419 GTCTGGTAAGTGCTGTTTGTGGG - Intronic
982720540 4:158855231-158855253 GTGCTGTAAGTGAAGTTTAATGG - Intronic
982872562 4:160601619-160601641 GATTTGTTTATGAAGTTTGTTGG + Intergenic
983306353 4:165994143-165994165 GTTCTGTGAGTGAATTTTGTTGG - Intronic
983576689 4:169269098-169269120 GTTTTGCAAGCGATGTTTGCTGG - Exonic
983805000 4:171983697-171983719 GTTTTGTAAGTTAAGTCATTGGG + Intronic
984447766 4:179858536-179858558 ATTTTGTAAGTGAAGTCTAATGG - Intergenic
986767817 5:10943715-10943737 GAATTGAAAGTGAAGTTTGTAGG - Intergenic
986841832 5:11706414-11706436 TTTTTGAAAGTCAAGTTTATTGG + Intronic
987091921 5:14515723-14515745 GTTTTCTAAATTAAGTTTGATGG - Intronic
987299154 5:16581289-16581311 GTTTTGTAAGTGAAGTGTGATGG - Intronic
987586580 5:19863862-19863884 GTTTTATAAGTGAAGTCAGATGG - Intronic
987702452 5:21418765-21418787 GTTGTGTCAGTGTAGTTTGAAGG + Intergenic
988861083 5:35280100-35280122 GTTTTTTTAGTGAAATTTTTAGG - Intergenic
989010788 5:36870061-36870083 GTTTTGTGAGAGATGTTTGGAGG - Intergenic
990105756 5:52257824-52257846 GTTTTGTAAGTGAAATTCAATGG - Intergenic
990197676 5:53336895-53336917 GTCTTGTAAGTAAAGTCTGATGG - Intergenic
990782451 5:59380881-59380903 ATTTTGTAAATAAAGTTTATTGG + Intronic
991274312 5:64825734-64825756 GTTTTGTAAGTCAGCTTGGTGGG + Intronic
992492112 5:77255466-77255488 GTTTTGTAAGTGAAGTCTGATGG + Intronic
993268850 5:85766687-85766709 GTTTTTTTGGTGAAGTTTTTAGG + Intergenic
993415024 5:87616941-87616963 GTTTTTTAGGTGAAATTTCTGGG + Intergenic
995517794 5:112971541-112971563 GTTTTGTAAGTAAAATTGGAGGG - Intergenic
995521450 5:113010383-113010405 GTTTTATAAATAAAGTATGTTGG + Intronic
996145279 5:119967257-119967279 GTTTTGTAAGTGAATTCTGATGG + Intergenic
996299065 5:121960246-121960268 GTTTTGTAAGTGAAGTCTAGTGG + Intergenic
996860600 5:128061520-128061542 CCTTTGTAAGTAATGTTTGTTGG - Intergenic
998729179 5:145054320-145054342 GTCTTGTAAGTGAAGTCTGGTGG - Intergenic
999722711 5:154410846-154410868 GTTTTGTAAGTGAAATCTGATGG - Intronic
1000022119 5:157327216-157327238 GTTATGTAAGCAAAGTTTGAAGG + Intronic
1000500314 5:162040193-162040215 CTTTAGTTAATGAAGTTTGTTGG + Intergenic
1001540509 5:172534546-172534568 GTTTCGTAAGTGAAGTCTGATGG + Intergenic
1001795811 5:174501553-174501575 ATTTTGTAAGTGAAGTCTGATGG - Intergenic
1002430246 5:179199227-179199249 GTTTTGTAAGTGAAGGCTCCTGG + Intronic
1002531671 5:179850366-179850388 GTTTTTTAAGTGAAGTGTGCTGG + Intronic
1003770868 6:9298327-9298349 GTTTGGTCAGTTATGTTTGTAGG - Intergenic
1004093045 6:12524874-12524896 GTTTTGTAAGAGAAGTCTGAAGG - Intergenic
1004855255 6:19743274-19743296 GTTTTATAAGTGAAGTTTGATGG - Intergenic
1005027186 6:21474463-21474485 GTTTTGTAAGTGAAGTCTGATGG + Intergenic
1005266866 6:24121311-24121333 ATTTTGTAAATGAAGTCTGATGG - Intergenic
1005493026 6:26364163-26364185 GGTTTGTAGGTGAAAGTTGTGGG - Intergenic
1007556773 6:42772844-42772866 ATTTTGGAAGTGAGTTTTGTAGG + Intronic
1008147053 6:47904366-47904388 GTTTTGGAAATAAATTTTGTTGG + Intronic
1008650336 6:53554891-53554913 GTATTGTAAGATAAGTTTTTAGG - Intronic
1008948636 6:57129510-57129532 CTTTTGTAATTAAACTTTGTTGG - Intronic
1009053544 6:58307921-58307943 GTTTTGCAAGTGAAGTCTGGTGG + Intergenic
1009237572 6:61142627-61142649 GTTTTGCAAGTGAAGTCTGGTGG - Intergenic
1009751946 6:67886431-67886453 GAGTTGTAAGGGAAGTTGGTAGG + Intergenic
1010329358 6:74604749-74604771 TTTTTGTAAATAAAGTTTTTTGG + Intergenic
1010754663 6:79653633-79653655 GTTTTCATAGTGAAGTTAGTGGG + Intronic
1010816826 6:80367887-80367909 GTTTTGTAAGCAAAGTTGGATGG - Intergenic
1010859166 6:80884526-80884548 TTTTTGTAAAGGAAGTTTATTGG + Intergenic
1010955677 6:82088230-82088252 GTTTTATAAGTGATGTCTGATGG - Intergenic
1011581534 6:88872184-88872206 GTTTTGTCAGTTTAATTTGTAGG + Intronic
1012103105 6:95116635-95116657 GTTTTATAAATTAAGTTTGAGGG - Intergenic
1012949994 6:105507499-105507521 TTTTTGTAAATAAAGTTTATTGG - Intergenic
1013894362 6:115067793-115067815 GTCTTGTAACTAGAGTTTGTGGG + Intergenic
1014896449 6:126905884-126905906 GTTTTGTGAGTGAGGTTTGCTGG + Intergenic
1014909591 6:127075116-127075138 GATTTGTAACTGAAGTTTGTTGG - Intergenic
1015487271 6:133787188-133787210 GTTTTGTAAGTGAAGTCTGATGG + Intergenic
1016263236 6:142199856-142199878 GTTTTGGAAGTAAAATTTCTTGG + Intronic
1016660717 6:146575930-146575952 CTTTTGTATTTGAAGTTTTTAGG + Intergenic
1017132765 6:151122211-151122233 GCTTGGTCAGTGAAGTTTGGTGG - Intergenic
1017473486 6:154763808-154763830 GTTTTGTAAGTAAGTTCTGTTGG + Intronic
1017551420 6:155512507-155512529 TTTTTATAAGTGAATTTTTTTGG + Intergenic
1017888343 6:158619568-158619590 TTTTTGTAAGAGAAGGATGTTGG + Intronic
1018003115 6:159597021-159597043 ATTTTGTAAGTGAAGTCCGATGG - Intergenic
1018045946 6:159966510-159966532 GTTTTGTAAATAAAGTTTTGTGG - Intergenic
1020894514 7:13923230-13923252 GGTTTGAAAGTGAAACTTGTAGG - Intronic
1022466124 7:30654181-30654203 GTTTGGTAATTGAATTTTTTTGG + Intronic
1022641922 7:32195144-32195166 GTTTTCTAAGTTATGTTTGATGG - Intronic
1022773787 7:33503153-33503175 GTTTTGTAAGTAAAATTGATAGG - Intronic
1024607014 7:51029837-51029859 GTTTTTTAAGTGAAGGATGTTGG - Intronic
1024625006 7:51199435-51199457 GTTTTGTTAGTTAACTTTGGTGG - Intronic
1024937831 7:54729613-54729635 GTTTTGTAAATAAAGTTTATTGG - Intergenic
1027337302 7:77165356-77165378 GTTTTGTAAATAAAGTCTGTTGG + Intronic
1028009850 7:85628053-85628075 GTTTTCTAAGTGAAGCCTGATGG + Intergenic
1028132353 7:87190685-87190707 TTTTTGTAAATAAAGTTTATTGG - Intronic
1029157231 7:98525999-98526021 GTCTTGTAAGTGAAGTCTGATGG + Intergenic
1029500345 7:100925222-100925244 GAATTGTAAGGGAAGTTTATAGG - Intergenic
1029778495 7:102705764-102705786 GTTTTGTAAATAAAGTCTGTTGG - Intergenic
1029978086 7:104852748-104852770 GTTTTGTAAGTGAACTCTGATGG + Intronic
1030505874 7:110421529-110421551 GTTCTGTAAGATAAGTTTGATGG - Intergenic
1030929617 7:115505959-115505981 GTTTTGTTGGTGAAGCTTCTTGG - Intergenic
1031274323 7:119699117-119699139 GTTTTGGAGGTGAATATTGTTGG - Intergenic
1031314953 7:120244922-120244944 GTTTTGTAAGTGAAATATGATGG - Intergenic
1031658972 7:124396849-124396871 GTTTTAAAAGTGAAATGTGTTGG + Intergenic
1031730205 7:125290823-125290845 TTTTTGTAAATAAAGTTTGTTGG + Intergenic
1031913922 7:127544926-127544948 GTTTTGTAAGTGAAGTCTGAGGG - Intergenic
1033930992 7:146521292-146521314 GTTTAGTAAGTAAAGTTTTATGG - Intronic
1036228020 8:6976431-6976453 GTTTAGTAAGTGAAGTGTACAGG + Intergenic
1036230473 8:6995548-6995570 GTTTAGTAAGTGAAGTGTACAGG + Intergenic
1037196470 8:16196861-16196883 TTTTTGAAAGGGAAGTTTGTAGG + Intronic
1037914478 8:22764613-22764635 GTTTGGTAAGTGAAGTATCATGG + Intronic
1038297344 8:26306506-26306528 CTTTTGTAAATGCAGTTTATTGG - Intronic
1038766475 8:30433105-30433127 GTGTTGTTAGTCAAGTTTGGGGG - Intronic
1040407486 8:47120366-47120388 TTTTTGTAAATAAAGTATGTTGG + Intergenic
1040498720 8:47989305-47989327 GTCTGATAAGTGAAGTCTGTTGG + Intergenic
1040847996 8:51865309-51865331 GCCTCGTAAGTGGAGTTTGTAGG - Intronic
1041166283 8:55095860-55095882 GTTTTGTAAGTGAAGTGCAATGG - Intergenic
1041522741 8:58772896-58772918 GTTTTGTAAGTGAAATCTTATGG - Intergenic
1042367790 8:67956457-67956479 GTTTTGCAAATGAAGTCTGATGG + Intronic
1042485760 8:69343899-69343921 GTTCTGTATGTGAAGTCTGATGG - Intergenic
1044475410 8:92619355-92619377 ATTTTGTAAATGAAGTCTGCTGG - Intergenic
1044976701 8:97672150-97672172 GTTTTGTAAATAAAGTTTTATGG + Intronic
1045325472 8:101114560-101114582 GTTTTGTAGGTGAAATCTGGGGG + Intergenic
1045351976 8:101349717-101349739 GTTTTGTAAGTAAAGTCTGATGG + Intergenic
1045714626 8:105026685-105026707 GTTTTGTAAGTGAAGTCCTATGG - Intronic
1046112413 8:109741233-109741255 GTTTTGAAAATGAAGTATATTGG + Intergenic
1046113796 8:109760679-109760701 GTTTTTTTGGTGAAGTTTTTAGG + Intergenic
1046639432 8:116710529-116710551 TTTTAGAAAGTTAAGTTTGTGGG - Intronic
1046654925 8:116883062-116883084 CATTTGGAAGTGAAGTTTATAGG - Intergenic
1046887787 8:119386996-119387018 GTTTTGTAAATGCTGTTTGTAGG + Intergenic
1047334146 8:123920005-123920027 GTTTTGTAAGAGAAGTATGATGG - Intronic
1047432752 8:124806926-124806948 GTTTTGATAGTGAAGTTTGAGGG + Intergenic
1047643571 8:126846380-126846402 TTTTTGTAAGTAAAGTTTTATGG + Intergenic
1047784439 8:128140035-128140057 GTTTTGTAAGTAAAGTCTGATGG + Intergenic
1047876745 8:129146849-129146871 CTTTTGAAAGTAAAGTTTGTAGG + Intergenic
1047935489 8:129773370-129773392 ATTTTTTAAATGAAGTTTTTAGG - Intronic
1048339614 8:133528604-133528626 TTTTTGTAAATGAAGTTTTGTGG + Intronic
1048441233 8:134460573-134460595 GTTTTGTGTGTGGTGTTTGTGGG + Intergenic
1048663971 8:136640402-136640424 GTTTTGTAAATAAAGTTTACAGG + Intergenic
1048745690 8:137612471-137612493 GTTTTGTAAGTTTTGTTTGAGGG - Intergenic
1049159002 8:141085420-141085442 GTTTTGTAAGTGAAGTTCAATGG - Intergenic
1049892810 9:86420-86442 CTTTTTTCAGTGAAGTTTGTAGG - Intergenic
1050123295 9:2330544-2330566 GTTTTGTAAGTGAAGCCTGATGG + Intergenic
1051866637 9:21690865-21690887 TTTTTGTAAGTGAAGTTAGATGG - Intergenic
1052015875 9:23465588-23465610 GTTTTGAAAGATAATTTTGTTGG - Intergenic
1052240362 9:26264923-26264945 CTTTTATAAATGAACTTTGTGGG - Intergenic
1052630689 9:31034962-31034984 GTCTTCTATGTGAAGTTTCTAGG + Intergenic
1053673567 9:40396850-40396872 GTTTTGTAAGTGAACTCTGATGG + Intergenic
1053734036 9:41086480-41086502 CTTTTTTTAGTGAAGTTTGTAGG - Intergenic
1053923370 9:43023208-43023230 GTTTTGTAAGTGAACTCTGATGG + Intergenic
1054384668 9:64536915-64536937 GTTTTGTAAGTGAACTCTGATGG + Intergenic
1054511062 9:65979439-65979461 GTTTTGTAAGTGAACTCTGATGG - Intergenic
1054694369 9:68345073-68345095 CTTTTTTTAGTGAAGTTTGTAGG + Intronic
1055146047 9:72936255-72936277 CTTTTCTTAGTGAAGTTTGTGGG - Intronic
1055229515 9:74044832-74044854 GTTTTGAAAGTAAAGTATCTCGG - Intergenic
1055363674 9:75522141-75522163 GTTTTGTGAATGAAGTCTGGTGG + Intergenic
1055575626 9:77657938-77657960 GTGTTGAAAATGAAGTTTTTGGG - Intergenic
1056467472 9:86871862-86871884 ATTTTGTAAGTAAAGTCTGATGG - Intergenic
1056936951 9:90922583-90922605 GTTTTGTAAGTGAAGTCCGACGG - Intergenic
1057277688 9:93684690-93684712 GTTTGGTAAATGCAGTTTGCAGG - Intergenic
1058079564 9:100687740-100687762 TTTTTGTAAATGAAGTTTAACGG + Intergenic
1059000759 9:110346512-110346534 GTTTTGTAAATAAAGTTTTATGG - Intergenic
1059763664 9:117362925-117362947 GTTATATAAGTGAAATTTCTAGG - Intronic
1059910801 9:119041674-119041696 TTTTTGGAAGTGAAGTGTGATGG - Intergenic
1061583204 9:131550133-131550155 GAATTGTAAGGGGAGTTTGTAGG - Intergenic
1186310255 X:8309988-8310010 GTTTTGTAAATAAAGTTTATTGG - Intergenic
1186359006 X:8819644-8819666 GTTTTTTAAGTGAACTATATGGG - Intergenic
1186381738 X:9067883-9067905 CTTTTGTAAATGAAGTTTGACGG + Intronic
1186546413 X:10454508-10454530 GTTTTGTAAATAAAGTTTTATGG - Intronic
1186901863 X:14065807-14065829 GTTTTGTAAGCGAAGGTGGGGGG + Intergenic
1187200127 X:17126722-17126744 TTTTTGTAAATAAAGTTTATTGG + Intronic
1187327214 X:18301941-18301963 GTTTTCTAAGTTATGTTTGATGG + Intronic
1187428754 X:19203046-19203068 GTTTTGTAAGTGAAGCCCGATGG + Intergenic
1187971605 X:24664444-24664466 GTTTGGTAAGTGAAACTTGAAGG - Intronic
1188395136 X:29673506-29673528 GTTTTTTAATTTGAGTTTGTTGG - Intronic
1188832667 X:34919298-34919320 GTATTCTAAGTGAAAGTTGTTGG - Intergenic
1189274341 X:39774270-39774292 GCTTTGTAAGTGAAGTCTGATGG + Intergenic
1189956251 X:46277721-46277743 ATCTTGTAAGTGAAGTCTGATGG + Intergenic
1190406937 X:50097684-50097706 GTTTTGAATGTGGACTTTGTGGG + Exonic
1190412863 X:50154191-50154213 GTTTTTCAAGGGTAGTTTGTGGG + Intergenic
1192015701 X:67327612-67327634 ATTTTTTAAGTGAAGCATGTAGG - Intergenic
1192365974 X:70473494-70473516 GTTTTGTAATTGTAATTTCTAGG + Intronic
1193526278 X:82593474-82593496 ATTCTGTTAGTGAATTTTGTTGG + Intergenic
1193731839 X:85111697-85111719 GTTTAGGTAGTGAGGTTTGTAGG + Intergenic
1194219378 X:91172195-91172217 GTTTTCTTAGTGGAGTTTGCAGG + Intergenic
1195584252 X:106545864-106545886 GCTTTGTAAGTAAATTTTCTTGG - Intergenic
1195825486 X:108995411-108995433 GTTTTGTAAGTGTAGTCAGATGG + Intergenic
1196247830 X:113421643-113421665 GTGATGTAAGTTAAGTGTGTGGG + Intergenic
1196774287 X:119324098-119324120 ATTTTGTAAGTGATGTTTATTGG + Intergenic
1198664926 X:139009830-139009852 GTTTTTTAAGTGGAGTATTTAGG - Intronic
1199757397 X:150878024-150878046 GTTCTCTAAGTGAGGATTGTTGG - Intronic
1200555890 Y:4635958-4635980 GTTTTCTTAGTGGAGTTTGCAGG + Intergenic
1200680800 Y:6208355-6208377 ACTTTGTAAGGGAACTTTGTAGG - Intergenic
1201225630 Y:11816235-11816257 GTTTTGTAAGTGCAGTCTGATGG - Intergenic
1201317950 Y:12666611-12666633 TTTTTATAAGTGAAGTTGCTAGG + Intergenic
1201625566 Y:16011332-16011354 TTTTTGTAAATGAAGTTTTATGG + Intergenic