ID: 1080381240

View in Genome Browser
Species Human (GRCh38)
Location 11:31774294-31774316
Sequence ACCTCAGAGAAAAAAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080381240_1080381248 30 Left 1080381240 11:31774294-31774316 CCTTAATCTTTTTTCTCTGAGGT 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1080381248 11:31774347-31774369 AAGGTATTTAACGAAGGCTTAGG 0: 1
1: 0
2: 0
3: 4
4: 123
1080381240_1080381247 24 Left 1080381240 11:31774294-31774316 CCTTAATCTTTTTTCTCTGAGGT 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1080381247 11:31774341-31774363 TTAACGAAGGTATTTAACGAAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1080381240_1080381244 11 Left 1080381240 11:31774294-31774316 CCTTAATCTTTTTTCTCTGAGGT 0: 1
1: 0
2: 4
3: 44
4: 419
Right 1080381244 11:31774328-31774350 TCTGACCAGCCACTTAACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080381240 Original CRISPR ACCTCAGAGAAAAAAGATTA AGG (reversed) Intronic
901108874 1:6779503-6779525 ACCCCAATGAAAAAAGATAATGG + Intergenic
901565407 1:10110069-10110091 ACTTCAGAGTAAAAAAATTCTGG - Intronic
901858744 1:12060886-12060908 ACCTCAGTGAAGAAAAACTAAGG - Intergenic
902118827 1:14144242-14144264 AACGCAGAGCAAAAAGATGAAGG - Intergenic
903606329 1:24577661-24577683 ACTTCTGAGAAAAAAAATTGGGG - Intronic
903672402 1:25044517-25044539 GTCTCAGAAAAAAAAAATTAGGG - Intergenic
903673246 1:25048666-25048688 ACATCAGAGAAAAATGTATATGG - Intergenic
904107737 1:28099899-28099921 ATCTCAAAAAAAAAAAATTATGG + Intergenic
904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG + Intergenic
904853379 1:33476327-33476349 TCCTTAGAAAAAAAAGGTTATGG + Intronic
905353301 1:37362675-37362697 AGCCCAGAGAAAAAGGATTCTGG + Intergenic
905513608 1:38544182-38544204 ACATCAGAGAAAAAAGAAATAGG + Intergenic
905683969 1:39895836-39895858 ACCTCAGAAAGAAACCATTATGG + Exonic
905843073 1:41202008-41202030 ACTTCAGAGACCAAAGTTTATGG + Intronic
906017914 1:42598938-42598960 TTCTCAGACAAAAAAAATTAAGG + Intronic
906230257 1:44156572-44156594 AGCTCAGAGAAAAAGGAATTGGG + Intergenic
906391731 1:45423055-45423077 ACCTTAGAAAAAAAAAATGAGGG + Intronic
906975727 1:50570435-50570457 AGCTGAGAGAAAAAAGACTCTGG + Intronic
907098572 1:51805576-51805598 ACCATAGATAAAAAAGGTTAGGG + Intronic
907643111 1:56212476-56212498 ATCTCAGGGCAAAAAGATCAAGG + Intergenic
908176141 1:61556901-61556923 ACCTAAGGGAAAAAAAATTAAGG + Intergenic
908302331 1:62774406-62774428 AGCTAAGAGAAAAAAGCTAAGGG - Intergenic
909149367 1:71981596-71981618 ACAACAGAGGAGAAAGATTATGG + Intronic
909332234 1:74427393-74427415 ACCTTAGAGAATAAAGAAGATGG - Intronic
909355739 1:74707943-74707965 AATACAGAGAAAAAAGGTTAAGG + Intronic
909492414 1:76239891-76239913 AATTCAGAAGAAAAAGATTAAGG - Intronic
909618323 1:77638095-77638117 AATTCAGAGAAAAAAGAGTGTGG + Intronic
910096123 1:83524164-83524186 ACTTGAGAGAAAAAAGATATAGG + Intergenic
910454417 1:87381689-87381711 ACACCAGGGATAAAAGATTAAGG - Intergenic
910467085 1:87511375-87511397 ACCTCAGATAAAAAATATTTGGG - Intergenic
910560826 1:88588928-88588950 ACATCAGACAAAATAGATTTTGG + Intergenic
910672610 1:89788254-89788276 ACCTCAGATCAAAAATATTTGGG - Intronic
910859677 1:91731450-91731472 CCCTCAGAGAGAAAAGCTCAAGG + Intronic
911062079 1:93757337-93757359 ACATCAGAGAAAAGAGAAAATGG - Intronic
911207060 1:95102486-95102508 AACTCAGAGAAAGAAGAGTATGG + Intergenic
911997254 1:104781881-104781903 ACATGAGAGAAAAAAGAGGATGG - Intergenic
912016132 1:105039059-105039081 ATCTCAGGGAAGAAAAATTAAGG - Intergenic
912077761 1:105898104-105898126 AACTTAGACAAAAAAGATAAAGG - Intergenic
913272904 1:117111629-117111651 AGCTCAGAGAAAAATGAAAAAGG + Exonic
916640538 1:166724261-166724283 ATCTGATAGAGAAAAGATTAAGG + Intergenic
916843652 1:168626321-168626343 ACATCAGAGGAAAAGGATAAGGG + Intergenic
916998781 1:170331953-170331975 ATCTCAGAAAGAAAAAATTATGG - Intergenic
917569797 1:176253093-176253115 ATCCCAGAAAAAAAAGACTAAGG - Intergenic
917595882 1:176528726-176528748 ACCTGAGAGAAGATAGGTTAGGG - Intronic
919012116 1:191978280-191978302 ACCTCAGAGAAGGAAAAATAGGG - Intergenic
919184249 1:194123603-194123625 ACCACATACAAAAAAGATAAAGG - Intergenic
919960542 1:202463299-202463321 ACATCAGACCCAAAAGATTAGGG + Intronic
921460807 1:215424230-215424252 CCCTCAGAGGAAAAAGAGGAGGG + Intergenic
921751786 1:218802822-218802844 ACATGAAAGAAAAAATATTATGG - Intergenic
921830922 1:219726491-219726513 ACCCCAGAGAAAAACAATTTGGG - Intronic
923620464 1:235575123-235575145 ACATCAAAGAAAAGAGATTGTGG - Intronic
923680654 1:236115728-236115750 ATCTCAGAGAAAAAAAAAAAAGG + Intergenic
924095211 1:240543958-240543980 ACCTCAGATCAAAAATATTAAGG + Intronic
1062980130 10:1715113-1715135 ACCACAGAGAGAAAAGAATTAGG - Intronic
1063292195 10:4761019-4761041 ACCTCAGGCATAAAAGATTAAGG - Intergenic
1063400247 10:5736756-5736778 ACCAAAGGGAAAAAAAATTAAGG - Intronic
1063575434 10:7257936-7257958 ACCTCAATGAAAAAAGAATTTGG - Intronic
1064810629 10:19193955-19193977 CCCCCAGAGAAAAAATAGTAGGG + Intronic
1066757180 10:38722810-38722832 ATCTCAAAAAAAAAAAATTATGG + Intergenic
1067036558 10:42925081-42925103 ACCACAAAGAAAAAACAATAAGG - Intergenic
1068482871 10:57616720-57616742 ACCTGAAAGAAACAAGATTTAGG - Intergenic
1070537025 10:77386873-77386895 AGCTAAGAGAAAGAACATTAAGG + Intronic
1071093363 10:81946017-81946039 GCCTCAGAAAAAGAAGATCAAGG - Intronic
1071234657 10:83631514-83631536 ATCTCAGAAAAAAAAGAGTAAGG - Intergenic
1072170676 10:92858405-92858427 ACAGGAGAGAAAAAAGAATAAGG - Intronic
1072261663 10:93681479-93681501 GCCTCCAAGAAAAAAGATAAAGG - Exonic
1072412707 10:95218501-95218523 AACTCAGAGAAAAAAGCAGATGG - Intronic
1072441852 10:95463999-95464021 GCCTCTAAGAAAAAAGATGAAGG - Intronic
1073162528 10:101411492-101411514 CACTAAGAGAAAAAAGACTAAGG - Intronic
1073877496 10:107941904-107941926 ACCAGAAAGAAAAAAGAGTAGGG - Intergenic
1074118758 10:110477642-110477664 AATTTAGAGAAAAAAAATTATGG + Intergenic
1075185235 10:120250293-120250315 AAAGAAGAGAAAAAAGATTAGGG - Intergenic
1075746439 10:124731434-124731456 GCCTGAGAGAAGAAAGAGTAGGG - Intronic
1076177768 10:128381641-128381663 ACCTGAGATAAAAAATATTCAGG - Intergenic
1076588412 10:131566931-131566953 ACCTCAGATTAAAAAGAAAATGG + Intergenic
1077255926 11:1583039-1583061 ATCTCAGAAAAAAAAAATTGTGG + Intergenic
1077906155 11:6535130-6535152 AACTCAGAGAAAAAGAATAAAGG - Intronic
1078490372 11:11762632-11762654 ACATCAGAGAAAGAAGCTAAAGG + Intergenic
1079582138 11:22078988-22079010 ACCTCAGACAAACAAGATCATGG - Intergenic
1079948011 11:26767504-26767526 AACTCACATAAAAAAGATTTTGG - Intergenic
1080381240 11:31774294-31774316 ACCTCAGAGAAAAAAGATTAAGG - Intronic
1080513591 11:32999796-32999818 CTCTCAGTGAAAAGAGATTAGGG - Intergenic
1082697616 11:56388846-56388868 ATCTCAGGAAATAAAGATTAGGG + Intergenic
1082874306 11:57972499-57972521 AACACAGAGAAAAGAGATAAAGG - Intergenic
1083206701 11:61154523-61154545 ACCACAGAGAGAAAAGAAAAAGG + Intronic
1085069029 11:73524969-73524991 ACCTTAGTGAAACAAGAATAAGG - Intronic
1086469493 11:87092772-87092794 ACCACAGAGAACAAAGATAAAGG - Intronic
1086529406 11:87766213-87766235 TAATCAGAGAACAAAGATTATGG + Intergenic
1087244379 11:95817065-95817087 ACTTCAAAAAAAAAAGTTTAGGG + Intronic
1087924375 11:103902422-103902444 ATCTCTCAGAAAAGAGATTAGGG + Intergenic
1088783637 11:113161150-113161172 ACCTAGGAGAAAAGAGAGTAGGG + Intronic
1089050910 11:115545079-115545101 ATCTCAGAGACAGAAGATCAAGG - Intergenic
1089941036 11:122417993-122418015 ACCTCAGGGAAAAAGGATTCTGG - Intergenic
1090526000 11:127537505-127537527 ACTACAGAGAACAAAGATGATGG - Intergenic
1091078850 11:132646964-132646986 ACAAGAGAGAAAAAAGTTTAAGG + Intronic
1091090821 11:132769758-132769780 ACCACAGAGATAAAAGAAGAGGG - Intronic
1092288682 12:7145228-7145250 ACCTCATAGAGAAAACATCAAGG - Intronic
1092828851 12:12424228-12424250 AACAGAAAGAAAAAAGATTAAGG - Intronic
1092987713 12:13862731-13862753 ATCTCAGAGAAAAAAGCCTTTGG - Intronic
1093535451 12:20217827-20217849 TTCTCAGAGTAAAAAGATGAAGG + Intergenic
1093868235 12:24254690-24254712 AGCCCAAAGAAAAAAGAATATGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094715183 12:33006767-33006789 ACCTCAGAGAAGAAAAATAAGGG - Intergenic
1095221952 12:39626311-39626333 ACCTCAGTGTCAAAAGATTTGGG + Exonic
1095275996 12:40282815-40282837 AACTCAGAGGAAAAAGATGTTGG - Intronic
1095541773 12:43317935-43317957 TACTCAGAGTAAAAAGAGTAAGG - Intergenic
1097103198 12:56604008-56604030 ATCTCAAAAAAAAAAAATTACGG + Intronic
1097162921 12:57061993-57062015 ATCTCAAAAAAAAAAGATTGTGG + Intronic
1097599588 12:61674106-61674128 ACCTCAGAGAAAGAAGACACAGG + Intergenic
1097764117 12:63504140-63504162 ATTTCAGAGAAACAAGAATAAGG - Intergenic
1098232134 12:68382311-68382333 TCCTCAGAGAAAAAGGAATGAGG + Intergenic
1098349549 12:69543930-69543952 TCCTCTGAGAATAAAAATTAAGG - Intronic
1099408874 12:82299363-82299385 ACTTTAGAGAAAAAAAATTTGGG - Intronic
1099542530 12:83930373-83930395 ACCTCAGGGAAAACAAACTAGGG + Intergenic
1100682763 12:96947157-96947179 AACTTAGGGAAAAAGGATTAGGG - Intronic
1100694210 12:97073770-97073792 ACCACAAAGGAAAAAGAATAAGG - Intergenic
1100891922 12:99135097-99135119 ACATCAGAGGAAAAAGAAAAGGG + Intronic
1101349605 12:103916642-103916664 AGCTCAGAAAAAAAAAACTATGG + Intergenic
1102377278 12:112432809-112432831 ATCTCAAAAAAAAAAGATTATGG + Intronic
1103265016 12:119622277-119622299 ATCTCTGAGAAGTAAGATTAGGG + Intronic
1103762579 12:123262313-123262335 ACCACAGAGACAAAAGACTGGGG - Intronic
1104583289 12:130026829-130026851 ATCTCAAAGAAAAATGAATAGGG + Intergenic
1106276130 13:28209149-28209171 ACCACAGATAAAAAATATTTGGG - Intronic
1106916550 13:34521477-34521499 ACCTCCGTCAAAAAGGATTACGG + Intergenic
1107325011 13:39232298-39232320 TGCTCAGAGAAAACAGCTTATGG + Intergenic
1108248053 13:48536896-48536918 AGCTAAGAGAACAAAGGTTAGGG + Intergenic
1108679137 13:52764453-52764475 CCCTGAGAGAACAAACATTACGG + Intergenic
1108728739 13:53209746-53209768 GTCTCAGAAAAAAAAAATTACGG + Intergenic
1109156927 13:58922722-58922744 ACTTCACAGAAAAAAGAAAAAGG + Intergenic
1109160126 13:58962039-58962061 ACCTCAAAGGGAAAATATTAAGG + Intergenic
1109479636 13:62932324-62932346 ACGTCTGTGAAACAAGATTATGG + Intergenic
1110165669 13:72440253-72440275 ATCTCAAAGAAAAAAGATGTAGG - Intergenic
1111603946 13:90512749-90512771 ATCTCAGAGGAAATAGATTTTGG - Intergenic
1111889583 13:94064986-94065008 ACTTCACAGAAAAAGGATCAGGG + Intronic
1112146032 13:96701472-96701494 ACATCTGAGAAAAAAAATGAAGG - Intronic
1112312423 13:98330750-98330772 ATCTCAAAAAAAAAAAATTAAGG + Intronic
1112699804 13:101993712-101993734 ATCTCAGAGAAAAGAGAAAATGG + Intronic
1114807998 14:25859957-25859979 AGCCTAGAGAAAAAAGATCAAGG - Intergenic
1115410475 14:33068512-33068534 AACTTTGAGAACAAAGATTATGG - Intronic
1115652690 14:35414448-35414470 GCCTCAGTGAAAAGAGATTTAGG - Intergenic
1117194436 14:53325451-53325473 ACCTCAGAGTAAAGGGATTGGGG + Intergenic
1117286511 14:54290928-54290950 AACTCAGAGAAATAAAATCAAGG + Intergenic
1117518246 14:56523962-56523984 ACCTCTGAGTAAAAAGGTTCAGG + Intronic
1117649499 14:57888162-57888184 ACCTCAGAGAAAGGAGATTTGGG + Intronic
1117720454 14:58624014-58624036 ACCTTAGGGAAAAAAGATTCTGG + Intergenic
1118142574 14:63100655-63100677 ATCTCAGAGGTAAAAGATCAAGG + Intronic
1118302068 14:64625015-64625037 ATCTCTGGGAAAAAAAATTAAGG + Intergenic
1118771430 14:68945232-68945254 GCCCCAGAGAAAAGAGAGTAAGG + Intronic
1118806186 14:69238927-69238949 ACCTCAGATCAAAATGATTTGGG - Intronic
1119369143 14:74123445-74123467 ACCTTTGAGAAGAAAGATTTGGG + Intronic
1119783254 14:77293075-77293097 TCCTCAGGAAAAAAAAATTAGGG + Intronic
1120342096 14:83234516-83234538 AGCTCAGAGAGATAAAATTAAGG - Intergenic
1120425673 14:84344624-84344646 ACCTCAGATCAAAAATATTTCGG - Intergenic
1121054746 14:90843418-90843440 AACTCACAGGAAACAGATTAAGG - Intergenic
1121668089 14:95687548-95687570 ACCTCAGATTAAAAATATTTTGG - Intronic
1126001939 15:44218922-44218944 ACCACAGAGAAAGAAGAATGTGG - Intergenic
1127571339 15:60244854-60244876 ACCAAAGAGAAAAAAGAATAGGG + Intergenic
1128440992 15:67708409-67708431 ACCTCAGAGATGACAGTTTATGG - Intronic
1128763320 15:70234546-70234568 GACTCAGAGAAAAAAGATAAAGG - Intergenic
1128897269 15:71386484-71386506 ACCTCAGAGAAAAGGGAAAAGGG + Intronic
1128969986 15:72099970-72099992 ACATCAGAAATAACAGATTAGGG + Intronic
1129496492 15:75987183-75987205 GCCTTGGAGAAAAATGATTAAGG + Intronic
1129771744 15:78207216-78207238 ACCTCAGAGATAAAGGAGAAGGG - Intronic
1130647138 15:85738391-85738413 ATCTCAAAAAAAAAAGAATAAGG + Intronic
1131466541 15:92659994-92660016 ACTTCAGAGAAACAGGCTTAGGG + Intronic
1137866428 16:51901632-51901654 ATATCAGAAAAAAAAGAGTAGGG + Intergenic
1138344442 16:56311525-56311547 ACCTCAGAGAAAAACTGTTGGGG + Intronic
1140582159 16:76243759-76243781 ACCACAGACAAAACAAATTATGG - Intergenic
1141549161 16:84793505-84793527 GTCTCAAAAAAAAAAGATTAAGG + Intergenic
1142462165 17:102861-102883 GCCTCAAAAAAAAAAGAATATGG - Intergenic
1146750045 17:35370047-35370069 ACATCAAAGAAAAAAAATTATGG + Intronic
1148008406 17:44453927-44453949 ACCTCAAAAAAAAAAAATTGAGG + Intronic
1148018864 17:44540463-44540485 TCCTCAGAGTACAAAGGTTAGGG - Intergenic
1148199939 17:45743489-45743511 ACCTCAGAGAAAATAAATGTCGG - Intergenic
1148980440 17:51569550-51569572 ACCTGACAAAAAAAAGAATAGGG - Intergenic
1149723010 17:58864635-58864657 ATCTCAAAGAAAAAAAATGATGG + Intronic
1150373348 17:64661260-64661282 ACCTCAGAGACATGAGTTTAAGG + Intronic
1151175990 17:72288536-72288558 ATTTCAGAGAAAAGAAATTATGG - Intergenic
1152213655 17:79019402-79019424 AACTCCTAGAAGAAAGATTAGGG + Intergenic
1154248838 18:12725645-12725667 ATATCAAAGAAAAAAGATTAAGG + Exonic
1156003222 18:32409566-32409588 ACAAAAGAGAAAAAAGATTAGGG + Intronic
1156041342 18:32826398-32826420 AATTCAGAGAAAAAAGGTAAAGG - Intergenic
1156287896 18:35716899-35716921 ACCACAGAGAAAAAAGATAAAGG + Intergenic
1157640858 18:49212930-49212952 ACATCAGAAAAACAAGATCATGG + Intronic
1157937225 18:51886466-51886488 GCCTCAGGGAAAAAAGAAAATGG - Intergenic
1158158872 18:54457266-54457288 CCCTCCCAGAAGAAAGATTATGG + Intergenic
1158870156 18:61678699-61678721 ACCTCAGATTAGAAAGAGTATGG + Intergenic
1159864272 18:73686410-73686432 ACCTGAGAGAACAAAGATGGCGG + Intergenic
1161129466 19:2579524-2579546 ACCTCAGAGGAAAACGCTCAAGG - Intronic
1162904742 19:13817063-13817085 ACCTCAAAAAAAAAAGTTGAAGG + Intronic
1163745014 19:19041258-19041280 ACCTAAGAGAAAACACATGATGG + Intronic
1163748667 19:19062807-19062829 ACCCCAGAGAGGAAAGATCAAGG + Intergenic
1164339185 19:24370270-24370292 TCCTCAGATAAAAAAGAGAAAGG + Intergenic
1165083415 19:33325288-33325310 AACTCAGAGTGAAAACATTAGGG - Intergenic
1165195385 19:34098476-34098498 ACCACAGATAAAAAATATTAGGG - Intergenic
1166550094 19:43659801-43659823 ACAGCAGAGCAAAAGGATTAAGG - Intronic
1168215745 19:54924320-54924342 GTCTAAGAAAAAAAAGATTATGG + Intronic
1168268110 19:55233945-55233967 ATCTCACAGAAAAAAGAAAATGG - Intronic
924972103 2:137633-137655 ACCTCAGAGAAGAAAGAACAGGG - Intergenic
925945979 2:8864365-8864387 ACATTAGAAAAACAAGATTAAGG - Intronic
926562834 2:14436167-14436189 ATGAAAGAGAAAAAAGATTAGGG + Intergenic
927828424 2:26326773-26326795 ATCTCAAAGAAAAAAGAAAAAGG - Intronic
928023762 2:27723390-27723412 AGCTCAGAGAAAAGTGATCAAGG + Intergenic
928092246 2:28382071-28382093 AGCTCACAGAAAAAAGAGTTTGG - Intergenic
930718676 2:54617874-54617896 AATTAAGAAAAAAAAGATTAAGG - Intronic
931137874 2:59424636-59424658 ACCTCAGAGACAGAAGATCTAGG + Intergenic
931544398 2:63365545-63365567 TCCTAAGAGATCAAAGATTATGG - Intronic
931592538 2:63901231-63901253 ACATCAGAGAACAGAGATCAGGG + Intronic
932172491 2:69569955-69569977 ACCCCAGAGAAATAAAAATATGG - Intronic
932741884 2:74297180-74297202 ACTTTAGAGGAAAAAGATTTGGG + Intronic
933871265 2:86567786-86567808 ACCTTAAAGAAAAAAGAGTGTGG + Intronic
934099506 2:88639756-88639778 ATCACAGAGAAAAAATATAATGG + Intergenic
934711448 2:96517152-96517174 ACCACAGAGACAAAAGAATATGG + Intergenic
934963919 2:98703352-98703374 AACAGAGAGAAAAAAGATTGAGG + Intronic
935048808 2:99506366-99506388 ACCTCAGAGTAAAGAGATGAGGG - Intergenic
935555062 2:104500871-104500893 ACCCCAGAAAAAAATGATAATGG - Intergenic
935837138 2:107067092-107067114 ACCTCCCTAAAAAAAGATTATGG - Intergenic
935895339 2:107730868-107730890 ACATCAGAGAAAAAAGTTAAAGG + Intergenic
936778350 2:116001525-116001547 AGCACAGAAACAAAAGATTAGGG + Intergenic
937742617 2:125374481-125374503 ACCTCAGGGAAAATAGTTCAAGG - Intergenic
939271037 2:139939908-139939930 ACCTCAGAGTAAAAGTTTTATGG + Intergenic
940232941 2:151477708-151477730 ACCTCAAAAAAAAAAGAAAATGG - Exonic
940330344 2:152467231-152467253 ACTTCCAAGAAAAAAGAATAAGG - Intronic
940648122 2:156413180-156413202 AGCTCAGAGAAAATATATTTTGG - Intergenic
940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG + Intronic
941046988 2:160687457-160687479 ACCTAAGAGGAAAAAGATAAAGG + Intergenic
941296613 2:163746877-163746899 ACCTCAGTGAAGACAGAATATGG - Intergenic
941637992 2:167956558-167956580 ACCTCAGAAAAAAAAAAAAAAGG + Intronic
942912511 2:181262793-181262815 TCCCAAGAGAAAAAAGATGAGGG - Intergenic
943178836 2:184515200-184515222 ACATGAGAGGAGAAAGATTATGG + Intergenic
943813410 2:192219912-192219934 ATTTCAGAGAGAAAAGATCAGGG - Intergenic
944157334 2:196621175-196621197 ACATCAGAAACAACAGATTATGG + Intergenic
944676500 2:202036865-202036887 GCCCCAGTGAAAAGAGATTATGG - Exonic
946012500 2:216577157-216577179 ACGTCATAGAATAGAGATTAGGG + Intronic
947195460 2:227561589-227561611 ACTACAGAGAAATAAGATTAGGG - Intergenic
947628324 2:231635117-231635139 ACCTCAGAGCACAAGGATTCAGG + Intergenic
1169880024 20:10336739-10336761 ACGTGAGAGAGAAAAGATTCAGG + Intergenic
1171253203 20:23666196-23666218 ACCTCAGAGAAGAGCGATGAGGG - Intergenic
1171496398 20:25559242-25559264 ATCTCAAAGAAAAAAGAAAAAGG - Intronic
1172693580 20:36806837-36806859 ACTTTAGGGAAAAAAAATTAGGG - Intronic
1173237716 20:41262796-41262818 ACTTCACAGAACAAACATTAAGG + Intronic
1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG + Intronic
1174935240 20:54860705-54860727 ACAACAGAGAAACAAGATCAGGG - Intergenic
1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG + Intronic
1177030108 21:15972317-15972339 ACCTCAAAGAGAAAAGTTTGAGG + Intergenic
1178128042 21:29537235-29537257 AACTCAGAGAAAAGAGACTGTGG - Intronic
1180591839 22:16945402-16945424 TCTTCAGAGAAAAAAAAATATGG + Intergenic
1182096238 22:27627854-27627876 TCTTCAGAGACAAAAGATCATGG - Intergenic
1184953135 22:47860419-47860441 ATCTCAAAAAAAAAAGAGTAAGG - Intergenic
949188185 3:1218776-1218798 ACCTCAAAAAAAAATGAGTACGG + Intronic
949673513 3:6426329-6426351 ACCTCACACAAAAAAGAATTTGG + Intergenic
950349710 3:12336438-12336460 ACTTCAGAGAAAAAAAAAGATGG + Intronic
950761005 3:15226439-15226461 ACTTGAGAGAACAAATATTATGG + Intronic
950847974 3:16033277-16033299 TCCTCAGAGAACAAAGATGAAGG - Intergenic
951782649 3:26381585-26381607 CCGTCAAAGAAAAAATATTAGGG - Intergenic
952053459 3:29414702-29414724 AACTCAGGGAAAAATGATAAGGG + Intronic
952075163 3:29686943-29686965 ATCTTAGAGAAGAAAGATAAGGG - Intronic
952672381 3:35985840-35985862 AGATCAGAAAAAAAAGATTTAGG - Intergenic
953600453 3:44358438-44358460 ACCTCAGACTGAAAATATTAGGG + Intronic
954053064 3:47998416-47998438 ACATTAGAGAAGAAACATTAGGG + Intronic
955554607 3:60122642-60122664 GCCTCAGAGAAAAAAGTATCTGG + Intronic
955576263 3:60366999-60367021 TCCTCAGAGAACAAATATAATGG - Intronic
955811411 3:62794680-62794702 TCCTTAGGGAAAAAAGATGATGG - Intronic
957271272 3:78033168-78033190 AAGTCAAAGAGAAAAGATTAAGG - Intergenic
957664121 3:83201796-83201818 ACCACAGAGACAAAAGATTATGG - Intergenic
958094334 3:88922991-88923013 ATCACAGAGAAAAAAGAATATGG + Intergenic
958145206 3:89614841-89614863 ATCTCAAAAGAAAAAGATTATGG + Intergenic
958471522 3:94526686-94526708 ACATCAGAGAAGAAAAATAAAGG - Intergenic
958827291 3:99046499-99046521 AACTCAGAAATAACAGATTATGG + Intergenic
959145653 3:102541478-102541500 ACCTGGAAGAAAAAAGAGTAGGG + Intergenic
959417096 3:106088586-106088608 CTCTCAGAGAAGAAAGATTAGGG + Intergenic
959528415 3:107403639-107403661 ACCACAGGGAAAAAAGCTAATGG - Intergenic
959821427 3:110739825-110739847 ACCTCAGTGAAAAAGTATTATGG + Intergenic
959922589 3:111884980-111885002 AGCTCAAAGAAGAAAAATTAAGG - Exonic
960077208 3:113500602-113500624 ATTTCAGAGAAAAAAGAAAAGGG + Intronic
960377132 3:116916914-116916936 AAATCAGGGAAAAAAGATGATGG - Intronic
962003429 3:131324271-131324293 GCCTCAGAGGAACATGATTAAGG + Intronic
963033783 3:141006367-141006389 AACACAGACAAATAAGATTATGG - Intergenic
963666277 3:148191903-148191925 AACTCAAAGAAAAAATATCAGGG + Intergenic
964123824 3:153215317-153215339 ACCCAAGACAAAGAAGATTATGG - Intergenic
964216771 3:154293656-154293678 ATGGTAGAGAAAAAAGATTAAGG + Intronic
964650912 3:159010184-159010206 ACCTCTGAGAAGAAAGAGAAAGG + Intronic
965050990 3:163647174-163647196 ACTTCAGGGAAAAAAGAGAAGGG - Intergenic
965959394 3:174410611-174410633 ACCCCAGAGAACAAAGAAGAAGG - Intergenic
966007506 3:175034066-175034088 GCATGAGAGAAAGAAGATTAAGG - Intronic
966423110 3:179753427-179753449 ACCTGAGAGAAAAAACTTTCTGG + Intronic
966483752 3:180444654-180444676 ACATGAGATAGAAAAGATTAAGG - Intergenic
967642413 3:191881676-191881698 ACCTCAGAGAACTTAGATTCCGG + Intergenic
967679259 3:192340670-192340692 ACTTCACAGAAAAAAGGTAATGG + Intronic
967777090 3:193395824-193395846 ACTTGAGAGAAAAATGATTTAGG - Intergenic
968112799 3:196063049-196063071 GGCTCAGAAAAAAAAGATTTTGG - Intronic
969039868 4:4287777-4287799 TCCAAAGAGAAAAAAAATTAAGG + Intronic
969250284 4:5963423-5963445 CCATCAGAAAAAAAAGTTTAAGG + Intronic
970511663 4:16787609-16787631 ATCTCAGAAAAAAAAGAGTGGGG + Intronic
971454610 4:26832621-26832643 ACTTCAGAGGAAAAAGAGGAAGG + Intergenic
971620252 4:28846752-28846774 ACCTTACAAAAAAAAGCTTAAGG - Intergenic
971796942 4:31240211-31240233 ACCCTAGATAAAAAAGAATAAGG + Intergenic
971822707 4:31579481-31579503 AGCTCAGAGAAAATATATTGAGG + Intergenic
972444196 4:39127886-39127908 ACCTCAGAGAAGAAAAATGTTGG + Intergenic
976113389 4:81700916-81700938 ACCAGAGGGAAAAAAGATTTGGG - Intronic
976366819 4:84241902-84241924 ACATCAGAGAAAAATAATTGGGG - Intergenic
976505850 4:85846326-85846348 ACCTCACAGAAAGCAGATTGGGG - Intronic
977272665 4:94937261-94937283 ACATCACAGAAAAAAGATACAGG - Intronic
977784308 4:101015281-101015303 ACCTCAGAAAAAAAAAAAAAAGG - Intergenic
978866703 4:113521387-113521409 ACCACAAAGAAAAACTATTAAGG - Intronic
979092958 4:116510162-116510184 ACAAAAGAGAAAAAAAATTAAGG + Intergenic
979324973 4:119368464-119368486 ACCTCAGATCAAAAATATTCAGG - Intergenic
979696208 4:123616297-123616319 ACCTCAGAAAAATAAAATCAAGG - Intergenic
979729720 4:124009649-124009671 ACCTCAGAGAAACAAGAAATGGG - Intergenic
980481383 4:133391965-133391987 ACATAAGATAAAAAATATTAAGG + Intergenic
981849401 4:149211009-149211031 ATATCAAAGAAAAAAGACTAGGG + Intergenic
982143314 4:152352634-152352656 ACGTCAGAAAAGGAAGATTAGGG + Intronic
982493042 4:156053557-156053579 ACCACACAGAAGAAAGAGTAAGG - Intergenic
982511026 4:156283529-156283551 ACCCCAGAAAAAAATGAATATGG - Intergenic
982542422 4:156690599-156690621 ACCACAGAGTAAAAAGAATGAGG + Intergenic
983168045 4:164501565-164501587 ACAGCAGAGAAACAAGATTAAGG + Intergenic
983242880 4:165253482-165253504 ACCTCAGATCAAAAATATTCAGG - Intronic
984406391 4:179337244-179337266 AAGGCAGAGAAAAAAAATTAGGG + Intergenic
984422138 4:179537104-179537126 TGCTCAGAGAAACAATATTAAGG - Intergenic
984537856 4:180999674-180999696 AGATCAGAGAACAAAGATTTTGG - Intergenic
984549851 4:181147142-181147164 ACCTCAGAGGAAAAACATGGTGG + Intergenic
986100835 5:4609680-4609702 ACCTCAGAGATAAAATCATATGG + Intergenic
986888886 5:12275606-12275628 ACTTCAGAGAACAAACATTAAGG + Intergenic
986984624 5:13486289-13486311 ACCTCTGAGCAAAGAGATGATGG + Intergenic
987881156 5:23748289-23748311 ACCACAAAGAAACAACATTAGGG + Intergenic
988013708 5:25526140-25526162 ACCTCAATGAAATAAAATTATGG + Intergenic
988432446 5:31135193-31135215 ACCTCACAGAAACAAAATAAAGG + Intergenic
988943049 5:36165337-36165359 ACCTCACAGAAAAATGAATTTGG - Intronic
989286171 5:39702499-39702521 AACTCAGAGAAAAAAAAAAAAGG + Intergenic
989680899 5:44028700-44028722 ACTTCAGAGAAAAAAACTGAGGG - Intergenic
990019472 5:51107557-51107579 ACCTAAGATAGAAAAGATAAGGG - Intergenic
990219125 5:53567151-53567173 ACCTCAGATTTAAAATATTAAGG - Intronic
990479096 5:56190422-56190444 AACTCATAGAAAAAAGCCTAGGG - Intronic
990679739 5:58228970-58228992 ATCTCAGAGAGAAAAAATTATGG + Intergenic
991591339 5:68254753-68254775 ACCTAAAAGAAACACGATTATGG - Intronic
991721667 5:69499398-69499420 ACCTCAGACAGAAAATATTCAGG - Intronic
992467153 5:77018079-77018101 ACCTCAGGGAAAAAAGGGAAGGG + Intergenic
992470430 5:77047183-77047205 ACCTCAGATCAAAAATATTCAGG + Intronic
992706443 5:79399307-79399329 TTCTCAGAGAAATAAGACTATGG - Intronic
993054219 5:82963095-82963117 ACATCAGAAAAAAAAGATGAAGG + Intergenic
993126018 5:83836531-83836553 ACCCCAGAGAAACAAAAATATGG + Intergenic
993532413 5:89040866-89040888 ACCCCAGAGAAAAAGGAAGAGGG + Intergenic
993967995 5:94381353-94381375 ACCTCAGATAGAAAATATTTGGG + Intronic
995026923 5:107434422-107434444 AACTCAGAGAAGGAGGATTATGG - Intronic
995366130 5:111363332-111363354 AGCTCAAAGAAAAAAAATTCTGG - Intronic
995524818 5:113042159-113042181 ACAGCAGACAAAAAAGATGAAGG + Intronic
995633678 5:114161703-114161725 AGTTTAGAGAAAAAAGAATATGG - Intergenic
995719558 5:115116296-115116318 ATCTCAGAGTTAGAAGATTAAGG - Intergenic
996646505 5:125824592-125824614 ACCTCATACAAAAAAAAATATGG - Intergenic
997795583 5:136806658-136806680 ACATGAGAGAAAAAACATTATGG + Intergenic
997827972 5:137124486-137124508 ACCTTAGAGAGAAGAGATTCTGG + Intronic
1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG + Intergenic
1000668073 5:164023868-164023890 ACATCAAAGAAAAAACATAATGG - Intergenic
1001007803 5:168069712-168069734 ACCAGAGAGAAAGAAGATGAAGG - Intronic
1001606675 5:172965279-172965301 ACTACAGAGAAAGAAGATAAGGG - Intronic
1003527297 6:6909017-6909039 ACCTCAGAGAAACAAGATTGTGG - Intergenic
1004172261 6:13304587-13304609 CCCAAAGAGAAAAAAGAGTAAGG + Intronic
1004415400 6:15418890-15418912 AACTCAGACCAAAAAGAATAAGG - Intronic
1005293433 6:24400830-24400852 ACCTCAGAGTTAAATGATTAAGG - Intergenic
1005774155 6:29111860-29111882 ACCTGAGAGAAAAAAAAGAAAGG - Intergenic
1006527754 6:34622140-34622162 AACTCCTAGAAAAAAGCTTAGGG + Intronic
1006666949 6:35701848-35701870 ACCTAAGAAAAAAAAAAATACGG - Intronic
1009468173 6:63999725-63999747 ATCTCAGAGATAAAAGCATAAGG + Intronic
1009678629 6:66861186-66861208 AGCGCAGAGAAACAAGATAATGG + Intergenic
1009887830 6:69645194-69645216 AATACATAGAAAAAAGATTATGG + Intergenic
1009998265 6:70921048-70921070 ACATCAAAGAAAAAATACTAAGG - Intronic
1010766465 6:79781446-79781468 ACCTGGGAGAAAAAAGTTTCTGG + Intergenic
1011037493 6:82993643-82993665 ACCTCAGAAAGAAAATATTTTGG - Intronic
1011266745 6:85529046-85529068 ACCTCAGAAAAAAAAAAAAAAGG + Intronic
1011272297 6:85592422-85592444 ACATCAGAGAAAACAGCTTGCGG + Intronic
1012631010 6:101467883-101467905 ACCTCAAAAAAAAAAAAATAAGG - Intronic
1013213443 6:108006731-108006753 ACCACCAAGAAAAAAGATCATGG - Intergenic
1013612024 6:111804613-111804635 ACCCCAGTGAACAAAGACTAGGG - Intronic
1013824020 6:114189688-114189710 GCCTCAGTGGAAAAAGAGTATGG - Intronic
1014020024 6:116576075-116576097 ACGGCAAAGAAAAAAGATTTTGG - Intronic
1016148696 6:140708554-140708576 AGCTGAGAAAAAAAAAATTAGGG + Intergenic
1016637260 6:146306880-146306902 ACTTCAGGAAAAAAAGATTAGGG + Intronic
1016667368 6:146657655-146657677 ACATCAGAGAAGAAAGAGGAAGG - Intronic
1017321808 6:153103028-153103050 AGCTCAGTGAATAAAGAATATGG + Intronic
1017408082 6:154141171-154141193 ACCTCACATAAAAGAGATAATGG + Intronic
1017485445 6:154897928-154897950 ACCTCTGAGGAATATGATTATGG + Intronic
1017634330 6:156429035-156429057 AAATGAGAGAAAAAAGAATAAGG + Intergenic
1018039766 6:159911503-159911525 ACTTCACTGAAAAAAGAATAGGG - Exonic
1018932531 6:168250707-168250729 ACCTCTGAGACAAAAGGTTAGGG - Intergenic
1019216816 6:170449080-170449102 AGCTCAGAGAAAGGAAATTATGG - Intergenic
1019994034 7:4711815-4711837 AGGTCAGAGAGAAAAGATTGCGG + Intronic
1020699676 7:11464155-11464177 ACTTTAAAAAAAAAAGATTATGG - Intronic
1021410415 7:20324073-20324095 ACTTCAGACTAAAAAGATTGTGG + Intergenic
1023917472 7:44600895-44600917 ACCTCATAGAAGAAACATAAGGG + Intergenic
1024434357 7:49332305-49332327 ATCCAAGAGAAAAAAGAATAAGG - Intergenic
1024448788 7:49514260-49514282 TCCTAAGAGAAAAAATCTTAGGG + Intergenic
1024513335 7:50220451-50220473 ACCTCAGTCAAAACAGATTCAGG - Intergenic
1024864395 7:53888026-53888048 AAGTCAGAGAACAAAGATCAAGG + Intergenic
1026132305 7:67630546-67630568 AGCTCAAAGAAAGAAGATCAGGG + Intergenic
1026849844 7:73717780-73717802 ACATCAGAGCAAAAAGATCTGGG + Intronic
1027504296 7:78996333-78996355 ACTTCAGTGACAAAAGATTTGGG - Intronic
1028810527 7:95081148-95081170 ATCCCAGAAAAAAAAGCTTAAGG + Intronic
1028960302 7:96741258-96741280 ACCTTAGAGTAAAAAGACTCAGG + Intergenic
1029265987 7:99340923-99340945 ACCTAATAGAAATAAGATTGTGG - Intronic
1030706632 7:112699478-112699500 ACCTCAGAGAAAAGAAACAAAGG + Intergenic
1031663589 7:124457489-124457511 ATCACAGAGAGGAAAGATTATGG - Intergenic
1032334975 7:131016873-131016895 TCCCCATAAAAAAAAGATTAGGG + Intergenic
1032768396 7:135023286-135023308 TCCTCAGAGAGAAAACACTAAGG + Intronic
1033832494 7:145270667-145270689 ATGTCAGAGAAAAATGATAATGG + Intergenic
1033934637 7:146568959-146568981 ACCACAGAGAAAAAACAAGATGG - Intronic
1035235918 7:157497702-157497724 ACATCAAAGCAAAAAGAATATGG - Intergenic
1036966115 8:13300302-13300324 ACATTAGAGAAAAGAGATAATGG + Intronic
1037200283 8:16243881-16243903 AACTCAATAAAAAAAGATTATGG + Intronic
1037394910 8:18431341-18431363 GCCTTAGAGAAAAAATATAATGG - Intergenic
1037543825 8:19898507-19898529 ATCCCAGAGAAATAAGAATAAGG + Intergenic
1039222263 8:35345834-35345856 ACCTGACAGAAAAAAAATTAAGG + Intronic
1040384717 8:46906559-46906581 ACCTCACAGAAAAGAGTCTAAGG + Intergenic
1040992155 8:53363837-53363859 ACAGCATGGAAAAAAGATTAAGG + Intergenic
1041501168 8:58540128-58540150 ATCTTAGAGAATAAAGATTAGGG + Intergenic
1042257955 8:66825975-66825997 ATCTCAAAAAAAAAAGATGAAGG - Intronic
1043337191 8:79191082-79191104 AAGTCAGAGAAACAAGATTAAGG + Intergenic
1043412772 8:80015994-80016016 AGCAAAGAGAAAAAAGATTGAGG + Intronic
1043959115 8:86395186-86395208 ACGTCAGAGAATAAACATAAGGG + Intronic
1045603696 8:103748518-103748540 AATTCAGAGAAAAAAGTTGAGGG - Intronic
1045626279 8:104055553-104055575 CCCTCAGAGAAGAAATATAATGG - Intronic
1046316244 8:112506355-112506377 ACCTTAGATAATAAAGATTGGGG + Intronic
1046547587 8:115670334-115670356 ACCATAGAGAAAAAGGAATAAGG - Intronic
1046818537 8:118611706-118611728 ACCTCAGACAACAAGTATTAGGG + Intronic
1047002220 8:120584483-120584505 AGTTAAGAGAAAAAAGTTTAGGG + Intronic
1047855775 8:128909923-128909945 ACCACACAGAAAAAACATTCTGG + Intergenic
1048584219 8:135757501-135757523 ACCTCAGTAGAAAAATATTATGG - Intergenic
1048839607 8:138553327-138553349 TTCTCTGAGAAAACAGATTAAGG + Intergenic
1050116304 9:2267072-2267094 ACCTCTAAGAAAAAATATTCCGG + Intergenic
1050195919 9:3084607-3084629 ACCTTAGAGAAAAACGAGTAAGG - Intergenic
1050471795 9:6000807-6000829 ACTGAAAAGAAAAAAGATTAGGG - Intronic
1051072949 9:13194897-13194919 ACCTAAGGAAAAATAGATTAAGG - Intronic
1052441610 9:28503835-28503857 AAATCAGAGAAAAAAGATACGGG + Intronic
1052977739 9:34424001-34424023 GGCTTAGAGAAAAAAAATTAAGG + Intronic
1053112735 9:35476864-35476886 ACATCAGTGAAAACAGCTTAAGG - Intergenic
1053858421 9:42360951-42360973 ACCCCACAGAAAACACATTAGGG + Intergenic
1054756369 9:68962634-68962656 AACTCAGAGAATTAAAATTATGG + Intronic
1055482828 9:76726705-76726727 ACCTGAAAGAATAAAGATTAAGG - Intronic
1055485485 9:76752563-76752585 AGCTTATAGAAAAAAGGTTAAGG - Intronic
1056087601 9:83167233-83167255 ACCTCAGAAAAAAAAAAATCTGG + Intergenic
1056220218 9:84444568-84444590 ACCTCAGAGAAAAGAATGTATGG - Intergenic
1057052941 9:91939595-91939617 ACCACAGAGAGAACAGATGAGGG - Intronic
1057627964 9:96694599-96694621 ATCTCAAAAAAAAAAAATTAAGG - Intergenic
1057813720 9:98278631-98278653 ATCTCAGAGAAAATAGAGAATGG - Intergenic
1058088061 9:100772228-100772250 AACGTAGGGAAAAAAGATTAAGG - Intergenic
1058133983 9:101287036-101287058 ACAACAGGAAAAAAAGATTAAGG - Intronic
1060577184 9:124707186-124707208 AGAACAGAGAAAAAAGATTGAGG - Intronic
1185770208 X:2760175-2760197 GTCTCAGAAAAAAAAAATTAAGG + Intronic
1186190105 X:7059930-7059952 AACACAGAGAAAAAAGCCTAAGG + Intronic
1187403439 X:18982849-18982871 ACAACAAAGAAAACAGATTAAGG + Intronic
1187686557 X:21821302-21821324 ACCTCTAAGACAAAGGATTAAGG + Intergenic
1188179100 X:27031960-27031982 GCCACACAGAGAAAAGATTATGG - Intergenic
1188336677 X:28943859-28943881 AACTCAGAAAAAATACATTAAGG - Intronic
1189120577 X:38390070-38390092 ACCTTAGAGAAAAATGAATGGGG - Intronic
1189963805 X:46351380-46351402 AGCTCAGAAAGAAAAGAATAGGG - Intergenic
1190781583 X:53601562-53601584 ACACCAGAGAAAAAACATTCTGG + Intronic
1191215912 X:57932330-57932352 ACCTCAGAAAGAAACCATTATGG + Intergenic
1193690793 X:84639876-84639898 ACCTCAAAGCATAAAGATTCTGG + Intergenic
1195603555 X:106776121-106776143 ACTTGAGACAAGAAAGATTATGG + Intronic
1195650186 X:107275551-107275573 ACCTCAGAAAGAAACCATTATGG - Intergenic
1196299568 X:114038903-114038925 GTCTCAGAAAAAAAAAATTATGG - Intergenic
1197079353 X:122393828-122393850 AGCACAGAAAAAAAAGATGAGGG - Intergenic
1197130230 X:122996958-122996980 CCCACAGAGAGAAAAGATTAAGG - Intergenic
1199082794 X:143595282-143595304 ACCTCAGAAAGAAACCATTATGG + Intergenic
1199519370 X:148718102-148718124 ACATCAGTGAAGAAAGGTTAAGG + Intronic
1200159560 X:153999168-153999190 ACTTCAAAAAAAAAAAATTAAGG - Intergenic
1200902178 Y:8443908-8443930 ACATCAGAGACAAAAGGTTTTGG - Intergenic
1201704635 Y:16922682-16922704 ACCTCAGAAAAAAAAACCTAAGG + Intergenic
1202575185 Y:26316638-26316660 ACATCAGACCCAAAAGATTAGGG - Intergenic