ID: 1080381569

View in Genome Browser
Species Human (GRCh38)
Location 11:31777266-31777288
Sequence CAGGGTCACAAGGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 574}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080381569_1080381576 3 Left 1080381569 11:31777266-31777288 CCATCCTCCTCCTTGTGACCCTG 0: 1
1: 0
2: 2
3: 50
4: 574
Right 1080381576 11:31777292-31777314 GGAAATCTGTCTTTCCACAAAGG 0: 1
1: 0
2: 0
3: 26
4: 256
1080381569_1080381577 7 Left 1080381569 11:31777266-31777288 CCATCCTCCTCCTTGTGACCCTG 0: 1
1: 0
2: 2
3: 50
4: 574
Right 1080381577 11:31777296-31777318 ATCTGTCTTTCCACAAAGGAAGG 0: 1
1: 0
2: 1
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080381569 Original CRISPR CAGGGTCACAAGGAGGAGGA TGG (reversed) Intronic
900475246 1:2873420-2873442 CAGGGACTCAGAGAGGAGGAGGG - Intergenic
900711878 1:4119590-4119612 CAGGGAGACAGGCAGGAGGAGGG + Intergenic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901123178 1:6911337-6911359 CAAGGTCACAGGGAGGTCGAAGG - Intronic
901559330 1:10057844-10057866 AAAGTTCTCAAGGAGGAGGAAGG + Intronic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902565660 1:17309747-17309769 CAGGGCCACATGGTGGAGGCAGG + Intronic
902602174 1:17547384-17547406 CAGGCTCTCAAGGAGAAAGAGGG - Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902897320 1:19487724-19487746 CAGAGGCACAAGGAGCAGCAAGG + Intergenic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903333229 1:22608211-22608233 CAGGGGCAGAAGGGAGAGGAAGG - Intergenic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
904259438 1:29280003-29280025 CAGGGTCACAAGCTGGAGCTTGG - Intronic
904263950 1:29307053-29307075 CAGGGGCAGATGGAGGTGGACGG - Intronic
904965118 1:34366181-34366203 CAGGGGCACAGGGAGGTGGAGGG - Intergenic
905204080 1:36332998-36333020 TGGGGTAACAAGGAGGAGGGGGG - Intergenic
905316230 1:37083186-37083208 CAGAGACACAAAGAGGGGGAGGG + Intergenic
905458361 1:38104116-38104138 CAGGGTCCTAAGGAGAAAGAAGG + Intergenic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905623103 1:39466306-39466328 CAGAGTCACAAGTGGTAGGAGGG - Intronic
905926823 1:41757006-41757028 CAGGATCTCAAAGAGGAGGGCGG + Intronic
906325611 1:44843437-44843459 CGGGGCCCCAGGGAGGAGGAGGG + Intergenic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
907553344 1:55323454-55323476 CAGAGTCTCAAGCAGGAAGAAGG - Intergenic
908053108 1:60254480-60254502 GAGTGTCACATGGAGGAAGAAGG + Intergenic
913496229 1:119430573-119430595 CAGGGGCTCAAGGTGCAGGAGGG + Intergenic
914971227 1:152309414-152309436 CAGGGTCAAGCAGAGGAGGAAGG - Exonic
915057636 1:153149981-153150003 CAGGTGGACAAGGAGGAGGCAGG + Exonic
915270378 1:154749587-154749609 CAGGGTGCCAAGGAGGAGCCTGG + Intronic
915637184 1:157195273-157195295 CAGGGTCTCAAGCTGGACGAAGG + Intergenic
915772406 1:158441538-158441560 CTGGGTGGCAATGAGGAGGAAGG - Intergenic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
916025256 1:160827950-160827972 AAGGGTGAGAAGGAGGGGGAGGG - Exonic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
917619953 1:176785655-176785677 CAGCAACACAAGGAGGGGGATGG - Intronic
917707297 1:177647412-177647434 CAAGGGCAGAAGGAGGAGCAGGG + Intergenic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918430275 1:184452405-184452427 TAGGGTCACAAGTTGGAGGTGGG + Intronic
919645987 1:200095056-200095078 GATGGTCACAATGAGGAAGAGGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920378628 1:205522933-205522955 GAGGGTCACTGGGAGGAAGAAGG + Intronic
921169042 1:212529461-212529483 CAGAGACACAGAGAGGAGGAGGG - Intergenic
921890617 1:220350084-220350106 CAGGCTGTCAAGCAGGAGGAGGG + Intergenic
922367380 1:224878598-224878620 CAGGACCACAAGGATGGGGATGG + Intergenic
922421468 1:225463490-225463512 CAGCCTCCCAAGGAAGAGGAGGG + Intergenic
922496741 1:226063050-226063072 CAGGGGCGCGGGGAGGAGGAGGG - Intronic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923230819 1:231984601-231984623 CAGGGGTACAAGGATGAGTAAGG + Intronic
923719726 1:236456590-236456612 CAGAGGCACACGCAGGAGGAAGG - Intronic
924952190 1:248895353-248895375 CTGGCACACAAAGAGGAGGAAGG + Intergenic
1062876449 10:946761-946783 GAGGGTGGCAAGGAAGAGGAGGG - Intergenic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1063890655 10:10624866-10624888 CAGGGACACAAAGAGGCAGATGG + Intergenic
1063902105 10:10744822-10744844 GAGGCTCTCTAGGAGGAGGAGGG + Intergenic
1064256116 10:13743975-13743997 CAGGGTTACATGGAGGAAAAAGG + Intronic
1065562974 10:26981875-26981897 CAGGGGCTCAAGGCGCAGGAGGG + Intergenic
1065683034 10:28256579-28256601 AAGTGGCACAGGGAGGAGGATGG + Intronic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1067015780 10:42755473-42755495 CAGGGGCTTAAGGAGGAGGTTGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067405516 10:46019940-46019962 CTGCGCCACAGGGAGGAGGAGGG - Intronic
1067530665 10:47069297-47069319 CAGACACACACGGAGGAGGAAGG - Intergenic
1067559989 10:47298478-47298500 GAGGGGCACATGGAGAAGGAGGG + Intergenic
1067945180 10:50684603-50684625 CAGGTTCAGAGGGAGTAGGATGG + Intergenic
1068643514 10:59438381-59438403 CTGGGACTCAAGCAGGAGGAAGG + Intergenic
1068806014 10:61194578-61194600 CAGAGTCAGAAGGAGTAGGATGG - Intergenic
1070821174 10:79355499-79355521 CAGGGTCTTAGGAAGGAGGAGGG + Intergenic
1070841369 10:79490308-79490330 CAGGCTCACAAGATGGAGAAAGG + Intergenic
1070866689 10:79711475-79711497 CAGGTTCAGAGGGAGTAGGATGG + Intronic
1070880478 10:79849596-79849618 CAGGTTCAGAGGGAGTAGGATGG + Intronic
1071633599 10:87233698-87233720 CAGGTTCAGAGGGAGTAGGATGG + Intronic
1071647047 10:87365914-87365936 CAGGTTCAGAGGGAGTAGGATGG + Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072791456 10:98321122-98321144 CAGGGTCCCAGAGAGGAGTATGG + Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073050117 10:100661781-100661803 CGGGGTCATAAGAAGGACGAAGG + Intergenic
1073185619 10:101613642-101613664 CAGGGTCTCAGTGAGGTGGAAGG - Intronic
1073498289 10:103913899-103913921 CAGGCCCCCAAGAAGGAGGAGGG + Intronic
1074112276 10:110431089-110431111 CAGGCCCAGAAGGAGGAGCAGGG - Intergenic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075762403 10:124866630-124866652 CAGGGTCATAGGAAGAAGGAAGG - Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076323714 10:129604147-129604169 CATGCAAACAAGGAGGAGGATGG - Intronic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077023202 11:428728-428750 CAGGGTCAGGACGAGGATGACGG + Exonic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077539833 11:3141322-3141344 CAGAGTCACAGGGAGGATGCTGG - Intronic
1078135510 11:8648695-8648717 CAGGGGCACAAGGAGGATTTTGG + Intronic
1078346991 11:10558915-10558937 CAGGGTTACAATAAGGAGAAGGG + Exonic
1078368545 11:10726323-10726345 AAGGCTCACCAGGAGGAGGTAGG - Intergenic
1078455279 11:11470090-11470112 CAGGGACACTTGGATGAGGATGG + Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1078662239 11:13296916-13296938 CACTGTCACAGGCAGGAGGACGG - Intronic
1080094923 11:28394470-28394492 CTGGCTCACAAGGAGGGGGGTGG + Intergenic
1080119539 11:28661293-28661315 CAAGGTCAGATGTAGGAGGATGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080661068 11:34296321-34296343 GAGGGAGACAAGGAGGAGGGTGG + Intronic
1080923995 11:36737276-36737298 CAGAGACAAAGGGAGGAGGAGGG - Intergenic
1082790390 11:57342862-57342884 CAGGGAGCCAAGGAGGAGGCTGG - Intronic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1083297872 11:61724938-61724960 AATGGCCACAAGGAGAAGGAGGG - Intronic
1083487629 11:62993465-62993487 CAGGGTCTCAGGCAGGAAGAGGG + Exonic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085366029 11:75945716-75945738 CAGGGTCATATGGGAGAGGATGG - Intronic
1086041580 11:82485970-82485992 GTAGGTGACAAGGAGGAGGAAGG - Intergenic
1086114251 11:83230433-83230455 CACGGACACAAAGAGTAGGATGG - Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1086693537 11:89817038-89817060 CAGGGTCAGTAGTAGGAGGGAGG - Intergenic
1086771222 11:90770044-90770066 CTGGGTCTCAAGGATAAGGAAGG - Intergenic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1088734136 11:112712430-112712452 GAGAGACACAAGGAGGAAGATGG + Intergenic
1088927355 11:114315865-114315887 CAGGGTGCTAAGGGGGAGGATGG + Intergenic
1089022325 11:115229190-115229212 AAGGTGCACAAGGAGGACGATGG - Exonic
1089353798 11:117836873-117836895 CATGGTCAGAGGGAAGAGGAAGG - Intronic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089603933 11:119630768-119630790 CAGGGGCAGAAGGAAGGGGAAGG + Intronic
1089638308 11:119830943-119830965 GAGGGTGACATGGAGGAAGAAGG - Intergenic
1089679702 11:120112361-120112383 CAGGGTCAGGAGGAAGAGCAGGG + Exonic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091353538 11:134916293-134916315 CAGGCTCACAGGGAGGCAGAAGG - Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1092060654 12:5547812-5547834 CAGGATCACAGGAAGGATGAGGG + Intronic
1092881591 12:12891470-12891492 CAGAGGGACAAGGAGGGGGAGGG - Exonic
1092906499 12:13104572-13104594 CAGGGCAGCAAGGAGAAGGAAGG - Intronic
1093525310 12:20098463-20098485 TAGGGTCACAAAGACAAGGAAGG - Intergenic
1093850250 12:24027706-24027728 AAAAGTCACAAGGAGGGGGATGG + Intergenic
1093989343 12:25572569-25572591 CAGGGTTACACTGGGGAGGAGGG + Intronic
1094826712 12:34275252-34275274 CAGGCTCACAAGGATGCTGATGG - Intergenic
1096761964 12:53849325-53849347 CAGGGTCATAAAGAGAGGGAGGG - Intergenic
1096957939 12:55546071-55546093 CAGGGTCCCCAAGAGTAGGAAGG - Intergenic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1100863566 12:98832330-98832352 CAGGGGCACAAAGAGAAGGGAGG + Intronic
1101649058 12:106658515-106658537 CTGAGCCACAAGGAGGAAGAAGG - Intronic
1101733265 12:107443949-107443971 CAGGGTCACCTAGATGAGGATGG + Intronic
1103033861 12:117640687-117640709 CGGGGGCCCAGGGAGGAGGAAGG - Intronic
1103145314 12:118590367-118590389 CAAGGTCACACAGAGGAGAAAGG - Intergenic
1103249242 12:119485914-119485936 CTTGGTCACAAGGTGGTGGAGGG - Intronic
1103696223 12:122817917-122817939 CAGGGTGCCAAGGTGGAGAAGGG - Intronic
1104714592 12:131008013-131008035 CAGGGTCACACAGATAAGGAGGG - Intronic
1104809044 12:131609502-131609524 GAGGCTCAGAAGGAGGAGGGCGG - Intergenic
1104845305 12:131843972-131843994 GCGGGAGACAAGGAGGAGGACGG - Intronic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105545284 13:21346617-21346639 CAGGAGCACAGGGAGGATGAGGG - Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106384650 13:29272435-29272457 GAGGTTCTCAAGGAAGAGGAAGG - Intronic
1107436962 13:40388771-40388793 TAGAGTGTCAAGGAGGAGGACGG - Intergenic
1108896382 13:55334276-55334298 CAGTGTCCCAAGGCTGAGGAGGG - Intergenic
1109464628 13:62713385-62713407 CAGGGTCACAAGACGAAAGATGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1112843610 13:103610437-103610459 GAGGAACAAAAGGAGGAGGAAGG - Intergenic
1113776761 13:112952253-112952275 CAGGCTCACAGAGAGCAGGAGGG - Intronic
1113900432 13:113793854-113793876 GAGGGTCAGAAGGAGAGGGAGGG + Intronic
1113993186 14:16045181-16045203 CAGGCTCACAAGGATGCTGACGG - Intergenic
1114050795 14:18918850-18918872 GAGGGTGGCAAGGAGGAGCAGGG - Intergenic
1114111764 14:19483072-19483094 GAGGGTGGCAAGGAGGAGCAGGG + Intergenic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117281765 14:54248307-54248329 CACGATCACAAGGAGGAGAATGG - Intergenic
1117374401 14:55107745-55107767 CAGGCTAACAAGGACAAGGAAGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119061082 14:71475420-71475442 CATCATCACAAAGAGGAGGAGGG - Intronic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119649439 14:76373385-76373407 CAAGGTCACATGGAGGAGTCAGG + Intronic
1119896042 14:78220710-78220732 CAGGGTCCCAGGGAGGTGGCAGG + Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1122787383 14:104170035-104170057 CGGGCTCACAACCAGGAGGAAGG - Intronic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1123726701 15:23110233-23110255 AAGGCTCAGAAGGAGGAGCAGGG + Intergenic
1124071302 15:26395165-26395187 GAGGGTCTCAGGGAGGTGGACGG + Intergenic
1124788943 15:32708364-32708386 CAGGGACTCAAAGAGGAGGAAGG + Intergenic
1125034318 15:35106495-35106517 CAGGGTCACTCAGAGGATGATGG + Intergenic
1125375218 15:39021466-39021488 CAGGGCCACAGGAAAGAGGAAGG + Intergenic
1125672031 15:41480694-41480716 CAGGGTCAGAAGCAGCAGGCTGG - Exonic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1127953792 15:63834763-63834785 CAGGTACAGAAGGAGGAAGATGG - Intergenic
1128895118 15:71366036-71366058 CTGGGACACAAGTAGGAGGGAGG - Intronic
1128942511 15:71800182-71800204 CAGGGTGACATGGAGGAGTGAGG - Intronic
1129673636 15:77620809-77620831 CAGGGTCTCAGGGTGAAGGACGG + Intronic
1129985714 15:79918438-79918460 CGGGGTCTCAGGGAGGAGCAAGG - Intronic
1130061855 15:80576166-80576188 CAGGGTAACAGCGAAGAGGATGG - Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130789143 15:87133492-87133514 CAGGGTCTCAAGGAGAAGGGAGG + Intergenic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132812670 16:1809021-1809043 CAGTGGCTCACGGAGGAGGAAGG + Exonic
1132903548 16:2271019-2271041 CTGGGACACAGGGATGAGGATGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133287192 16:4696051-4696073 CAGGGCCACCAGGATCAGGAAGG - Intergenic
1133382800 16:5345338-5345360 CAGGGGCACAATGGAGAGGAAGG - Intergenic
1134880263 16:17740043-17740065 CTGGGTCCCAAGGAAGAGGCTGG + Intergenic
1136142938 16:28298842-28298864 CCAGATCAGAAGGAGGAGGATGG - Intronic
1136561125 16:31039868-31039890 CAGGGTCTGAGGGAGGAGGGAGG - Intronic
1136867546 16:33769432-33769454 CAGAGCCACAGTGAGGAGGACGG - Intergenic
1137055637 16:35745493-35745515 CAGGGTCACAAGGTACATGATGG + Intergenic
1137420503 16:48329306-48329328 CAGGGTCACACAGAGCAGGATGG - Intronic
1137825785 16:51493690-51493712 CAGGGCCACAGGGAGCAGGTGGG + Intergenic
1138562118 16:57807571-57807593 AAGGGACACAGGGAGCAGGAAGG - Intronic
1139342006 16:66273540-66273562 CAGGGTCAGAAGGCAGAAGAGGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140046912 16:71445889-71445911 CAGAGTGACAAGGAGTAGGGAGG - Intergenic
1140250136 16:73288106-73288128 CAGGGAGCCAAGGAGGAGGGTGG + Intergenic
1140506705 16:75478140-75478162 CATGGTGAGAAGGAGGATGAAGG - Exonic
1140585576 16:76287728-76287750 CAGGGTCACAGGGAGCAGTGAGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141608862 16:85170212-85170234 CAGGGGCGCGCGGAGGAGGAGGG + Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141814240 16:86398779-86398801 CAGCTTCACAAGCAGGAAGAAGG - Intergenic
1141990332 16:87605670-87605692 CAGGACCACAAGGAGGGGAAGGG - Intronic
1142026725 16:87818405-87818427 CTCGGTCAGAAAGAGGAGGAGGG + Intergenic
1142108380 16:88318333-88318355 CAGCGTCTCCAGGAGGAGGCTGG - Intergenic
1142205323 16:88780125-88780147 CAGGGTCACTGGGAGGACGGGGG - Intronic
1203104615 16_KI270728v1_random:1346771-1346793 CAGAGCCACAGTGAGGAGGACGG + Intergenic
1203128899 16_KI270728v1_random:1615597-1615619 CAGAGCCACAGTGAGGAGGACGG - Intergenic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1143628777 17:8125466-8125488 CAGGTTCCCAAGGAGGGGGGCGG - Intergenic
1143728723 17:8867716-8867738 GAGGGCCACAAGGAAGGGGAAGG - Intergenic
1143894602 17:10126146-10126168 CAGGGACTCAAGGAAGGGGAAGG + Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145754761 17:27382324-27382346 CATGGAGACAGGGAGGAGGAGGG - Intergenic
1145901631 17:28493943-28493965 CAGGGCCACAGGGTGGAGGGTGG - Intronic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146464621 17:33076353-33076375 CAGGCTCACATAAAGGAGGAGGG - Intronic
1146650198 17:34601810-34601832 AGGGGTCACAAGGTTGAGGAAGG - Intronic
1146704203 17:34988543-34988565 AATGGTCACAAGGAGGTGAAAGG + Intronic
1146943087 17:36857337-36857359 CAGGGAGACAAGGCGGAGGGAGG - Intergenic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1147637320 17:41972044-41972066 CAGGGACACATGGGGGAGGTGGG + Intronic
1147970757 17:44218452-44218474 GGGGGTCACGAGGAAGAGGAGGG - Intronic
1148208569 17:45794641-45794663 GAGTGTGACAAGGAGGGGGAAGG - Intronic
1148387306 17:47243576-47243598 CAGGGTCCCAAGGAGGGCGACGG + Intergenic
1148667271 17:49383964-49383986 CAGGGTTCCAAGGTGGATGAGGG - Intronic
1148823616 17:50376157-50376179 CAGTGTCACTTGGAGGAGAAGGG + Exonic
1148999170 17:51739478-51739500 CAGAGTCAAGTGGAGGAGGATGG + Intronic
1149221183 17:54416584-54416606 CAGGGTCACAAGGTGCAGGGTGG - Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150781080 17:68122647-68122669 AGGGGTCACAAGGTGCAGGATGG + Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152185834 17:78855870-78855892 GAGGGGCACACGGAGGGGGACGG + Intronic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152342134 17:79731153-79731175 CAGAGCCACAGTGAGGAGGACGG - Exonic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1153927544 18:9847355-9847377 CAGGGAGCTAAGGAGGAGGAGGG - Intronic
1154048148 18:10927070-10927092 CTGGGTCACACGCGGGAGGAGGG + Intronic
1154093010 18:11382166-11382188 CAGGGTCACAAGTCTCAGGATGG + Intergenic
1154122474 18:11663127-11663149 CAGGTAACCAAGGAGGAGGAGGG + Intergenic
1156495749 18:37524302-37524324 GAGGGTGACAAGGTGGAAGAAGG + Intronic
1156849461 18:41709339-41709361 AACGCTCACAAGGAGTAGGAGGG + Intergenic
1157494089 18:48142864-48142886 GAGGAGCAAAAGGAGGAGGAAGG - Intronic
1158038965 18:53069718-53069740 CAGGGTCAGAGAGGGGAGGATGG - Intronic
1158880873 18:61778656-61778678 CAGGGAGATAAGGACGAGGAGGG + Intergenic
1159359992 18:67387897-67387919 CAGTGTCACTAGGAGGTGGCAGG - Intergenic
1159934284 18:74349989-74350011 TAGGAGCACAAGGAGGAGGGTGG + Intronic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160954582 19:1684643-1684665 CAGGGTCTCAAGCAGGGGGAGGG + Intergenic
1161672865 19:5623759-5623781 CAAGGTCACACGGCCGAGGACGG + Intronic
1162308144 19:9888182-9888204 AAGGGTCTGAAGGAGGTGGAAGG - Intronic
1162531680 19:11239744-11239766 CAGGGTCCCATGGAAGAGCAGGG - Exonic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163218306 19:15896832-15896854 CAAGGTCACGGGGAGGAGAAAGG + Intronic
1163418815 19:17202815-17202837 GAGGAACACAAGGAGGAGGTTGG - Intronic
1163427720 19:17248200-17248222 CAAGGTCACATGTGGGAGGACGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1165143959 19:33719696-33719718 CAGGGTCCTAAAGAGGGGGATGG + Intronic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165741868 19:38209696-38209718 CGGGGCCTCGAGGAGGAGGAGGG - Intergenic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166364055 19:42269615-42269637 CAGGGTGACAGGGAGAGGGAGGG + Intronic
1166380392 19:42352497-42352519 CTGGGGCACATGGAGGTGGAGGG + Intronic
1166532917 19:43553252-43553274 CTGGGTCTCAGGGTGGAGGAAGG - Intronic
1166569167 19:43782885-43782907 CTAGGACACAAGGAGGGGGAGGG - Intergenic
1166643391 19:44513143-44513165 CAGGGATACAGGGAGGGGGATGG - Intronic
1166688458 19:44809476-44809498 CAGGGTCTGAGGGAGGAGGCAGG - Intronic
1166755090 19:45185716-45185738 CAGGGCCAGAATGAGGAGCAGGG + Intronic
1166859954 19:45804367-45804389 GAGGGCGACGAGGAGGAGGAAGG - Exonic
1166995773 19:46719118-46719140 CAGGCCCACAAGGAGCAGGGAGG - Intergenic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167568535 19:50272280-50272302 AAGGGGCACAGGGAGGAGGCAGG + Intronic
1167583760 19:50361484-50361506 GTGCGTCACAAGGAGGGGGAGGG - Intronic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168104907 19:54160714-54160736 CTGGGTCCGAAGGAGGAGGTGGG - Intronic
1168128990 19:54305412-54305434 CAGGGACAGAAGGAGTAGGTGGG + Intergenic
1168131193 19:54320411-54320433 CATGCTCACCAGGATGAGGATGG + Intergenic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168179173 19:54648624-54648646 CATGCTCACCAGGACGAGGATGG - Intronic
1168405307 19:56107570-56107592 AAGGGTCACCAGGAGAAAGAGGG + Intronic
1168540688 19:57207213-57207235 CAGGGACTCATGGAGGTGGAGGG - Intronic
1168545975 19:57250122-57250144 CAGGGACTCATGGAGGTGGAGGG - Intronic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
925617106 2:5754149-5754171 CAGCCTCGCAAGGAGGAGGCTGG + Intergenic
925900973 2:8509120-8509142 CAGGTTCACAAGGAGGCTCAGGG - Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926178359 2:10617169-10617191 CAGGGACCCAAGGGGCAGGAGGG + Intronic
926549119 2:14279776-14279798 GGGGGTCTCAAAGAGGAGGATGG - Intergenic
926791066 2:16572264-16572286 CAGGGTCATAATGAAGATGATGG + Intronic
927648897 2:24899015-24899037 CAGGGTGACAAGGGGCATGAGGG - Intronic
932103687 2:68923969-68923991 CAGGGACTCATGGAGGGGGATGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933660071 2:84920427-84920449 CAAGGTCAGAAGAAGAAGGATGG - Intergenic
934040265 2:88122463-88122485 CAGGGGCAGAAGGTAGAGGAAGG - Intergenic
934882857 2:97998279-97998301 GAGGGACACTAGGAGCAGGAGGG + Intergenic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938291017 2:130150578-130150600 CTGGGGCACAAGGAGGAGGGAGG - Intergenic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
938465527 2:131522378-131522400 CTGGGGCACAAGGAGGAGGGAGG + Intergenic
938473821 2:131589903-131589925 CAGGGTCACAGGGAGCAGCTGGG - Intergenic
938538515 2:132265685-132265707 CAGGCTCACAAGGATGCTGACGG + Intergenic
939045475 2:137245056-137245078 GAGGGAGACGAGGAGGAGGAGGG - Intronic
940152187 2:150614899-150614921 CAAGGACACAGAGAGGAGGAGGG - Intergenic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
942047624 2:172109019-172109041 CATGGACACAAGGAGGGGAACGG + Intergenic
942326671 2:174781940-174781962 GGGGCTCACACGGAGGAGGAGGG + Intergenic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
944499369 2:200342456-200342478 CAGCATCAGACGGAGGAGGAAGG - Intronic
944523111 2:200591311-200591333 CATGGGAACAAAGAGGAGGATGG + Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
946136935 2:217655287-217655309 CAGAGGCTCAAGGATGAGGAAGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
947044554 2:225966470-225966492 TGCGGTCACAAGGAGGAGAAAGG - Intergenic
947618597 2:231574359-231574381 CAGGGACACAAGGCTGAGGAGGG + Intergenic
947969792 2:234313409-234313431 CAGTGTAACAAGGAAAAGGAAGG - Intergenic
948774253 2:240273974-240273996 AAGGGTCACAGGCAGGAAGAGGG + Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1169316293 20:4593309-4593331 CAGGGGCACAGGAAGAAGGAGGG - Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1171132805 20:22669747-22669769 CAGGGTCTCAAGGAAGAGCTAGG + Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171431798 20:25087616-25087638 CAGGGACAAAAGGAGAGGGAGGG + Intergenic
1171442839 20:25179325-25179347 TAGTATCACAAGGAGGAGGCTGG - Intergenic
1171811839 20:29750676-29750698 CAGGCTCACAAGGATGCTGACGG + Intergenic
1171867417 20:30497483-30497505 CAGGCTCACAAGGATGCTGACGG + Intergenic
1171907832 20:30915032-30915054 CAGGCTCACAAGGATGCTGATGG - Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173581449 20:44149570-44149592 CAGGGTCACAGGCAGTGGGATGG - Intronic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173798720 20:45881054-45881076 CAGGGTTACAAGGAGCTGGCTGG - Intergenic
1173940932 20:46910571-46910593 CAGGATCACTAGGAGTAGAAGGG + Intronic
1174280195 20:49433704-49433726 CAGGGTCACTAGGTGTAGGTAGG + Intronic
1175100440 20:56575343-56575365 GAGGGTCAGAGGGAGGAGGCGGG - Intergenic
1175779045 20:61670740-61670762 CAGGGTGTCAACGAGGATGAGGG + Intronic
1176553051 21:8238443-8238465 CAGGCTCACAAGGATGCTGACGG - Intergenic
1176571973 21:8421467-8421489 CAGGCTCACAAGGATGCTGACGG - Intergenic
1176579882 21:8466050-8466072 CAGGCTCACAAGGATGCTGACGG - Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177868569 21:26543143-26543165 CAGGGACACAGGGAGGGGAACGG + Intronic
1178727010 21:35062113-35062135 AAGGGAGACAGGGAGGAGGATGG - Intronic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1180050901 21:45330605-45330627 CAGGGCCTCAGGGTGGAGGATGG + Intergenic
1180050934 21:45330695-45330717 CAGGGCCTCAGGGTGGAGGATGG + Intergenic
1180050943 21:45330726-45330748 CAGGGCCTCAGGGTGGAGGATGG + Intergenic
1180081692 21:45490248-45490270 AAGGGTCACATGGAGGACGCAGG - Intronic
1180314082 22:11262332-11262354 CAGGCTCACAAGGATGCTGACGG + Intergenic
1180341276 22:11621202-11621224 CAGGCTCACAAGGATGCTGATGG - Intergenic
1180469272 22:15641225-15641247 GAGGGTGGCAAGGAGGAGCAGGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181113166 22:20613618-20613640 CATGGTCAGAAGCAGGAGGTGGG + Intergenic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181286570 22:21756767-21756789 CATCTACACAAGGAGGAGGAAGG - Exonic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182143803 22:27984461-27984483 CAGAGTGACAAGGATGAGGAGGG - Intronic
1182772855 22:32808378-32808400 GATGGTCACAAGGAGGAGGATGG + Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183030876 22:35103784-35103806 CAAGGTCACCAGGAGGTCGATGG + Intergenic
1183694755 22:39415442-39415464 CAGGGTCTCACGGAGGTGGAGGG - Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184388638 22:44190578-44190600 CAGGGCCACAAGGAGGTGCAGGG - Exonic
1184431399 22:44443320-44443342 CAGGACCACAAGGAGAAGGTGGG + Intergenic
1184457761 22:44621160-44621182 CAGGGACACAACGATGGGGATGG + Intergenic
1184738808 22:46415102-46415124 CAGGAGCTCAGGGAGGAGGATGG + Intronic
1184939144 22:47748169-47748191 AAGGGGCAGAGGGAGGAGGATGG + Intergenic
1185050722 22:48552771-48552793 CAGGCTCCCAGGGAAGAGGAGGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1203258049 22_KI270733v1_random:155485-155507 CAGGCTCACAAGGATGCTGACGG - Intergenic
949517701 3:4822065-4822087 CAGGGTCACACGGCGAGGGAAGG - Intronic
949980888 3:9501102-9501124 CAGGGTAACAAGGCTTAGGAAGG + Exonic
950634324 3:14304241-14304263 CAGAGTCACAGGGAGGACGGAGG - Intergenic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
953299104 3:41753626-41753648 AAGGCTCAGAAGGAGGAGCAGGG - Intronic
953468557 3:43146818-43146840 CCCAGTCACCAGGAGGAGGAGGG - Intergenic
953677655 3:45015914-45015936 CTGGGTCACATGGAGCAGGAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954602809 3:51883932-51883954 AAGGGTCGCAGGGAGGAGGCGGG + Intergenic
954853094 3:53619642-53619664 CAGGGTCCCAATGCCGAGGAAGG - Intronic
958485233 3:94697583-94697605 TGGGGACACAAGGAGTAGGAGGG + Intergenic
959191721 3:103121049-103121071 CAGATTCAGAAGCAGGAGGATGG + Intergenic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960302506 3:116021044-116021066 GAGTGTCACAAGGAGGAAGCAGG + Intronic
961356209 3:126341569-126341591 CATGGTCCCGAGGAGGAGGCTGG - Intergenic
961695039 3:128698575-128698597 CCGGGTCAGAAGGAGGCGGCCGG - Intergenic
962042671 3:131723406-131723428 TAGGATGGCAAGGAGGAGGAAGG + Intronic
962107371 3:132405400-132405422 CTGGGTCACAAGGAGGAAATAGG + Intergenic
963112626 3:141699792-141699814 CAGGGTAAGAATGAGTAGGAGGG + Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
965726755 3:171725223-171725245 CAGTGTCACAATGTTGAGGAGGG - Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
967308339 3:188081833-188081855 CAAGGTTACAAGGATCAGGATGG - Intergenic
968337112 3:197923386-197923408 AAAGGTCACTAGGAGGTGGAAGG - Intronic
968440462 4:621372-621394 CAGGGCTACAAGGAGGTGAATGG + Intergenic
969652583 4:8476659-8476681 GAGGGTCTCATGGAGGAGGGAGG - Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971856540 4:32052009-32052031 TAGGGTAACAAGGTGCAGGATGG - Intergenic
972638680 4:40906551-40906573 CAGAGTCCCAATGAGGAGGGAGG + Intronic
972716615 4:41652805-41652827 CATGATCACATGGAGAAGGATGG + Intronic
973334706 4:48944410-48944432 CAGGCTCACAAGGAGAAAGGGGG - Intergenic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
979670661 4:123357241-123357263 GAGGGCCACAAAGAGGAGGGAGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
984843180 4:184087126-184087148 CATGGACACAGGGAGGAGAACGG - Intergenic
985779851 5:1864829-1864851 CAGGGTCAGAGCCAGGAGGAGGG - Intergenic
986758799 5:10861286-10861308 CAGGGCCACAGAAAGGAGGAGGG + Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
988611960 5:32735245-32735267 CAGAGCCAGATGGAGGAGGAGGG - Intronic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
990037927 5:51345484-51345506 CAGGAGCATAAGGAGGAGGGAGG + Intergenic
990604675 5:57396577-57396599 CAGGGTCAAAAGGCATAGGATGG - Intergenic
992332827 5:75735089-75735111 CAGTGACACAAGAATGAGGACGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995494324 5:112725450-112725472 CAGTTTCAAAAGGAGAAGGAGGG + Intronic
995840040 5:116435452-116435474 CAGGGCCACAATGAGCAGCAAGG - Intergenic
996490278 5:124086602-124086624 CAGTTTCCCAAGAAGGAGGAAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998920166 5:147059455-147059477 CAGGGTCACCAGGAGAGGAATGG + Intronic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1000148450 5:158476098-158476120 CAGGCTCACAAGAAAGTGGAGGG + Intergenic
1000925397 5:167187670-167187692 GAGGAACACAAGGAGTAGGAGGG - Intergenic
1000927928 5:167216308-167216330 AAGGATCACCAGGAGGAAGAAGG + Intergenic
1001168195 5:169390981-169391003 GATGGTGAGAAGGAGGAGGATGG + Intergenic
1001482762 5:172099943-172099965 CAGCGTCCTTAGGAGGAGGAAGG + Intronic
1001787231 5:174424339-174424361 CAGGCCCAGAAAGAGGAGGAGGG - Intergenic
1001949448 5:175806054-175806076 CAGGGGCTCAAGGATGAGAAAGG - Intronic
1001961364 5:175882121-175882143 CAGGGGCACAAGGTGGGGGCGGG - Exonic
1002167597 5:177358089-177358111 CAGGGCCACGAGGAGGGGGTGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003380954 6:5624342-5624364 CAGGGCAACAAGGAGGAACAAGG - Intronic
1003406345 6:5829899-5829921 CAGGAGCACAGGGAGGACGAGGG + Intergenic
1003924729 6:10867016-10867038 CATGGACACAGGGAGGAGGGAGG + Intronic
1004474853 6:15961795-15961817 CAGAGTCACAGGGAGCAAGAGGG - Intergenic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1005046460 6:21647718-21647740 CTGGGTCACATGGAGGACAAAGG - Intergenic
1005434382 6:25792663-25792685 AAGCTTGACAAGGAGGAGGATGG - Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006376962 6:33677012-33677034 CAGCGTCCCACGGACGAGGAGGG + Exonic
1006387485 6:33739413-33739435 AAGGGGCAGAAGGAGGAGGGAGG + Intronic
1007167721 6:39840886-39840908 CAGGATGCTAAGGAGGAGGAAGG + Intronic
1007282326 6:40721763-40721785 CAGGGCCCCAGGGAGGAAGACGG - Intergenic
1007617396 6:43188254-43188276 CAAGGTCAAAAGGAAGAAGATGG - Intronic
1008222005 6:48865584-48865606 TAGGGTAGCAAGGAGAAGGAAGG + Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008815494 6:55559558-55559580 CAGGGGCACAAGAAGGAGCGTGG + Intronic
1009593674 6:65708606-65708628 GAGGGACACAGGGAGGGGGAAGG - Intergenic
1010609942 6:77942260-77942282 AAGGATTACAAAGAGGAGGAAGG - Intergenic
1011249868 6:85359762-85359784 CTGGGACTCAGGGAGGAGGATGG + Intergenic
1011921966 6:92589172-92589194 CAGTGTCACACGGAGCAGGCTGG - Intergenic
1012246394 6:96930817-96930839 CCTGGTCACAAGGAAAAGGAGGG + Intronic
1012477010 6:99624658-99624680 CATGGTTAAAAGGAGAAGGAAGG + Intergenic
1013233479 6:108176565-108176587 CGTGGACACAAGGAGGAGAACGG + Exonic
1013481342 6:110555418-110555440 CTGGGACAGAAGGAGGAGGCGGG + Intergenic
1013822646 6:114174029-114174051 CAAGGTCACAATCAGGGGGAGGG - Intronic
1014151184 6:118057401-118057423 GATGGTCCCAAGCAGGAGGAGGG + Intronic
1017351514 6:153448149-153448171 CAGGGTCTCAAGGTGCAGGAGGG + Intergenic
1017931658 6:158960667-158960689 CAGGGTCCCAAGGTGGTGCAGGG + Intergenic
1018346443 6:162904102-162904124 GAGGTTCTGAAGGAGGAGGAAGG - Intronic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019531486 7:1505777-1505799 CAGGGTGACAAGGCAGAGGGAGG - Intergenic
1019895723 7:3981333-3981355 CAGGGGCCCAAGGAGACGGAGGG - Intronic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023560667 7:41470306-41470328 CAGAGTCTGAAGGAGGAGGGAGG - Intergenic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024236295 7:47401707-47401729 CACGGTCACAAGAAGCAGGGGGG - Intronic
1024626685 7:51213774-51213796 CAGAGCCACAGTGAGGAGGACGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1026631200 7:72039700-72039722 CAGGCTTAGAAGGAGGAGTAAGG + Intronic
1026641558 7:72130652-72130674 GATGGTGATAAGGAGGAGGAGGG + Intronic
1026880326 7:73903524-73903546 CAGAGCCACATGGAGGAGCAGGG - Intergenic
1026966238 7:74441878-74441900 CAGGCTCACATGGAGGCGGTGGG - Intergenic
1027661739 7:80996083-80996105 AATGGCAACAAGGAGGAGGATGG + Intergenic
1029036637 7:97529335-97529357 AAGGGTCTCAAGGGGTAGGAGGG - Intergenic
1029147394 7:98456570-98456592 GAGGGGCTCAGGGAGGAGGAGGG + Intergenic
1029160832 7:98550645-98550667 CATGGTCTGGAGGAGGAGGAAGG + Intergenic
1029620906 7:101689162-101689184 CAAGGTCACATGGGGGTGGATGG + Intergenic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030719128 7:112848593-112848615 CAGGATCAAATGGAGGGGGATGG + Intronic
1031027543 7:116696525-116696547 GAGGGTCTCAAGGAGGACGTTGG - Intronic
1031045077 7:116878654-116878676 CAGGGTCAAGTGGAGGGGGAAGG + Intronic
1032915339 7:136483203-136483225 AAGGGTCACAAGAAAGAGAAGGG - Intergenic
1034271452 7:149805282-149805304 AGGGCTCACAAGGAGGAGGGAGG - Intergenic
1034429418 7:151033772-151033794 CAGGGCCACAAGGCAGAGGTGGG - Exonic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036229564 8:6988227-6988249 CAGGGCCACCAGGAGAAGCATGG + Intergenic
1036232015 8:7007330-7007352 CAGGGCCACCAGGAGAAGCATGG + Intronic
1036288271 8:7463453-7463475 CAGGGCCACAAGGAGAAGGCTGG + Exonic
1036333204 8:7848075-7848097 CAGGGCCACAAGGAGAAGGCTGG - Exonic
1036414849 8:8537510-8537532 CATAGGCAGAAGGAGGAGGATGG - Intergenic
1037274844 8:17166748-17166770 AAGGGTGTCAAGGAGGAGGGAGG + Intronic
1037440628 8:18912697-18912719 CAGGTTGCCAAAGAGGAGGAGGG - Intronic
1037662473 8:20939610-20939632 AAGTGACACAGGGAGGAGGATGG + Intergenic
1037758475 8:21726633-21726655 CAGAGACACAAGGAAGAAGATGG - Intronic
1038625944 8:29193323-29193345 GAGGAGCAAAAGGAGGAGGATGG + Intronic
1042752656 8:72175070-72175092 CAATGTTACAAGGTGGAGGAAGG + Intergenic
1043526957 8:81107596-81107618 CAAGGTCACAGTGAGGATGAAGG + Intronic
1044725479 8:95191189-95191211 CAGGGTGACATGCAGGTGGATGG + Intergenic
1044847775 8:96398882-96398904 GAGAGTGAAAAGGAGGAGGAGGG - Intergenic
1045184478 8:99823177-99823199 CAAGGTCACAAAGATGAAGAGGG - Intronic
1045554399 8:103201460-103201482 CTGTGTCACACGGAAGAGGAAGG + Intronic
1046099607 8:109599674-109599696 CAGGGCCACAAGGAGCAGCTGGG - Intronic
1046260593 8:111762665-111762687 CATGGACACAGGGAGGGGGAGGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1048457658 8:134592566-134592588 CAGGGTCACAGGAAGGATAAGGG + Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049220296 8:141425897-141425919 CAGGGTCGCAAGGCTGGGGAGGG - Intronic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1049352827 8:142173161-142173183 CAGGCTCACGAGGAGAAGGATGG + Intergenic
1049653622 8:143788280-143788302 GGGGGTCACAGTGAGGAGGAAGG - Intergenic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050371240 9:4923581-4923603 CTGGCTCACAAGGAGAAGAATGG - Intergenic
1052332702 9:27286253-27286275 GAGGACCACAAAGAGGAGGAGGG + Exonic
1053075215 9:35127289-35127311 CAGGGGCTCAAGGTGCAGGAGGG - Intergenic
1053283183 9:36834834-36834856 CAGGGTCACAGGGTGGGGGGCGG + Exonic
1053654050 9:40197578-40197600 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054366165 9:64343794-64343816 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054673795 9:67833524-67833546 GAGGGTGACGAGGAGGAGAAGGG + Intergenic
1055581454 9:77711079-77711101 AAGGGGGACAGGGAGGAGGAGGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056154209 9:83818058-83818080 CGGGGTCACAGGGAAGAGAAGGG + Intronic
1056356298 9:85805051-85805073 CGGGGTCACAGGGAAGAGAAGGG - Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057353749 9:94319453-94319475 CAGGTTCAGAGGGAGTAGGATGG - Intronic
1057654001 9:96938139-96938161 CAGGTTCAGAGGGAGTAGGATGG + Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059977155 9:119729820-119729842 CAGGTTGAGAAGGAGAAGGAGGG + Intergenic
1060143218 9:121228189-121228211 TGGGGACAGAAGGAGGAGGAAGG - Intronic
1060394651 9:123306965-123306987 CAAGGTCACAAGTAAGAGGCGGG + Intergenic
1060550108 9:124481023-124481045 CAGGGTCCCAGGGATGAGGTGGG + Intergenic
1060552830 9:124493685-124493707 CAGGCTCAGGAGGAGGAGGGAGG + Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062201578 9:135305734-135305756 CAGGCTGCCAAGGAGCAGGAGGG - Intergenic
1062268921 9:135699917-135699939 CAGGGACACAGGGAGGGGGAAGG + Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1203474243 Un_GL000220v1:137508-137530 CAGGCTCACAAGGATGCTGACGG - Intergenic
1203362394 Un_KI270442v1:228451-228473 CAGGCTCACAAGGATGCTGATGG + Intergenic
1186063875 X:5740485-5740507 CAGGGACTCAGGGAGGGGGATGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1186966184 X:14788520-14788542 CAAGGTTAGAAGGAGGAGAAGGG - Intergenic
1187956690 X:24525520-24525542 TTGGGTCATGAGGAGGAGGAAGG + Intronic
1188006369 X:25018133-25018155 CAGCTGCACAAGGGGGAGGAGGG - Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1189847283 X:45149232-45149254 CAGAGTCCCACGGAGGAAGAAGG - Exonic
1189847596 X:45151116-45151138 CAGGGCCATAGGGAGCAGGAAGG + Exonic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1194596245 X:95862151-95862173 GAGGGTATCAAGCAGGAGGAAGG + Intergenic
1194696500 X:97058500-97058522 CAGTGTCAAAAGTAGCAGGAAGG - Intronic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1197709685 X:129656523-129656545 CTGGGTCTCAAGGATGAAGAGGG - Intergenic
1199993648 X:153004918-153004940 CAGTGTCACAAGGCTGAGCAGGG + Intergenic
1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG + Intergenic
1202379426 Y:24262530-24262552 CAGGCTGACAAGCAGGCGGATGG - Intergenic
1202491356 Y:25407591-25407613 CAGGCTGACAAGCAGGCGGATGG + Intergenic