ID: 1080383354

View in Genome Browser
Species Human (GRCh38)
Location 11:31796467-31796489
Sequence CTGGGGGGATGGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2798
Summary {0: 1, 1: 0, 2: 29, 3: 285, 4: 2483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080383339_1080383354 16 Left 1080383339 11:31796428-31796450 CCGAAGAGCGGGCGCCTCCGTGC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG 0: 1
1: 0
2: 29
3: 285
4: 2483
1080383344_1080383354 -1 Left 1080383344 11:31796445-31796467 CCGTGCTATTTAGGGCGCTTGGC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG 0: 1
1: 0
2: 29
3: 285
4: 2483
1080383342_1080383354 2 Left 1080383342 11:31796442-31796464 CCTCCGTGCTATTTAGGGCGCTT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG 0: 1
1: 0
2: 29
3: 285
4: 2483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080383354 Original CRISPR CTGGGGGGATGGAGGGTGGA TGG Intronic
Too many off-targets to display for this crispr