ID: 1080384699

View in Genome Browser
Species Human (GRCh38)
Location 11:31804445-31804467
Sequence CCCCACCCGCGCCTTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080384699_1080384711 19 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384711 11:31804487-31804509 GAGAAGTGACAGGCGTTTGGGGG 0: 1
1: 0
2: 3
3: 15
4: 142
1080384699_1080384710 18 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384710 11:31804486-31804508 TGAGAAGTGACAGGCGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 144
1080384699_1080384707 9 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384707 11:31804477-31804499 TCAACTCGATGAGAAGTGACAGG 0: 1
1: 0
2: 1
3: 3
4: 76
1080384699_1080384708 16 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384708 11:31804484-31804506 GATGAGAAGTGACAGGCGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 166
1080384699_1080384712 25 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384712 11:31804493-31804515 TGACAGGCGTTTGGGGGATCTGG 0: 1
1: 0
2: 0
3: 14
4: 118
1080384699_1080384709 17 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384709 11:31804485-31804507 ATGAGAAGTGACAGGCGTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 100
1080384699_1080384713 26 Left 1080384699 11:31804445-31804467 CCCTCACCAAGGCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1080384713 11:31804494-31804516 GACAGGCGTTTGGGGGATCTGGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080384699 Original CRISPR CCCCACCCGCGCCTTGGTGA GGG (reversed) Intronic