ID: 1080385475

View in Genome Browser
Species Human (GRCh38)
Location 11:31808493-31808515
Sequence TACTACTCCTTTGCAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080385475_1080385487 14 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385487 11:31808530-31808552 GAATGGAATTCCCCTAGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 96
1080385475_1080385481 -9 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385481 11:31808507-31808529 GGAGTAGTAGGTGGGGAGATGGG 0: 1
1: 0
2: 0
3: 34
4: 461
1080385475_1080385482 -8 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385482 11:31808508-31808530 GAGTAGTAGGTGGGGAGATGGGG 0: 1
1: 0
2: 2
3: 59
4: 466
1080385475_1080385485 12 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385485 11:31808528-31808550 GGGAATGGAATTCCCCTAGGAGG 0: 1
1: 0
2: 2
3: 8
4: 91
1080385475_1080385484 9 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385484 11:31808525-31808547 ATGGGGAATGGAATTCCCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1080385475_1080385483 -3 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385483 11:31808513-31808535 GTAGGTGGGGAGATGGGGAATGG 0: 1
1: 0
2: 13
3: 195
4: 1362
1080385475_1080385486 13 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385486 11:31808529-31808551 GGAATGGAATTCCCCTAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 112
1080385475_1080385480 -10 Left 1080385475 11:31808493-31808515 CCTGAAGCTGCAAAGGAGTAGTA 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1080385480 11:31808506-31808528 AGGAGTAGTAGGTGGGGAGATGG 0: 1
1: 0
2: 4
3: 71
4: 812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080385475 Original CRISPR TACTACTCCTTTGCAGCTTC AGG (reversed) Intronic
907611585 1:55876396-55876418 CACTACTCCATTGCATCTCCTGG + Intergenic
907824499 1:58002000-58002022 TTCTTGCCCTTTGCAGCTTCTGG - Intronic
908309497 1:62863845-62863867 TGCTACTCCTTTGCCTGTTCTGG - Intronic
908384014 1:63623364-63623386 TACGACACTGTTGCAGCTTCAGG + Exonic
916209906 1:162351964-162351986 AAGTGCACCTTTGCAGCTTCTGG + Intronic
917094218 1:171383684-171383706 ATCTATTTCTTTGCAGCTTCTGG + Intergenic
918139394 1:181707713-181707735 TACTCCTCCTTTTAAGCCTCTGG + Intronic
919913856 1:202128351-202128373 TGCTGCTCCTTTGCATCTGCAGG + Exonic
920506285 1:206517669-206517691 TACTAGGGCTTGGCAGCTTCTGG + Intronic
920674372 1:208029139-208029161 TTTTACTCCTTTGCCCCTTCAGG - Intronic
923665152 1:235992772-235992794 TACTGTTTCTTAGCAGCTTCGGG + Intronic
924248471 1:242107755-242107777 TTCGACTCCTTTTAAGCTTCTGG - Exonic
1063086679 10:2824758-2824780 TATTACTCCTTTGCAGATTTTGG + Intergenic
1067820182 10:49521441-49521463 TACTACTGCTTTGCACATTGTGG - Intronic
1070129172 10:73645039-73645061 TATTGCTTCTTTTCAGCTTCAGG - Exonic
1071226019 10:83528387-83528409 TACTTCCCCTTTCCAGCTTCTGG - Intergenic
1071403017 10:85296668-85296690 TATTCCTTCTTTGCTGCTTCTGG - Intergenic
1072868569 10:99091164-99091186 TATTAGTCCTTAGCAGTTTCTGG + Intronic
1074623803 10:115155583-115155605 TGTTACTCCTTTACAGCTTAAGG + Intronic
1075942530 10:126403841-126403863 TCCTGCTCCTTTGCACCTCCAGG - Intergenic
1078491771 11:11776065-11776087 TGCTTCTCCTTTGCAGCTCCCGG + Intergenic
1079558783 11:21794810-21794832 CACCACTCCTTCCCAGCTTCTGG - Intergenic
1080385475 11:31808493-31808515 TACTACTCCTTTGCAGCTTCAGG - Intronic
1080543500 11:33293062-33293084 TACTACACATTTGCAGCCACAGG - Intronic
1081871135 11:46382983-46383005 AACTACTCCATTGGAGCATCTGG + Intronic
1084288161 11:68145301-68145323 GGCCAGTCCTTTGCAGCTTCTGG + Intergenic
1087894103 11:103568648-103568670 TATTAGTCCTTTGTAGATTCTGG + Intergenic
1089235122 11:117017673-117017695 TACAACTCCTTTGCACCTAAAGG + Intronic
1089697361 11:120224477-120224499 CACTAATACATTGCAGCTTCGGG + Intronic
1090441623 11:126729502-126729524 TGCTTCTCCTTTGCAGCCTCAGG + Intronic
1092984989 12:13836791-13836813 TGCTTCTCCTTCTCAGCTTCTGG - Intronic
1095067418 12:37795405-37795427 AACTATCCCTTTGCAGATTCTGG - Intergenic
1095784282 12:46092715-46092737 TACTTCTCATTTGCAGGTTTGGG - Intergenic
1095900883 12:47327035-47327057 CACTACACCTGGGCAGCTTCTGG - Intergenic
1099795069 12:87389656-87389678 TACTTCTGCTTTGCTGCTTTTGG + Intergenic
1107768699 13:43766263-43766285 CACTGCTCCTGTGCACCTTCAGG - Intronic
1109470476 13:62798393-62798415 TATTAGTCCTCTGCAGCTACTGG - Intergenic
1111096044 13:83516972-83516994 TCCTACACCGGTGCAGCTTCGGG + Intergenic
1114367042 14:22040251-22040273 TTCAACTCCTTTGTAACTTCTGG + Intergenic
1116944655 14:50825176-50825198 TACCACTCCTTTGTAGCTGCAGG - Intronic
1117794375 14:59377054-59377076 TCCTACTCCTTTGCACATACCGG + Intergenic
1118110493 14:62712855-62712877 TGCTACCATTTTGCAGCTTCTGG + Intronic
1127936157 15:63640756-63640778 TAATACTCCTTTTCTGCTCCAGG + Intronic
1130937029 15:88479298-88479320 GACCACTCCTTCTCAGCTTCTGG - Exonic
1131880050 15:96852641-96852663 TACTACTCCTTTGCTCCTATTGG - Intergenic
1137223292 16:46477303-46477325 TTCTACTCCTCTGCACATTCTGG - Intergenic
1140188620 16:72795969-72795991 TACTCCTGCTTTGGAGGTTCCGG + Exonic
1142758686 17:2030406-2030428 TACCAGTCTTTTGCAGCTTTAGG + Intronic
1142956605 17:3527168-3527190 TAGTACCGCTTTGCAGGTTCTGG - Intronic
1148652136 17:49257903-49257925 TGCTCCTTCTTTACAGCTTCTGG - Intergenic
1156462186 18:37327330-37327352 TACTACTCCTTTCCTGGTCCTGG + Intronic
1157491909 18:48129501-48129523 TTCTACTCCTCTGCAGGTCCAGG + Intronic
1157536463 18:48462034-48462056 TAATACTCCATTTCAGCTGCTGG + Intergenic
1159036198 18:63279313-63279335 TAGGAGTTCTTTGCAGCTTCTGG - Intronic
1159523778 18:69561582-69561604 TATTACTCCTTTAGAGCTCCTGG - Intronic
1164850938 19:31483617-31483639 TGCTGCTCCTGTGCAGCCTCAGG - Intergenic
1167535448 19:50048070-50048092 CACTACTGCTCTGAAGCTTCTGG + Exonic
1168081361 19:54012571-54012593 TACAACTCATCTGCAGCTCCGGG + Exonic
930836761 2:55802475-55802497 TTTTGCTCCTTAGCAGCTTCTGG + Intergenic
935785383 2:106544178-106544200 TACAACTCCCATGCAGCTTCAGG - Intergenic
937677108 2:124603558-124603580 TATTATTCTTTTGCAGATTCTGG + Intronic
938678527 2:133664091-133664113 TACAACTCCTTTGGAGCTCTTGG + Intergenic
939003794 2:136764576-136764598 TCCACCTCCTTTGCTGCTTCCGG + Intergenic
940139004 2:150472928-150472950 TATTACTCCTTTGAATCCTCTGG - Intronic
940671268 2:156671250-156671272 TACTTCTCCTTTACACCTTCTGG - Intergenic
942381641 2:175397926-175397948 TGCTACACGTTTGCACCTTCTGG - Intergenic
943442872 2:187947716-187947738 TGCTAGTCTTTTCCAGCTTCTGG - Intergenic
943682228 2:190780650-190780672 TAATTCTCCTTTGCAGCTAGAGG + Intergenic
946610702 2:221454685-221454707 GACTACTCCTCTGGAGCCTCTGG + Intronic
948278175 2:236725926-236725948 TACTACATCTTTGAAGCTTTTGG - Intergenic
948655237 2:239472685-239472707 TATGGCTCCTTTGCATCTTCAGG + Intergenic
1169510494 20:6258912-6258934 TACTCCTTCTTCACAGCTTCTGG + Intergenic
1169696382 20:8391997-8392019 TACAATTCCTTTTCAGCTTTAGG + Intronic
1174970520 20:55270233-55270255 TTTTTCTCCTTTGCAGCCTCAGG - Intergenic
949419603 3:3851760-3851782 TGCTTTTCTTTTGCAGCTTCAGG - Intronic
949678315 3:6483433-6483455 TACTACTGCTTTGGAACTTAAGG + Intergenic
951542794 3:23798238-23798260 TACTACTGCTTTCCAGGATCTGG - Intergenic
954330384 3:49886804-49886826 TCCAACTCCTTTCCAGCCTCAGG + Intergenic
956599155 3:71000626-71000648 CACTTCTCCTTTGCATTTTCTGG - Intronic
960791648 3:121438293-121438315 TATTACTCTCTTGCATCTTCAGG + Intronic
962908210 3:139824519-139824541 TCCTGCTCCTTTGCAGGTTTTGG - Intergenic
971312618 4:25538520-25538542 GACTGCTCCTTTGTGGCTTCCGG + Intergenic
971343062 4:25788291-25788313 TACCACTCAATTGCTGCTTCGGG + Exonic
971597865 4:28554744-28554766 TCCTTGTCATTTGCAGCTTCTGG - Intergenic
973125983 4:46585469-46585491 GAATTCCCCTTTGCAGCTTCTGG - Intergenic
976242383 4:82971996-82972018 AACTAATGCTTAGCAGCTTCTGG + Intronic
976499048 4:85765571-85765593 TACTACTCTTTACAAGCTTCTGG + Intronic
978563263 4:110055555-110055577 AACTACACCTTTGCAGCTGCAGG + Intronic
980706222 4:136499206-136499228 AACTACTCCATAGCAGCTTTTGG - Intergenic
980709958 4:136552867-136552889 TACTCCTCCTTTTCAGATTCTGG + Intergenic
984145798 4:176058683-176058705 TACTACTCATTTCCAGCTGTGGG - Intergenic
988533154 5:32042703-32042725 GACTTCTCCTTTTCAGCCTCTGG - Intronic
990146943 5:52772150-52772172 TGCTAATACTTTGCATCTTCAGG + Intergenic
990607028 5:57421439-57421461 TACCACTCCTTTGCTGGTGCTGG - Intergenic
1002873955 6:1194147-1194169 TACTTCTCCTTTGTAGTTACAGG + Intergenic
1006728071 6:36214313-36214335 TCCTGCTCCTTGGCCGCTTCCGG - Exonic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1010188898 6:73174649-73174671 TACCTCTCCCTAGCAGCTTCAGG - Intronic
1010857749 6:80862694-80862716 TACTATTACTTTGCAGCTTTGGG - Intergenic
1011761804 6:90575455-90575477 CCTTACTCCTTTGAAGCTTCTGG - Intronic
1015416932 6:132959999-132960021 TTATGCTACTTTGCAGCTTCAGG + Intergenic
1021399350 7:20191654-20191676 CACTTCTCCTTTCCAGCTTCTGG - Intronic
1026331051 7:69352959-69352981 TAATACTCCTTTGATGCTTTGGG - Intergenic
1027338634 7:77181814-77181836 ACCTTTTCCTTTGCAGCTTCAGG + Intronic
1032123383 7:129173015-129173037 TCCTTGTCCTTTCCAGCTTCTGG + Intergenic
1032554059 7:132813078-132813100 TACTGCCCTTTTGGAGCTTCTGG - Intronic
1037702761 8:21290045-21290067 AACACCTTCTTTGCAGCTTCAGG + Intergenic
1040113549 8:43587846-43587868 AAATACCCCTTTGCAGATTCTGG - Intergenic
1040661716 8:49582727-49582749 TCATACCCCTTTGCAGCTTGGGG - Intergenic
1043679299 8:83001882-83001904 TATTAGTCCTTTGTAGATTCTGG - Intergenic
1043884420 8:85582321-85582343 TACTACTCCTTTGTATTTACAGG - Intergenic
1043889206 8:85637859-85637881 TACTACTCCTTTGTATTTACAGG + Intergenic
1046201965 8:110938772-110938794 TGCTACTCCTCTGCATCCTCAGG - Intergenic
1046956290 8:120066073-120066095 TACGTCTCCTTATCAGCTTCTGG + Intronic
1047054764 8:121151755-121151777 TACTTGTCTTTTCCAGCTTCTGG + Intergenic
1052704999 9:31983877-31983899 TACTGCTACTTATCAGCTTCCGG - Intergenic
1057922708 9:99111040-99111062 TACTATTTCTTTGCAACTGCAGG + Intronic
1061645674 9:131999141-131999163 AACTCTTTCTTTGCAGCTTCAGG - Intronic
1191880444 X:65839581-65839603 TACGACCCCTTTCCAGCTTGGGG - Intergenic
1197390420 X:125856468-125856490 TTCTAAACCTTTGCAACTTCTGG - Intergenic
1197454882 X:126666815-126666837 TAATACACATTTGCAGGTTCTGG + Intergenic
1200080226 X:153572581-153572603 TCCCACACCTTTGCTGCTTCTGG + Intronic