ID: 1080385983

View in Genome Browser
Species Human (GRCh38)
Location 11:31811538-31811560
Sequence GAATCTCGGCGTGCGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080385983_1080385995 30 Left 1080385983 11:31811538-31811560 CCGCTCCGCGCACGCCGAGATTC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1080385995 11:31811591-31811613 AGCGGTCAAGTGAAGGTTTCTGG 0: 1
1: 0
2: 1
3: 1
4: 76
1080385983_1080385994 23 Left 1080385983 11:31811538-31811560 CCGCTCCGCGCACGCCGAGATTC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1080385994 11:31811584-31811606 GAACTTGAGCGGTCAAGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1080385983_1080385992 12 Left 1080385983 11:31811538-31811560 CCGCTCCGCGCACGCCGAGATTC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1080385992 11:31811573-31811595 CCTGCTGCCGCGAACTTGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080385983 Original CRISPR GAATCTCGGCGTGCGCGGAG CGG (reversed) Intronic
902492464 1:16794438-16794460 GAAACAAGGCGTGAGCGGAGAGG - Intronic
923008071 1:230067579-230067601 GGAGCCCGGCGTGCGCAGAGGGG - Intronic
923527985 1:234788098-234788120 GAAACAAGGCGTGAGCGGAGAGG + Intergenic
1080385983 11:31811538-31811560 GAATCTCGGCGTGCGCGGAGCGG - Intronic
1081670152 11:44938236-44938258 GATCCTCGGCGTGGGCGGGGAGG - Exonic
1089599664 11:119605554-119605576 TAATCGGGGTGTGCGCGGAGAGG + Intergenic
1100869536 12:98895314-98895336 GCCTCCCGGAGTGCGCGGAGGGG - Intronic
1132105274 15:99058803-99058825 GCATCTGGGAGTGCGCGGAGTGG - Intergenic
1142059335 16:88019551-88019573 GGATCTCAGCGTGCGGGGGGCGG + Intronic
1142059359 16:88019631-88019653 GGATCTCAGCGTGCGGGGGGCGG + Intronic
1142059370 16:88019662-88019684 GGATCTCAGCGTGCGGGGGGCGG + Intronic
1142059381 16:88019693-88019715 GGATCTCAGCGTGCGGGGGGCGG + Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1160736201 19:663409-663431 GAAGCGGGGCGTGCGCGGGGCGG + Intergenic
929872519 2:45771157-45771179 GAATCTCAGCCTGGGAGGAGTGG - Intronic
948912264 2:241010578-241010600 GAATCTCAGCCTGCTCAGAGGGG + Intronic
1170332895 20:15234742-15234764 AAATCTCGGGGTGAGCGTAGGGG + Intronic
1183351076 22:37335060-37335082 GAACTTGGGCGTGGGCGGAGCGG + Intergenic
1183535282 22:38397834-38397856 GCACCTCGGGGTCCGCGGAGAGG + Intronic
969873095 4:10116683-10116705 GGCTCTCGGCGAGCGCGGCGCGG - Exonic
982320313 4:154070514-154070536 GACTCTCGGCGCTTGCGGAGGGG + Intergenic
995185862 5:109268964-109268986 GAATCTCTGCATGGGCTGAGTGG + Intergenic
1022103985 7:27185493-27185515 GCCTCCCGGCGCGCGCGGAGAGG + Intergenic