ID: 1080387829

View in Genome Browser
Species Human (GRCh38)
Location 11:31820022-31820044
Sequence TTCGGGCTGCGCGGGAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080387824_1080387829 -4 Left 1080387824 11:31820003-31820025 CCTGTCAATAAAGGGCGCGTTCG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387816_1080387829 20 Left 1080387816 11:31819979-31820001 CCACGGCCCCCGCCTGCTTATCT 0: 1
1: 0
2: 0
3: 16
4: 217
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387821_1080387829 8 Left 1080387821 11:31819991-31820013 CCTGCTTATCTGCCTGTCAATAA 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387819_1080387829 12 Left 1080387819 11:31819987-31820009 CCCGCCTGCTTATCTGCCTGTCA 0: 1
1: 1
2: 3
3: 30
4: 395
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387818_1080387829 13 Left 1080387818 11:31819986-31820008 CCCCGCCTGCTTATCTGCCTGTC 0: 1
1: 0
2: 1
3: 19
4: 251
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387817_1080387829 14 Left 1080387817 11:31819985-31820007 CCCCCGCCTGCTTATCTGCCTGT 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108
1080387820_1080387829 11 Left 1080387820 11:31819988-31820010 CCGCCTGCTTATCTGCCTGTCAA 0: 1
1: 0
2: 1
3: 33
4: 306
Right 1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080387829 Original CRISPR TTCGGGCTGCGCGGGAGCGC CGG Intronic
900190159 1:1349754-1349776 TGCGGGGCGCGCGGGGGCGCGGG + Intergenic
900483773 1:2911812-2911834 TGGGGGCTGCGGGGGAGCTCAGG + Intergenic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
916939067 1:169661462-169661484 CTCGGGCTGCACAGGAGCCCAGG - Intergenic
916940104 1:169668300-169668322 CTCGGGCTGCACAGGAGCCCAGG - Intronic
917693724 1:177495974-177495996 TTCGGGCTGTGTGGGAAGGCTGG - Intergenic
918407580 1:184226001-184226023 TTCTGGTTGCGCGGGAACCCAGG - Intergenic
923086238 1:230705514-230705536 TTCGGACTTCGCGTGAGCGGGGG - Intronic
924172631 1:241357398-241357420 GGCGGGGTGTGCGGGAGCGCGGG - Intergenic
924926865 1:248692038-248692060 TTCGCGTGGCGCGGGAGCGCGGG + Intergenic
1064209007 10:13347889-13347911 TCCGGGCCGCCCGGGACCGCCGG - Intronic
1067806281 10:49395562-49395584 CTAGGGCTGGGCGGGAGCGCTGG - Intronic
1069695379 10:70382078-70382100 TCCGGGCAGCGTGGGAGCCCCGG - Intronic
1069783195 10:70969615-70969637 TGGGGGCTGCGGGGGAGAGCAGG + Intergenic
1073465602 10:103693088-103693110 TTAGGGCCGGGCGCGAGCGCGGG + Intronic
1077192664 11:1261929-1261951 TCCGTGCTGCGCGGGCGCTCCGG - Exonic
1077266386 11:1652923-1652945 GCCGGGCTGCGCGGAAGCCCTGG + Intergenic
1079450558 11:20597235-20597257 TGGGGGCTGAGCGGGGGCGCTGG + Intergenic
1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG + Intronic
1089466362 11:118689046-118689068 CTCGGGCTGCACAGGAGCCCAGG + Intergenic
1094337901 12:29381165-29381187 TTCCGGGTACGCGGGAGCCCCGG - Intronic
1097165907 12:57086715-57086737 TGCGGGCTGCGGGGGCGCTCTGG + Intronic
1099204400 12:79711229-79711251 CTCAGGCTGCGCAGGAGCCCAGG - Intergenic
1101371875 12:104137994-104138016 CTCGGCCCGCGCGGGAGGGCGGG + Intronic
1104398495 12:128455808-128455830 TACGGGCTGTGGGGGAGCCCGGG + Intronic
1114679601 14:24473396-24473418 CTCAGGCTGCGCAGGAGCCCAGG - Intergenic
1123901124 15:24878295-24878317 TGCGGGCTGCGTGGCAGCGGTGG - Intronic
1129116417 15:73367785-73367807 TGCGGGCTGCGCCGAGGCGCCGG + Exonic
1129612318 15:77070790-77070812 TTGGGCCTGGGCGGGCGCGCGGG - Intronic
1129790927 15:78340241-78340263 TAGGGGCTGCGGGGGAGCGGGGG + Intergenic
1132382152 15:101373433-101373455 CTGGGGCAGCGCGGGAGCCCAGG + Intronic
1132572522 16:650184-650206 TGGGGGCTGCGTGGGAGCCCCGG + Intronic
1132778869 16:1612315-1612337 GCCGGGGTGCGCGGGCGCGCGGG - Exonic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1139528072 16:67528736-67528758 TGCGGGAGCCGCGGGAGCGCAGG + Intronic
1139676452 16:68526990-68527012 CTCGGGCTGCGCAGGAGCCTGGG - Intergenic
1142395177 16:89828118-89828140 CTGGGTCTGCGGGGGAGCGCCGG + Intronic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1151561594 17:74872826-74872848 TTGGGGCTGGATGGGAGCGCGGG - Intronic
1152724434 17:81938228-81938250 TCCGGGCTGCGTGGGAGTGGGGG - Intronic
1153480621 18:5543478-5543500 CTCGGGCTGGGGGCGAGCGCGGG - Intronic
1154326080 18:13391296-13391318 CTCGGGCTGTGGGGGAGGGCTGG + Intronic
1156099537 18:33577982-33578004 TTCGGCCTGAGCGGGACAGCGGG + Intergenic
1160613819 18:80109282-80109304 TTCTGGCTGCGCGGGAGGAGGGG + Exonic
1161266414 19:3366691-3366713 TGCGGGGGGCGCGGGGGCGCCGG - Intronic
1162396401 19:10420330-10420352 TCCGGGCTGGGAGGGGGCGCTGG - Intronic
1162951316 19:14073457-14073479 TCCAGGGCGCGCGGGAGCGCGGG - Exonic
1165780894 19:38433754-38433776 TGCGGGCTGGGCGGGAGGGCTGG - Intronic
1166315254 19:41985807-41985829 CTCGGGCTGCCCAGGAGCTCAGG - Intronic
1167074271 19:47239545-47239567 TGGGGGCTGGGCGGGGGCGCGGG + Intergenic
929452662 2:42047754-42047776 CGCGGGCTGGGCGGGACCGCGGG + Intergenic
929511464 2:42568718-42568740 CTCGGGCTCCGCGGGCGGGCGGG + Intronic
930089416 2:47520951-47520973 CTCGGGCGGCGTGGGCGCGCTGG - Exonic
930700678 2:54456263-54456285 CGGGGGCTGGGCGGGAGCGCGGG - Exonic
932316893 2:70790574-70790596 TGCGGGGTGCCCAGGAGCGCGGG + Exonic
938073997 2:128322421-128322443 TGCGGGCTGCCTGGGAGCCCAGG - Intergenic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
944496061 2:200307486-200307508 TCCGCGCTGCGCGGGTGGGCTGG + Intronic
946966571 2:225042755-225042777 TGCAGGCTGCGGGGGAGGGCGGG + Intergenic
948424145 2:237877136-237877158 TCCGGGCTGCAGGGGCGCGCGGG + Intronic
1170780737 20:19423298-19423320 TTGGGGCTGAGCGGGAAAGCAGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172966042 20:38835993-38836015 TGCGGGCTGCCCAGAAGCGCCGG + Exonic
1176679705 21:9812833-9812855 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1176681411 21:9821292-9821314 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1176681698 21:9822701-9822723 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176681976 21:9824110-9824132 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1176682257 21:9825511-9825533 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176682536 21:9826920-9826942 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176682814 21:9828339-9828361 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176683094 21:9829736-9829758 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176683373 21:9831146-9831168 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176683653 21:9832555-9832577 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176683932 21:9833958-9833980 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1176684210 21:9835367-9835389 TTCGGGCGGCGTGGGAGAGGGGG + Intergenic
1178981275 21:37267321-37267343 TTCCGGCTGCGCGTGACCCCAGG + Exonic
1181457967 22:23070371-23070393 GGCGGGCGGCGCGGGAGGGCGGG + Exonic
1185229079 22:49670272-49670294 CTCGGGCCGCGCAGGAGCCCAGG + Intergenic
953714662 3:45306978-45307000 CTCGGGCCGCGCAGGAGCCCAGG - Intergenic
954226164 3:49182735-49182757 CTCGGGCTGCACAGGAGCCCAGG + Intronic
968775120 4:2535959-2535981 TTCGGGCAGCGCTGGAAAGCCGG - Intronic
971457389 4:26857768-26857790 TGTGGGCTGTGCGGGAGCGAGGG + Intronic
977206566 4:94170135-94170157 CTGGGGCTGCGCAGGAGCCCAGG - Intergenic
982647703 4:158044417-158044439 CTCGGGCTGTGCAGGAGCCCAGG - Intergenic
983734753 4:171043448-171043470 CTCGGGATGCGCAGGAGCCCTGG - Intergenic
986729882 5:10627539-10627561 TTTGGGCTGCGGGGGAGCCCTGG + Intronic
987015107 5:13810190-13810212 TTCGCGCTGCTGTGGAGCGCGGG - Exonic
988554109 5:32221591-32221613 TTAGAGCTGTGCGGGAGCCCAGG - Intergenic
989812007 5:45688970-45688992 TTAAGGCTGAGCGGGAGGGCGGG + Intronic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1002021441 5:176366363-176366385 CTCGGGCTGCGGGGAAGCGGAGG - Exonic
1002524009 5:179805926-179805948 CTGGGGCCGCACGGGAGCGCAGG + Intronic
1003591651 6:7441501-7441523 CTCGGGCTGTGCAGGAGCCCAGG - Intergenic
1006717566 6:36130353-36130375 GTCGGGCCGGGCGGAAGCGCGGG + Exonic
1016329885 6:142945197-142945219 AGGGGGCCGCGCGGGAGCGCTGG - Exonic
1016461540 6:144284875-144284897 TGCGGGCTGGGAGGGCGCGCAGG + Intergenic
1017588746 6:155955286-155955308 TTAGGGCTGCTCTGGAGCCCTGG - Intergenic
1018551301 6:165001699-165001721 CTCGGGCTGCGCAGTAGCCCAGG + Intergenic
1019576269 7:1739148-1739170 TCAGGGCTGCGCGGGGCCGCAGG + Intronic
1019738717 7:2662571-2662593 TGCGGGCTGAGGGGGACCGCTGG + Exonic
1034990312 7:155543796-155543818 TTCTGGCTGAGCAGGAGCCCTGG + Intergenic
1037297183 8:17413454-17413476 CTAGGGCCGCGCGGGAGCCCCGG - Intronic
1053586526 9:39464432-39464454 TTAGGTCTGCGCGGGAGCCCAGG - Intergenic
1054579781 9:66900801-66900823 TTAGGTCTGCGCGGGAGCCGAGG + Exonic
1061211970 9:129198885-129198907 CTCGGGCTGCGCGGCAAGGCTGG + Intergenic
1061317157 9:129803444-129803466 TGCGGGGGGCGCGGGGGCGCGGG + Intronic
1061330675 9:129890358-129890380 CCCGGGCTGGGCGGGAGGGCAGG + Exonic
1061450230 9:130663708-130663730 CTAGGGCTGCGCGCGAGCTCGGG + Intergenic
1203664873 Un_KI270754v1:15368-15390 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1203665718 Un_KI270754v1:19594-19616 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1203666867 Un_KI270754v1:25232-25254 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1203668016 Un_KI270754v1:30871-30893 TTGGGGCGGCGTGGGAGCGGGGG + Intergenic
1189446661 X:41086265-41086287 CCCGGGCTGGGCGGGCGCGCGGG + Intronic
1199992310 X:152994053-152994075 GTCGCGCTGCGCGGGAACTCCGG - Intronic