ID: 1080389689

View in Genome Browser
Species Human (GRCh38)
Location 11:31833636-31833658
Sequence CTGTGGGTTTGAGGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080389689 Original CRISPR CTGTGGGTTTGAGGTGAAGA GGG Intronic
900485982 1:2923046-2923068 CTGTGGGTTAGAGGTAACCAGGG - Intergenic
900768486 1:4521132-4521154 CTGTGTGGTGGAGGTGGAGATGG - Intergenic
901278676 1:8013868-8013890 CGGTGGGTCTGAGGTGGAGGAGG + Exonic
901453057 1:9347874-9347896 CTGTGGGTGTGTGTTGAAGGGGG - Intronic
904001303 1:27340418-27340440 CTGTGGTTCTGAGGTGGAGGAGG + Intergenic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
909415562 1:75402270-75402292 CTATGGCTTTGGGGTAAAGAAGG + Intronic
910629988 1:89344459-89344481 CTGGGGGTTTGAGGTTTATATGG - Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
915216430 1:154343567-154343589 ATGTGGGTGTGAGGAGAGGAGGG + Exonic
917348003 1:174048899-174048921 CTGTGAGTTAGGGGAGAAGATGG - Intergenic
919934661 1:202243619-202243641 CAGTGGGTTAGAGATGAAGCCGG + Intronic
920610506 1:207432037-207432059 ATGTGTGATTGAGGTGAAGTAGG + Intergenic
921780637 1:219158871-219158893 CGGTGGGTTTGAGGTGTTAATGG - Intergenic
923071464 1:230568726-230568748 CTGTGTGCTTAAGGTGAAAACGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924240052 1:242031773-242031795 TTGGAGGTTTGAGGTGAATATGG + Intergenic
924414330 1:243843572-243843594 ATGTGTATTTGAGGTGAAGAGGG + Intronic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063116093 10:3073042-3073064 CTGGGAGTTGGGGGTGAAGACGG - Intronic
1064717634 10:18193390-18193412 CTGTGGGTGTGAAGTGCAGGTGG + Intronic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1065513227 10:26500311-26500333 CTGTGACTTTGGGGTGAAGACGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066442043 10:35448683-35448705 TGGTGGGTTTGAGGGGCAGAGGG + Intronic
1067771639 10:49130870-49130892 CTGTGTGTTTGAGATGCTGATGG - Intergenic
1067929387 10:50545017-50545039 CTGTTGCTCTGAGGTGAAAATGG + Intronic
1068142515 10:53025956-53025978 CTGCTGGTTAGGGGTGAAGAAGG + Intergenic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1069342810 10:67431973-67431995 ATGTGGGTTGGAGGAGAAGGTGG - Intronic
1070769548 10:79074331-79074353 CTGGGGGAATGAGGTGAAGGAGG + Intronic
1070793698 10:79204625-79204647 CTGTGATTTTGAGATGAATATGG - Intronic
1073160183 10:101386945-101386967 TTTTGGGTTTGATGTGACGAAGG + Intronic
1073580020 10:104656779-104656801 CTGTGGGTTAGAGGGAAAAAAGG + Intronic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1074489961 10:113931120-113931142 CTTTGGGTATGAGGTGAAACTGG + Intergenic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1076012046 10:126996764-126996786 CTGGTGGTTAGAGATGAAGATGG + Exonic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077936063 11:6786808-6786830 CTGTGTGTTTGTGCTAAAGATGG + Intergenic
1079947021 11:26756839-26756861 CTGTGGGGTTGAGGAGAGGTTGG - Intergenic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080650835 11:34221597-34221619 CTGAGGGCTTGAGGTGGTGACGG + Intronic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1081345531 11:41981309-41981331 TTGTGGTTTTCAGATGAAGAAGG - Intergenic
1081801375 11:45861765-45861787 CTGTGGTTTTCAGGTGAAAAAGG - Intronic
1082028398 11:47588473-47588495 CTGGGGGGTTGAGGAGGAGATGG - Exonic
1082799741 11:57405880-57405902 CTGTTGGTAGGAGGTAAAGAGGG + Intronic
1082854252 11:57792212-57792234 CTGTTGGTTAGAGTTGGAGAGGG + Intronic
1083314553 11:61806393-61806415 CTGGGTGTTTGGGGTGTAGAGGG - Intronic
1084659872 11:70540385-70540407 CTGTGGAGTCGAGGTGATGAAGG + Intronic
1088789344 11:113210761-113210783 GTGTGTGTTTGTGATGAAGAGGG - Intronic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089557731 11:119323901-119323923 GAGAGGGTTTGAGGTCAAGAGGG + Intergenic
1091692972 12:2609652-2609674 CTGAGGGTTTGAGAAGAAGCTGG + Intronic
1092943998 12:13436353-13436375 CTGTAGGTTTTAGATGAAGTTGG - Intergenic
1093483564 12:19629066-19629088 CATTGAGCTTGAGGTGAAGATGG + Intronic
1094161229 12:27393088-27393110 ATATGGGTTTGAGATGGAGAAGG - Intronic
1096086818 12:48870818-48870840 CTGTGGGGTTGAGGAGGAAATGG + Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096791533 12:54047954-54047976 CTTTGGGTTTGAGGGGATGGAGG + Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097605270 12:61745953-61745975 TTGCTGGTTTGAGGTGAAGGAGG + Intronic
1098565441 12:71930113-71930135 CTGAGGGGTAGAGCTGAAGAAGG - Intergenic
1098675197 12:73281767-73281789 ATGTAAGTTTGAGGTGAAGTGGG - Intergenic
1099377136 12:81905105-81905127 CTGCTGGATAGAGGTGAAGAGGG - Intergenic
1099523349 12:83690393-83690415 CTGTGTGCTTGAGGGAAAGATGG - Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1101652637 12:106691381-106691403 CTAAGGGTGTGAGGTGACGAAGG - Intronic
1101750464 12:107579141-107579163 CTGTGGTTTGAAGGTTAAGAGGG + Intronic
1102260707 12:111441624-111441646 ATATGGGATTGAGGTGAGGAAGG - Intronic
1103394494 12:120597419-120597441 ATGTGGATTTAGGGTGAAGAGGG + Intergenic
1103939194 12:124492772-124492794 CTGTGGGTTGGAGGTGAGCTGGG - Intronic
1106209947 13:27632750-27632772 GTGTGTGTTTGAGGGGTAGAGGG - Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1107028776 13:35830036-35830058 CTGTGGGGTAGAGGAGGAGAAGG + Intronic
1108505791 13:51111168-51111190 CTGTGGGCTGGAGTTAAAGATGG + Intergenic
1113548190 13:111170785-111170807 CTGTGTGTTTGAGGTAAAAATGG + Intronic
1114496955 14:23139511-23139533 CAGTGGGATGGAGATGAAGATGG + Exonic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117708134 14:58494733-58494755 CTGGGGCTTGGAGGGGAAGAAGG + Intronic
1119652649 14:76394577-76394599 CTGAGGGCTTGAGCTGATGAGGG + Intronic
1120322376 14:82980705-82980727 CTGTGGGTTTCAGGGAAAGGGGG + Intergenic
1121245164 14:92456782-92456804 CTGTGGGTTAGAGCTGCAGTGGG + Intronic
1121927907 14:97946082-97946104 CTGTGGTTTGGAGGCAAAGATGG - Intronic
1122011854 14:98756946-98756968 CCGTGGGCTTGTGGAGAAGATGG + Intergenic
1122567498 14:102671251-102671273 CTGTGGAGTCGAGGGGAAGAGGG - Intronic
1122979205 14:105183897-105183919 CTTTCCGTTTGGGGTGAAGAAGG + Intergenic
1126587334 15:50301897-50301919 TTGGGGGTTGGAGTTGAAGATGG - Intronic
1126808759 15:52379892-52379914 TTGTAGGTTTGATGAGAAGAGGG - Exonic
1127039919 15:54963276-54963298 CTGCGGGAGTGAGGTGCAGATGG - Intergenic
1127469826 15:59280981-59281003 TAGTGGGTTGGAGGTGAGGATGG - Intronic
1128512971 15:68325063-68325085 CTTTGGGGTTGAGGTGGAGGTGG + Intronic
1129337889 15:74864706-74864728 CTGTGGGATTGATGTGAGGAAGG - Intronic
1130107744 15:80941779-80941801 CGGTGGGTGGGAGGAGAAGAGGG + Intronic
1130353531 15:83110739-83110761 CTGTGGGGATGAGCTGAAGAAGG - Intronic
1130375358 15:83324155-83324177 CTGTGTGTTTGAGAGGAAGCAGG + Intergenic
1130660937 15:85831008-85831030 CTGTGTGTTTCATCTGAAGAGGG + Intergenic
1130770085 15:86915629-86915651 CGGTGGGGGGGAGGTGAAGAGGG - Intronic
1132320433 15:100920852-100920874 CTGGGGGTGTGAGGAGAAGGAGG - Intronic
1132612863 16:825978-826000 CTGTGGGTTTGAGAGCGAGAGGG + Intergenic
1132945826 16:2531070-2531092 CTCTGGGTTTTAGCTGAGGATGG - Exonic
1133726525 16:8542611-8542633 CTGTGGGTTTGGGGTGGGGGAGG + Intergenic
1134138072 16:11693056-11693078 CTGTAAGTTTGTGGGGAAGAGGG - Intronic
1134691291 16:16192363-16192385 CTGTGGGTCTGAGTAGAGGAGGG + Intronic
1136674892 16:31893844-31893866 CCATGGGTGAGAGGTGAAGAAGG + Intronic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1140197290 16:72865676-72865698 CTGTGGGTTGGAGGTGGTCAGGG + Intronic
1140400458 16:74666776-74666798 CTGCTGGTTTCAGGTGAGGAGGG - Exonic
1140733073 16:77873902-77873924 CTGTGGGTGGGAGGTGAAGATGG + Intronic
1140835753 16:78792186-78792208 CTCTGGGTTTGAGGTGACCTTGG + Intronic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141447714 16:84072829-84072851 CAGTGGGGTTCAGGAGAAGATGG - Intronic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1142265282 16:89061589-89061611 TTGGGGGCGTGAGGTGAAGACGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1144090048 17:11848010-11848032 CTCTGGGCTTGAGGAGAAAAGGG - Intronic
1144501088 17:15786980-15787002 TTCTGGGTTGGAGGAGAAGAAGG - Intergenic
1145115601 17:20208239-20208261 GTGAGAGTTTGAGGTAAAGATGG + Intronic
1145163255 17:20589654-20589676 TTCTGGGTTGGAGGAGAAGAAGG - Intergenic
1145801383 17:27688067-27688089 ATGTTGGTTTGAGCTCAAGAAGG - Intergenic
1146182161 17:30705486-30705508 CTGTGTGTTTGAGGCGTAAATGG + Intergenic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151404407 17:73877453-73877475 CTGTGGATGGGAGGTGAGGAAGG - Intergenic
1151430106 17:74056480-74056502 CTGTGGGTAAGAGGAGAAGGAGG + Intergenic
1152563445 17:81089854-81089876 CAGTGGGTGTGAGGTGAGGGTGG + Intronic
1152646817 17:81473020-81473042 CCATGGGTTTGAGGTGAGGGAGG - Intergenic
1153476428 18:5503619-5503641 CAGTAGCTTTGAGGTGGAGAGGG - Intronic
1153580664 18:6570498-6570520 GCGTTGGTTTGAGGTCAAGATGG - Intronic
1154040675 18:10852766-10852788 GTGTGAGTGTTAGGTGAAGACGG - Intronic
1155274091 18:24169367-24169389 CGGTAGGTCTGAGGTGAAGCTGG + Intronic
1155491696 18:26406678-26406700 CAGAGGGTTTGAGGTAAAAAGGG + Intergenic
1156157301 18:34318339-34318361 GAGTGGGTTGGAGGTGAAAAGGG - Intergenic
1156187640 18:34681806-34681828 CTGTGGACTTCAGGTGATGATGG - Intronic
1158309746 18:56145178-56145200 CTGTGGATCTGGGGTCAAGATGG - Intergenic
1158612343 18:58952813-58952835 CAGTGAGTTTAAGTTGAAGATGG + Intronic
1160045171 18:75379755-75379777 CTGTGATTTTGAGGTGCTGAAGG - Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161317753 19:3626188-3626210 TTCTGGCTTTGAGGTGGAGAAGG - Intronic
1162976673 19:14210316-14210338 CTGTGTGTTTGAGGCGTAAATGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164102938 19:22075081-22075103 CTCTGGGTTTGTGATGGAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164435380 19:28224215-28224237 CTGTGGGTGTCAGCTGAAAATGG - Intergenic
1164890749 19:31821219-31821241 CTGGGGGTTAGAGGTGAATTTGG + Intergenic
1164948110 19:32313080-32313102 TTGTGAGTTTGAGGATAAGACGG + Intergenic
1165062463 19:33211501-33211523 CAGTGGGATGGAGATGAAGATGG + Exonic
1165318485 19:35072073-35072095 CTGTGGGTTTGATGTGGCGGTGG + Intergenic
1165377462 19:35452915-35452937 ATGTGGGATTGAGGTGAGGGGGG - Intergenic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166531356 19:43545463-43545485 CTGTTGGTCTGGGGTGAAGCCGG - Intronic
1167103201 19:47416664-47416686 TTCTGGGTTGGAGGAGAAGAGGG + Exonic
1167510845 19:49894740-49894762 ACGGGGGTTTGAGATGAAGAAGG + Intronic
1167575833 19:50317053-50317075 CTATGGGATTGAGGGGGAGAGGG - Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1167796447 19:51712791-51712813 CTGGAGGTTTGAGGAGAAAAGGG + Intergenic
931610552 2:64094904-64094926 CTGTGGCTTGGATGTGAAGCTGG - Exonic
932283599 2:70514913-70514935 CTGTTGGGTGGAGGAGAAGAGGG + Intronic
932373392 2:71212260-71212282 ATGTGAGATGGAGGTGAAGATGG - Intronic
932913050 2:75825001-75825023 CTGTTGTTTTGGGGTGGAGAGGG - Intergenic
933342864 2:81044883-81044905 CTGTCGGTTTGAGGTTAATTTGG + Intergenic
933463658 2:82622167-82622189 CTGAGGGTGAGAGGTGAAGCTGG + Intergenic
934133376 2:88970849-88970871 AAGTGGGTTTGAGATGAAAAGGG + Intergenic
934680331 2:96278999-96279021 CTGTGGGTTGGAGAGGGAGAAGG + Intronic
935515090 2:104026665-104026687 CGGTGGGGATGAGGTGAACAGGG + Intergenic
937075666 2:119104541-119104563 CTGTGAGTCTGAGGTGAGGAGGG - Intergenic
937230522 2:120395868-120395890 CTCTTGGTTAGAGGTGAGGAAGG - Intergenic
937309424 2:120892964-120892986 CTGTGGATTTGAAGTCAGGAAGG + Intronic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
939233501 2:139461746-139461768 TTGTAGGATTTAGGTGAAGAAGG + Intergenic
941072258 2:160968644-160968666 CTCTGGCTTTGAGGGGATGAAGG - Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
944275898 2:197837184-197837206 GTTAGGCTTTGAGGTGAAGATGG + Intronic
946365120 2:219244307-219244329 CTGAGGATTTGAGATGAACAGGG - Intronic
1170298968 20:14860796-14860818 CTGTGGCTTGCAGGTTAAGAGGG - Intronic
1170797012 20:19556771-19556793 CTTTGGGTTTGAGGTCAGTAAGG - Intronic
1171147364 20:22796906-22796928 CTGTGGGGTTGAGAACAAGATGG + Intergenic
1172190455 20:33059272-33059294 CTGTGGGTTTGAGGTGAGATAGG + Intronic
1173258900 20:41415563-41415585 CTATGAGTTTGAGGTGGAGAGGG - Exonic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173350422 20:42240094-42240116 CTGTGGTTTGAAGGTGAAGAAGG - Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173667469 20:44773168-44773190 CTGTGTGTTTGAGGCTAAGTGGG + Intronic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1176919588 21:14671166-14671188 CCTTGGGTTGGAGGTGGAGATGG - Intergenic
1178388946 21:32182715-32182737 CTGTGGGTTTCTGCTGAAGCTGG - Intergenic
1179225610 21:39450487-39450509 CTCTGGGACTCAGGTGAAGAGGG + Intronic
1182218747 22:28741652-28741674 CTGTAGTTTTGAGCTGAAGGGGG - Intronic
1183667171 22:39252798-39252820 CTGTTGGTTAGAGGTGGAGCTGG + Intergenic
1183758166 22:39790221-39790243 CTTTGGCTTTTATGTGAAGAGGG + Intronic
1184249199 22:43250677-43250699 CTGTGAGGTTGAGGTAAACACGG + Intronic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185332653 22:50258628-50258650 CTGTTTGGTTGGGGTGAAGAGGG - Intronic
949424753 3:3904903-3904925 CTGGAGGCATGAGGTGAAGATGG + Intronic
951369319 3:21826024-21826046 GTGGGGGGTTGAGGGGAAGAAGG - Intronic
952090692 3:29881613-29881635 ATGGGGGTTTAAGATGAAGAAGG + Intronic
952650376 3:35719568-35719590 CTGTGCCTTTTAGGTAAAGAAGG - Intronic
953923593 3:46968762-46968784 CTGGGGGTGAGAGGTGTAGAGGG + Intronic
956055363 3:65292980-65293002 CTGTGGGTTGCAGGCAAAGATGG + Intergenic
958806276 3:98814714-98814736 CCTTGGGTTGGAGGTGATGAGGG + Intronic
962188529 3:133285919-133285941 CTATGTGTTTGAGGTGGAGGGGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
964616497 3:158672370-158672392 CAGGGTGTTTGAGGTGCAGAAGG - Exonic
965305201 3:167055734-167055756 CTGTGGATTTGTGATGAAGGAGG + Intergenic
965665865 3:171092744-171092766 CTGTAGTTTTGAGATGAATAAGG - Intronic
968542496 4:1175203-1175225 CTCTGGGTCTGAGGAGAGGAAGG + Intronic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
969352887 4:6608328-6608350 CTGTGGGATTGTGGTGAGGGTGG - Intronic
969482156 4:7452497-7452519 ATGTGTGTTTGAGGTGAAAACGG - Intronic
969575972 4:8036023-8036045 GTGTGGGTGAGTGGTGAAGATGG + Intronic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971232813 4:24813951-24813973 CTGTGGGTTTCAGCTGAGTAAGG + Intronic
972230936 4:37072087-37072109 CTCTGGGTTTGAGGTGGAAATGG - Intergenic
973386106 4:49515320-49515342 CTGAGGGTTCGAGATAAAGAGGG - Intergenic
973699471 4:53522175-53522197 AGATGGGTTTGATGTGAAGAGGG - Intronic
974701859 4:65460814-65460836 GTGTGTGTTTGAGGTGAATGAGG + Intronic
974723561 4:65772103-65772125 CACTGGGTGTGAGGTGAAGCAGG - Intergenic
974969323 4:68804888-68804910 CTGATGGTTAGGGGTGAAGAAGG - Intergenic
976002487 4:80388142-80388164 CTGTGGGGTGGAGGTGGTGAGGG + Intronic
976782698 4:88778583-88778605 ATCTGGGTTTGAGATGATGATGG - Intronic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
981050028 4:140300567-140300589 CTGGGCATTTGGGGTGAAGAAGG + Intronic
981257508 4:142679657-142679679 GTATGGGTTTGAGGTGTTGATGG - Intronic
981397360 4:144269234-144269256 CTGTGAGTTTGAGAACAAGATGG + Intergenic
984540825 4:181035089-181035111 GAGTGGGATAGAGGTGAAGAAGG + Intergenic
986639738 5:9860568-9860590 CTGTGGATTTGATGTGTAAAAGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
992988178 5:82255105-82255127 CTGTGGGGTTGAGAAGCAGAGGG - Exonic
993491155 5:88551743-88551765 CTGAAGATTTGATGTGAAGATGG + Intergenic
993983304 5:94568576-94568598 CTGTGAGTTTTAAGTGAAGTGGG - Intronic
994054771 5:95402778-95402800 CTGTATGTCTGAGGTTAAGAGGG - Intronic
994811959 5:104530954-104530976 CTGTAGGATATAGGTGAAGAAGG - Intergenic
995248704 5:109964669-109964691 TTGTGGGTTTGAGTAGAAGGAGG + Intergenic
996411224 5:123161665-123161687 CTGAGTGAGTGAGGTGAAGAGGG + Intronic
999021114 5:148166131-148166153 ATGTGGGTTTGAGGTGAAATTGG + Intergenic
1000414741 5:160972048-160972070 CTGTGAATTTGGGGTGAATATGG - Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001651324 5:173318194-173318216 CTGTGGGGAGGAGGTGAAGGAGG - Exonic
1002123336 5:177022720-177022742 GTGAGGGTTTGCGGGGAAGATGG + Exonic
1003243859 6:4367967-4367989 CTGTGGGTTTGTGATGAGGCTGG + Intergenic
1003635581 6:7828796-7828818 CGGTGTTGTTGAGGTGAAGAGGG + Intronic
1003724845 6:8749461-8749483 CAGTGGGTTGGAGCTGAAGCTGG + Intergenic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1006387524 6:33739604-33739626 CTGTGGGATTGAGCTGGGGAAGG + Intronic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007379032 6:41474832-41474854 TTTTGGGTTTGGGGTGATGATGG - Intergenic
1008813998 6:55540760-55540782 CAGTGAGATTGAGGTGGAGATGG + Intronic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1010731595 6:79396987-79397009 CTGTGTGTGTAAGGAGAAGAGGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1016852774 6:148638329-148638351 CTGGGAGGTGGAGGTGAAGATGG - Intergenic
1018626959 6:165789062-165789084 GTGGGGGCTGGAGGTGAAGATGG + Intronic
1018791132 6:167148626-167148648 ATGTGTGTTTAAGATGAAGATGG + Intronic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019512661 7:1425866-1425888 CTGTGGGTGTGAGGTCCAGGGGG - Intergenic
1020342871 7:7131510-7131532 CTGAGGGCTTGAGGGGAAGTAGG - Intergenic
1021560479 7:21964571-21964593 CTGGGGGTTTGGGGTTAATATGG - Intergenic
1022236391 7:28465861-28465883 GTGTGGCTTTGAAGTGTAGAAGG + Intronic
1022577963 7:31517382-31517404 CTGTTGGTGAGAGGTGAAGCCGG - Intronic
1022784323 7:33622330-33622352 TTGTGGGGTTCAGATGAAGAAGG + Intergenic
1022831169 7:34068213-34068235 CTGAGGCTTAGAGGTTAAGAAGG + Intronic
1023768884 7:43536703-43536725 CTGAGGGGTAGAGGTGAACATGG + Intronic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025797980 7:64757725-64757747 CTGTGGGATAGGGCTGAAGAAGG + Intergenic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026158439 7:67848021-67848043 ATGAGGGTTTGGGCTGAAGAAGG - Intergenic
1027876899 7:83782359-83782381 CGGTTGGTGAGAGGTGAAGATGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028239278 7:88399432-88399454 CTGTGGGTTTGAGGGGCTGAGGG + Intergenic
1030067849 7:105674140-105674162 CAGTGGGTAGGAGGTGAAGAGGG - Intronic
1033550254 7:142440511-142440533 CTTGGAGTTTGAGGTGCAGATGG + Intergenic
1036065754 8:5379880-5379902 CTGTGGAGTTGAGGTGTAGTAGG - Intergenic
1036918860 8:12832527-12832549 TTTTGGGTTTGGGGTAAAGAGGG + Intergenic
1037874220 8:22531498-22531520 CTGAGGGTTGGATGTGAGGAAGG + Intronic
1039415365 8:37389251-37389273 CTGAGGGTTTGTGGTCAAGGTGG - Intergenic
1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG + Intergenic
1040139893 8:43897520-43897542 ATGTTGGTTTGAGCTCAAGAAGG + Intergenic
1042085714 8:65106575-65106597 CTGTAGGATGGAGGTGAGGAAGG + Intergenic
1042164398 8:65931317-65931339 ATGTGTGTTTGTGGTGGAGATGG + Intergenic
1042272717 8:66971578-66971600 CTGTGGATTAGAGGTGAATAGGG - Intronic
1043483169 8:80673269-80673291 CTGTGGATTCCAGGTTAAGAAGG + Intronic
1045815362 8:106271075-106271097 CTGAGGGATTTGGGTGAAGAGGG + Intronic
1046771603 8:118122304-118122326 GTGGGGGTTAGAGGTGGAGAGGG - Intergenic
1047343628 8:124006233-124006255 GTGGGGGTTTCAGGGGAAGATGG + Intronic
1049822970 8:144647331-144647353 CTGCGGGTTTCATGTGAGGATGG - Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050668330 9:7967322-7967344 CTGTAGGGTGGAGGTGAAGTGGG - Intergenic
1052266479 9:26579388-26579410 GTGTGGGGTGGAGGTGAGGAGGG + Intergenic
1052323525 9:27193332-27193354 CAATGGTTTTGAGGTGAGGATGG + Intronic
1052987780 9:34500880-34500902 CTGGGGGTTTGGGATGTAGAGGG - Intronic
1053133633 9:35635298-35635320 CTGTGGGTTCCAGGAGAAAAAGG - Intronic
1053826701 9:42032366-42032388 CTGTGGATTTTAAGTGAAGATGG - Intronic
1054603858 9:67155057-67155079 CTGTGGATTTTAAGTGAAGATGG + Intergenic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1057301820 9:93890796-93890818 CTGTGGGTTAGAGATGGAGGAGG + Intergenic
1057980509 9:99657484-99657506 CTTTGGGGTTGGGATGAAGAAGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059453508 9:114385760-114385782 CTGGGGCTTTGTGGTGAGGAGGG - Intronic
1059916010 9:119101197-119101219 ATCTGGGTTAGAGGTGAAGTGGG - Intergenic
1060426825 9:123513209-123513231 GTGTGGGTGTGGGGTGAACAAGG - Intronic
1060795987 9:126513635-126513657 CTGTGGGGTTAAGGTGAGGATGG + Intergenic
1186413493 X:9363564-9363586 CTGTGGGTTCATGGTGAACAGGG + Intergenic
1187771769 X:22706430-22706452 CTGTTTGTTTCAGGTGAGGAAGG + Intergenic
1188604253 X:32008736-32008758 GTGTGGCTGTGAGCTGAAGATGG + Intronic
1190300127 X:49052682-49052704 GTGTGGGTTAGAGGTGTAGATGG + Intergenic
1191056007 X:56241538-56241560 CTGTGAGATTGATGTCAAGAAGG - Intronic
1194928860 X:99862402-99862424 CTGTGGGTGTAAGGTGGCGATGG + Intergenic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199159589 X:144593008-144593030 GTATGGGTTTGAGGGGAAGGTGG - Intergenic
1200078738 X:153565185-153565207 CTGTGGGTGTCGGGTGCAGACGG - Intronic
1200352131 X:155508810-155508832 CTATGGGTTTGAGGAGTAAATGG + Intronic
1200711672 Y:6490280-6490302 CTGCTGGGTAGAGGTGAAGAAGG - Intergenic
1200802942 Y:7402714-7402736 CTGTGGGTTGCAGGTGTAGTAGG + Intergenic
1201022262 Y:9671700-9671722 CTGCTGGTTAGAGGTGAAGAAGG + Intergenic
1201406755 Y:13657704-13657726 CTGCTGGCTTGAGGTGAAGAAGG + Intergenic
1201907527 Y:19100895-19100917 CTGTTGGATAGGGGTGAAGAAGG + Intergenic