ID: 1080389701

View in Genome Browser
Species Human (GRCh38)
Location 11:31833722-31833744
Sequence GGGCATCTCTGGGGCCTAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080389701 Original CRISPR GGGCATCTCTGGGGCCTAGT CGG Intronic
900015974 1:150239-150261 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
900046237 1:508836-508858 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
900068439 1:750548-750570 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
901535904 1:9882954-9882976 GGGCACTTCTGGGGGCTACTTGG + Intronic
901652291 1:10749960-10749982 TGGCACCTCTGGGTCCTAGGTGG + Intronic
902949418 1:19870239-19870261 GGCCATTTCTGGGGCCTCCTGGG + Intergenic
903060370 1:20664680-20664702 GGGCATTTCAGGGGCCTGGGTGG + Exonic
903182471 1:21611877-21611899 GGCCCTCTCTGGGTCCAAGTAGG - Intronic
903445270 1:23418885-23418907 GGGCATCTCGGGGGCGGAGAGGG - Intronic
907297802 1:53466655-53466677 GGGCGGGCCTGGGGCCTAGTCGG - Exonic
913424669 1:118713846-118713868 CTGCTTCTCTGGGGCCTGGTTGG + Intergenic
915609295 1:156978311-156978333 GGGCATCTCTGGGCTCCAGCAGG - Exonic
917586737 1:176434674-176434696 AGTCATCCCTGGGGCCTGGTTGG + Intergenic
921145746 1:212354291-212354313 GGGGATCTCTTGAGCCTAGGGGG + Intronic
922103799 1:222495934-222495956 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
922264117 1:223968451-223968473 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
922916054 1:229258722-229258744 GGGCCTCTTTGGGACCTGGTAGG - Intergenic
923087321 1:230711547-230711569 GAGCATCTCAGGGGTCTAGGAGG - Intronic
924345964 1:243073443-243073465 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
924592255 1:245414632-245414654 AGGCCTCTGTGGGGCCTAGAAGG - Intronic
1063658052 10:8011341-8011363 GGGGATCACTGGGGCCCAGGAGG - Intronic
1066694265 10:38064080-38064102 GAGCATCTCAGGGGCCTGGGAGG - Intronic
1066730378 10:38431372-38431394 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1067806758 10:49398012-49398034 GGTCATCTCTGGGCCTTAATAGG - Intergenic
1070698639 10:78582541-78582563 GGGTATCTCTGGGGCATTGCTGG + Intergenic
1070890294 10:79937954-79937976 GGGCTCCCCTGGGGCCCAGTTGG + Exonic
1073717274 10:106121587-106121609 GTGGATCTCTTGAGCCTAGTAGG + Intergenic
1075532416 10:123240858-123240880 GGGCAGCTTTGGGGCCTGGGAGG + Intergenic
1076433173 10:130421897-130421919 GGGCAGGTCTGGAGCCTGGTGGG + Intergenic
1076620742 10:131785784-131785806 GGGCACGTCTGGTGCATAGTAGG - Intergenic
1076972565 11:145308-145330 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1078414509 11:11154388-11154410 GGGCATCACTGGGGCCATTTTGG + Intergenic
1080389701 11:31833722-31833744 GGGCATCTCTGGGGCCTAGTCGG + Intronic
1081654992 11:44851216-44851238 GGGAATCTCTGGGGACTGGCCGG + Intronic
1081722525 11:45300830-45300852 GGGCCTCTCTGGGGGCTGGATGG + Intergenic
1081866475 11:46363172-46363194 GGGCTTCTCCTGGGCCTTGTTGG - Intronic
1082263317 11:50094729-50094751 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1085026135 11:73237706-73237728 GGGCACCTCTGGAACCCAGTTGG + Intergenic
1089302398 11:117506504-117506526 GGGCATGTCTGGGGCTTTCTTGG - Intronic
1090653703 11:128826691-128826713 GGGTATCTTTCGGGCCTAGCAGG - Intergenic
1090808343 11:130216854-130216876 GTGCCTCTCTGGGGCCTTCTGGG + Intergenic
1090827961 11:130401157-130401179 GGGCAGCTCTGGGGGCTGGAAGG + Intergenic
1091353638 11:134916958-134916980 GAGCAGCTCTGGGGCCTGGGAGG + Intergenic
1095506617 12:42905491-42905513 GGGCAACTGGGTGGCCTAGTGGG + Intergenic
1096460779 12:51820619-51820641 GGGCTTCTCTGGGGGCGAGCTGG - Intergenic
1097119926 12:56723966-56723988 GGACGACTCTGGGGCCCAGTAGG + Intronic
1099973022 12:89519156-89519178 TGGGATCTCTGGGGCCCACTTGG - Intronic
1102413206 12:112738280-112738302 GAGGATCTCTTGGGCCTAGGAGG - Intronic
1102566560 12:113801144-113801166 GGGCATACCTGGGGCCCTGTTGG - Intergenic
1102887526 12:116533359-116533381 GGGCCTGGCTGGGGCTTAGTCGG - Intergenic
1103294263 12:119872884-119872906 GGGCATCTCTGGGGCCCCGGAGG - Intronic
1104444864 12:128824528-128824550 GGGCTTCGGTGGGGCCCAGTAGG + Intergenic
1104857653 12:131909520-131909542 GGGCAGCGCCGGGGCCGAGTGGG + Intronic
1105018174 12:132798795-132798817 GGGCATCTCTGAGCCCCTGTAGG + Intronic
1105593336 13:21813837-21813859 GGGCATCTCTGTGGATTAGCAGG - Intergenic
1109625271 13:64965710-64965732 GAGAATCTCTGGGACCTAGGAGG + Intergenic
1110839884 13:80129824-80129846 GGCCAGCTCTGTGGCCAAGTTGG - Intergenic
1112200906 13:97273652-97273674 GGACATCTCTTGGGACTGGTGGG - Intronic
1120921536 14:89760246-89760268 GGGCATCTGTTGGTCCTAGCAGG + Intergenic
1122159746 14:99774344-99774366 AGGCAGCTCTGGGGCCTGGCAGG + Intronic
1123122382 14:105922848-105922870 AGGCATCTCTAGGGCCCAGTGGG + Intronic
1123405038 15:20014412-20014434 AGGCATCTGTAGGGCCCAGTGGG + Intergenic
1123514369 15:21021060-21021082 AGGCATCTGTAGGGCCCAGTGGG + Intergenic
1127393614 15:58526450-58526472 TGGCAGCTCTGGAGCCTACTTGG - Intronic
1128302467 15:66575151-66575173 GGTCATCGCTGGGCCCTCGTGGG - Intergenic
1129772019 15:78208536-78208558 GGGCATGGCTGGGGACTGGTGGG - Intronic
1130643851 15:85706242-85706264 GGGCATCTCTGTGGCAGAGGAGG + Intronic
1131296349 15:91152987-91153009 GGGAATCTCTGCCTCCTAGTTGG + Intronic
1132572709 16:650993-651015 AGCCATCTCTGGGGCCCAGTGGG + Exonic
1132614953 16:835786-835808 GTGCATCTCTGGGACCTGGAGGG + Intergenic
1133704393 16:8339659-8339681 GGGCCTGTCTGGGGCGTGGTGGG - Intergenic
1135131775 16:19859498-19859520 GGTCATCTCTGCATCCTAGTGGG + Exonic
1135391855 16:22100371-22100393 GGGGATCTCTCGGGCCCAGGGGG - Intronic
1137573322 16:49580726-49580748 TGGAATCTCTGGGGCCTTCTCGG - Intronic
1139328743 16:66171399-66171421 GGGAATCTCTGGAGCACAGTTGG - Intergenic
1142447685 16:90152213-90152235 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1142459805 17:83110-83132 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1143253953 17:5542151-5542173 GTGCATTTCTGGGGCCTGGGAGG - Intronic
1143381794 17:6501300-6501322 TGACATCTCTGGGGCCTCGCTGG + Intronic
1143584743 17:7845461-7845483 GGGAAACTCTGGGGCCGAGCTGG + Intronic
1144136042 17:12295988-12296010 GGGCAACTTTAGGGCATAGTAGG - Intergenic
1144658217 17:17051562-17051584 GGTCATCTCTGGGGCCATTTGGG + Intronic
1144799388 17:17914516-17914538 TGGCATCTCTGGGGCCTATCTGG + Intronic
1144806501 17:17971797-17971819 GGGCATCTCCGAGTCCAAGTTGG + Intronic
1144951020 17:18993484-18993506 AGGGATCTCTGAGGCCTAGGAGG - Intronic
1145305341 17:21671136-21671158 GGGCATTACAGGGGCATAGTGGG + Intergenic
1147994403 17:44353268-44353290 GGACAGCTCTGGGGACTAGGGGG - Exonic
1148824033 17:50378930-50378952 GGGCAGCTCTTGGGCCAAGGGGG + Intronic
1149653270 17:58292328-58292350 GGGCATCTATGGGGCAGAGGGGG + Intergenic
1150006293 17:61470926-61470948 GGGCCTCACTGGGGCATAGGCGG + Intronic
1150143452 17:62749400-62749422 TGGGATCTCTGGTGCCTAGGAGG + Intronic
1151376386 17:73691630-73691652 GGGCCTCTCTGGGGTCTGGGAGG + Intergenic
1151553765 17:74836462-74836484 GGGCATCACAGGGGCCTACGCGG + Exonic
1152814682 17:82400266-82400288 GGGCATCTGTGAGGCCTGGAGGG - Intronic
1154098800 18:11448495-11448517 GGGCTTTTGTGGGGGCTAGTAGG - Intergenic
1156470345 18:37373815-37373837 GGGCCTCTCACGTGCCTAGTGGG - Intronic
1160649521 19:215618-215640 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1160755936 19:757231-757253 GGGCATCCCTGGCGCCCAGGCGG - Exonic
1161221560 19:3120381-3120403 GGGCTGCTCTGGGGACTGGTGGG - Intronic
1161591882 19:5132692-5132714 AGGCATCTCTGGGGCCTCCGTGG + Intronic
1163493059 19:17628124-17628146 GGGCATCTCTGGGGACTGGTGGG + Intronic
1166046290 19:40232912-40232934 GGGCATCTCTGGTACCTATTGGG - Exonic
1167418706 19:49390439-49390461 GGTCAGCTCTGGGGCCCTGTGGG + Intronic
1168422013 19:56210509-56210531 GGGAGTCTCTGGTGACTAGTTGG + Intergenic
1168423457 19:56220245-56220267 GGGAGTCTCTGGTGACTAGTTGG - Exonic
1168427317 19:56249129-56249151 GGGAGTCTCTGGTGACTAGTTGG + Intronic
925102054 2:1255462-1255484 CGGCATCTCTGGGTCCCTGTTGG - Intronic
925108007 2:1309600-1309622 GGGCATCTCCAGGGCCTACTGGG + Intronic
926241885 2:11094805-11094827 GGGAGTCTCTGGGGCCTTTTAGG - Intergenic
926574390 2:14564188-14564210 GGACATCTTTGGGGGCTATTAGG - Intergenic
926740048 2:16103136-16103158 GGGCTGCTCTGGGGCCGAGGTGG + Intergenic
927476067 2:23415034-23415056 GGGCAGCTGTGGGGCCTTGTGGG - Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
932288301 2:70554372-70554394 GGGCATCTCTGGGGCGGGGAAGG + Intergenic
932424339 2:71619610-71619632 CGGCAGCTCTGGGTCCTAGCTGG + Intronic
934473709 2:94578317-94578339 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
934516905 2:94993987-94994009 GGGCATCCCTGGGGCCAACCTGG - Intergenic
937845331 2:126573183-126573205 TGGCTTCTCAGGGGCCTAGGGGG - Intergenic
938835690 2:135101997-135102019 GACCATCTCTGGGGGCTAGCAGG - Intronic
938844498 2:135194997-135195019 GTGCATCTCTGTGGCCCATTTGG - Intronic
938875523 2:135528236-135528258 GGGAATCGCTGGGGCCCAGGAGG - Intronic
947751751 2:232536207-232536229 GGGCATCACTGGGGCCATCTTGG - Intronic
1171522860 20:25788608-25788630 GGGCATTACAGGGGCTTAGTGGG + Intronic
1171530599 20:25850577-25850599 GGGCATTACAGGGGCATAGTGGG + Intronic
1171553967 20:26067275-26067297 GGGCATTACAGGGGCTTAGTGGG - Intergenic
1172064120 20:32207465-32207487 GGGCCTATCTGGGGCCGGGTTGG + Intronic
1173007430 20:39150989-39151011 GGCCAGCTCTGGGGCCTTTTGGG + Intergenic
1173546171 20:43899804-43899826 TGGCAGCTCTGGGGCCTGGAGGG - Intergenic
1174852474 20:54008237-54008259 TGGCATCTGTGGGGCTAAGTAGG + Intronic
1175385483 20:58592311-58592333 TGGCATCTCTGGGGCCATGGTGG + Intergenic
1175592049 20:60200897-60200919 GAGCATTTCTGGGGCCAAGATGG - Intergenic
1178494579 21:33075999-33076021 GGGCCTCTCTTGGGGCTAGGGGG - Intergenic
1180675330 22:17582442-17582464 GGGCATTTTTGGGGCCAGGTGGG - Intronic
1181175580 22:21032895-21032917 GGGCCTGTCTGGGGCCCAGCTGG - Intergenic
1181936307 22:26441386-26441408 GAGCATCTCTAGAGCCTAGGAGG + Intronic
1184694353 22:46131381-46131403 GGGCTTCCCTGGGGCTTAGCAGG - Intergenic
951443864 3:22754195-22754217 GGGAATATCTGGGGACTATTTGG - Intergenic
952617016 3:35285841-35285863 GAGCATCACTTGGGCCTAGGAGG + Intergenic
953882022 3:46695535-46695557 AGGCATCCCTGGGGCTTAGGAGG + Intergenic
954201547 3:49026201-49026223 GGGCAACCCTGGGGCCAAATTGG - Intronic
954201655 3:49026785-49026807 TGGCATCTTTGGAGGCTAGTGGG + Exonic
954290916 3:49649579-49649601 GGGCATCTCTGAGGCCTAAATGG - Intronic
954526478 3:51276299-51276321 TGGCTTCTCTGAGGCCTGGTGGG - Intronic
961628194 3:128278189-128278211 GGACCTTTCTGGGGACTAGTGGG + Intronic
964123009 3:153206127-153206149 GAGGATCACTTGGGCCTAGTAGG + Intergenic
966256005 3:177917511-177917533 GGGCATCTCTGTGCTCTTGTGGG + Intergenic
966873576 3:184308291-184308313 GGGCGTCTCTGGTTCGTAGTAGG + Intronic
968368326 3:198204513-198204535 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
970148591 4:13065702-13065724 GGGCCTATCTGGGACCTAGGAGG + Intergenic
971713015 4:30141418-30141440 GAGCATCTCTTGAGCCTAGGAGG - Intergenic
972440945 4:39090890-39090912 GAGGATCTCTTGGGCCTAGGAGG - Intronic
983976051 4:173935788-173935810 GGGCAGCTCTGGGGGTCAGTGGG + Intergenic
985124167 4:186674942-186674964 GGGCATCGCTTGAGCCTGGTAGG + Intronic
990533390 5:56695951-56695973 GGGCATCTCTGGGGCTGTCTTGG + Intergenic
992314606 5:75539583-75539605 GAGTATCTCTGAAGCCTAGTAGG - Intronic
995612091 5:113921791-113921813 GTGCATTTGTGGGGGCTAGTTGG - Intergenic
995837830 5:116415796-116415818 GGGCTTCTCTGGGGGCTACTTGG + Intergenic
997194098 5:131966280-131966302 GAGCACCTCTGGGGCCTGGGGGG - Intronic
997941175 5:138158846-138158868 GAGCATCACTGGGGCCCAGGAGG - Intronic
1000218476 5:159187726-159187748 GGGTATCACTGGGGTCTAGTGGG + Intronic
1000518255 5:162267430-162267452 GGGTGTGTCTGGGCCCTAGTAGG - Intergenic
1000731037 5:164834477-164834499 GGGCATCTGTGGGGTCTGGAAGG + Intergenic
1002591798 5:180295661-180295683 GCACATCTCTGGGTCCTTGTAGG - Intergenic
1002727547 5:181309740-181309762 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1004144205 6:13049598-13049620 CGGGATCTCTGGATCCTAGTGGG - Intronic
1006397240 6:33795467-33795489 GGGCATCTCTGTGGCTTGGCCGG - Intronic
1006612017 6:35299773-35299795 GGGAGTCTCAGGGGCCAAGTGGG + Intronic
1008032476 6:46712551-46712573 GGGTATTTCTGGTGTCTAGTGGG + Intronic
1008342201 6:50380991-50381013 CGGCATGTTTGGGGGCTAGTTGG + Intergenic
1011117066 6:83905694-83905716 GGGCCTCTTGGTGGCCTAGTTGG + Intronic
1014725990 6:124972355-124972377 GAGCATCACTGGGACCAAGTAGG - Intronic
1016014118 6:139166694-139166716 GGGCCTTTCTGGGGCTTATTTGG - Exonic
1017157158 6:151332810-151332832 GGCCATCTTTGTGACCTAGTGGG + Intronic
1017502493 6:155038433-155038455 GGTCTTCTCTTGGGGCTAGTTGG + Intronic
1018378212 6:163233015-163233037 GGGCATCTCTGGGGAGGAGATGG + Intronic
1018726265 6:166615541-166615563 GGGCATCTCTGGGGCCCCAGGGG - Intronic
1021886838 7:25147501-25147523 GGGCAGCTCTGGGGTCTGGGTGG + Intronic
1023398734 7:39775527-39775549 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1024651705 7:51409167-51409189 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1025133913 7:56394963-56394985 GAGCATCTCTTGAGCCCAGTTGG - Intergenic
1025185513 7:56855185-56855207 GAGCATCTCTGGAGCCCAGTTGG - Intergenic
1025283295 7:57643535-57643557 GGGCATTACAGGGGCATAGTGGG + Intergenic
1025686419 7:63721768-63721790 GAGCATCTCTGGAGCCCAGTTGG + Intergenic
1026848079 7:73708736-73708758 GGCCATCTCTGGGCCCCAGAAGG - Intronic
1026857061 7:73762091-73762113 GGGCACCCCTGGGGCCTCCTGGG - Intergenic
1029123078 7:98281413-98281435 GGGCGTCTCTGGGTCGTCGTGGG + Intronic
1032134451 7:129262747-129262769 GGGCTTCTCTGGGGTCTCCTTGG + Intronic
1032570708 7:132993521-132993543 GGTCATCTATGGGGCACAGTAGG - Intronic
1033637104 7:143222198-143222220 GGCCATCTATGGGGCTGAGTGGG + Exonic
1039633182 8:39134490-39134512 GGGAACCTCTGAGGCCTAGAAGG - Intronic
1040310169 8:46232763-46232785 GGACAGCTCTGGGGCCTGCTTGG - Intergenic
1042126404 8:65541575-65541597 GGGCATGGATGAGGCCTAGTTGG - Intergenic
1044312539 8:90710582-90710604 GGGCATCTCTGGGGGCTGCCAGG - Intronic
1045538939 8:103062553-103062575 GGGCATCAGTGGGGCTGAGTTGG + Intronic
1049617178 8:143580768-143580790 AGGCAGCTCTGGGCCCTGGTTGG - Intronic
1053684621 9:40510195-40510217 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1053934587 9:43138473-43138495 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054279105 9:63114770-63114792 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
1054297715 9:63345657-63345679 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054395731 9:64650168-64650190 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054430375 9:65155363-65155385 GGGCATCTCTGGGGGCAGGGTGG + Intergenic
1054500005 9:65866158-65866180 GGGCATCTCTGGGGGCAGGGTGG - Intergenic
1055079709 9:72257247-72257269 CGGCAGCCCTGGGGCCTCGTGGG - Intergenic
1056706359 9:88955463-88955485 GGGCATCTCTGGGCCCCAGAAGG - Intergenic
1057794975 9:98149286-98149308 AGGCATCTCTGGGAGCTTGTTGG + Intronic
1060426514 9:123511105-123511127 GGGGATATCTGGGGCCTTGAGGG - Intronic
1062538765 9:137032304-137032326 GGGCCTCTCTGGAGACCAGTGGG - Exonic
1062570712 9:137183916-137183938 GGGGATGTCTGGTGCCTAGCAGG - Intronic
1062645414 9:137545429-137545451 GAACATCACTGGGGCCCAGTGGG - Intronic
1062752666 9:138267218-138267240 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1203760498 EBV:10763-10785 GGGCATCTGGGGGCCCTTGTTGG - Intergenic
1203575184 Un_KI270745v1:1993-2015 GAGCATCTCTTGAGCCCAGTTGG + Intergenic
1186426755 X:9468538-9468560 GGGCACCTCTGGGGCTCACTTGG - Intronic
1190661928 X:52662535-52662557 AAGCATCTCTGGGGGCTAATAGG + Intronic
1191976957 X:66883386-66883408 GGGCATCTCTGGGATGTAGGCGG + Intergenic
1197728577 X:129792492-129792514 GGGCTTCTCTGGAGCCTGGCAGG + Intronic
1200747855 Y:6918133-6918155 GGGCAGCTCTGGGGCTCACTTGG - Intronic