ID: 1080390938

View in Genome Browser
Species Human (GRCh38)
Location 11:31845923-31845945
Sequence TGTTAACTATAGTCACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 14, 2: 44, 3: 113, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080390938_1080390939 12 Left 1080390938 11:31845923-31845945 CCATATGGTGACTATAGTTAACA 0: 1
1: 14
2: 44
3: 113
4: 272
Right 1080390939 11:31845958-31845980 CTTGAAAATTGCTAAGAAAGAGG 0: 1
1: 20
2: 62
3: 162
4: 2291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080390938 Original CRISPR TGTTAACTATAGTCACCATA TGG (reversed) Intronic
900901234 1:5517491-5517513 TATTAACCATAGTCACCATGCGG - Intergenic
901009660 1:6192748-6192770 TGTTAACAATAGTCAACTTTTGG - Intronic
901272893 1:7966966-7966988 TGTTAACTATAGTCATTCTACGG + Intronic
903985588 1:27225566-27225588 TGTTCACTATAGTTACAAAATGG - Intergenic
904634679 1:31870643-31870665 AGTAAACTACAGTCACCAGACGG - Intergenic
907086971 1:51684314-51684336 TATTAATTATTGTCACCATGTGG - Intronic
907696551 1:56735895-56735917 TGTTAACTATAGTCATCCTATGG - Intronic
908930766 1:69314030-69314052 TATTTACAATAGTCAACATATGG - Intergenic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
909922043 1:81394262-81394284 TGTTATTTATAGTCACTATATGG + Intronic
911685244 1:100768301-100768323 TGTTAACCATAGTCATCCTTTGG - Intergenic
911685741 1:100775195-100775217 TATTAACTATAGTCACCATGTGG - Intergenic
911928691 1:103871734-103871756 CTTTTACTATAGTCACCAAAGGG - Intergenic
914513951 1:148357777-148357799 TGTTATCTATAGGCACAATTGGG - Intergenic
914963652 1:152231383-152231405 TGTTCACAATAGTCACAATATGG - Intergenic
915918603 1:159957287-159957309 TATTAACTGTAGTCACCATATGG - Intergenic
916280133 1:163041448-163041470 TATTAACTATAGGCAGTATATGG + Intergenic
917992142 1:180391617-180391639 TGTTGATTATAGCCACCCTAAGG - Intronic
918452581 1:184673753-184673775 TGTTGACTATAGTCACCATATGG + Intergenic
918955877 1:191206074-191206096 TGTTAACTGTAGTCATCCTACGG + Intergenic
919758848 1:201084228-201084250 TGTTAACTACTGTCACCACAGGG - Intronic
919870312 1:201815670-201815692 TATTAACTATAGTCACCATATGG - Intronic
920792880 1:209109295-209109317 TATTAACAACAGTCACCATTTGG - Intergenic
921173989 1:212577464-212577486 TATTAACTATAGTCACTATGTGG + Intronic
922350507 1:224731390-224731412 TGTAAAATAGAGTCACCATATGG + Intronic
922990250 1:229901366-229901388 TGCTTGCTATAGTCACCTTAGGG - Intergenic
923043866 1:230339924-230339946 TATTAACTTTAGTCACCATGTGG - Intronic
924147885 1:241095826-241095848 TGTTAACTATAGTCATTCTACGG + Intronic
924313299 1:242769318-242769340 TGTTAACTATAGTCATCATGTGG - Intergenic
1063641267 10:7833018-7833040 TGTTGACTTTAGTCACCCTGTGG + Intronic
1064384059 10:14875592-14875614 ATATAACTATAGTTACCATATGG + Intergenic
1064950497 10:20843881-20843903 AGTTAACCATATTCACCTTACGG + Intronic
1065007985 10:21397118-21397140 TGTTATCTTTAGTTTCCATAGGG - Intergenic
1065412885 10:25449666-25449688 TATTAACTATAGTCACTATTTGG - Intronic
1065457620 10:25923676-25923698 AATTAACTATTGTAACCATAGGG + Intergenic
1065888420 10:30099567-30099589 TGTTAAATATAATCTCCATGAGG - Intronic
1068653494 10:59550050-59550072 TGTTATCTATAGGAGCCATAAGG + Intergenic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1068892714 10:62164454-62164476 TCTTAACTATAGTCACCCTATGG - Intergenic
1070455973 10:76615960-76615982 TATTCACAATAGTCAACATATGG + Intergenic
1072347810 10:94525980-94526002 GGGTAACTATAGTTAACATATGG - Intronic
1073203112 10:101752361-101752383 CCTTAGCTAGAGTCACCATATGG - Intergenic
1073537463 10:104290833-104290855 TATTTACTATAGTCACCATGTGG - Intronic
1073851511 10:107624380-107624402 TATTCACTATAGTCAAGATATGG - Intergenic
1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG + Intronic
1077801369 11:5541737-5541759 TATTAACTATAGCCACCATAGGG - Intronic
1077828154 11:5832651-5832673 TCTTAACTATATTCATCATACGG - Intronic
1077988558 11:7380371-7380393 TATTGACTATAGTCACCCTATGG - Intronic
1078260193 11:9698963-9698985 TATTAACTATAGTTATCATGTGG + Intronic
1078673919 11:13391409-13391431 TGTTAAGTATTGTTAACATATGG - Intronic
1079385387 11:19974415-19974437 TATTAACTAAAGTCACATTAGGG - Intronic
1079929873 11:26544525-26544547 TATTAACTATAGTCACCATGTGG - Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1082690669 11:56299968-56299990 TGTTAACTGTAGTCATTGTACGG + Intergenic
1084513670 11:69622854-69622876 TACTAACTCTAGTCACCATGTGG + Intergenic
1086067952 11:82766121-82766143 TGTTTATTATAGTCACCCTACGG - Intergenic
1086636308 11:89090822-89090844 TATTAACTATAGTTACCTTATGG - Intergenic
1087553523 11:99684002-99684024 TATTAACTGTAGTCATCATGAGG + Intronic
1087677000 11:101175152-101175174 TATTAACAATAGTCAAGATATGG - Intergenic
1089229534 11:116959865-116959887 TGTTAATTATAGCCAACAAAAGG - Intronic
1090384712 11:126350671-126350693 TATTAACTATTGTCACCATGTGG + Intergenic
1090442780 11:126737919-126737941 TGTTAACTACAGTCACCCTGTGG + Intronic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1090898897 11:131007580-131007602 TGTTGACTATAGACAACAGAGGG - Intergenic
1091559922 12:1604284-1604306 TGTTAACTATATTCGCCCTACGG - Intronic
1092118520 12:6026700-6026722 TGATAATTATAGTCACCCTGTGG - Intronic
1094099762 12:26749395-26749417 TTTTAACTCTAGTAATCATAAGG + Intronic
1094420650 12:30267439-30267461 TATTGACTATAGTCACCCTGTGG - Intergenic
1094469594 12:30791436-30791458 TGTTATCTTTAGTTTCCATAAGG + Intergenic
1094715345 12:33008618-33008640 CATTAACTATAGTCACCATGTGG + Intergenic
1096486753 12:51987787-51987809 TATTGACTATAGTCACCCTGTGG - Intronic
1096566244 12:52482736-52482758 TATTAACTATAGTCATCCTACGG + Intergenic
1097469350 12:59969086-59969108 TGTTAATTATAGTTCACATAAGG + Intergenic
1098303405 12:69077663-69077685 TATTAAGTATAGTCACCATTGGG - Intergenic
1098742281 12:74188564-74188586 TATTAACTATAGTCACCATGAGG - Intergenic
1098789248 12:74799780-74799802 TTTTAATTATAGTTGCCATATGG - Intergenic
1098799167 12:74931458-74931480 TGTTTACAATAGTCAAGATATGG - Intergenic
1100204536 12:92334025-92334047 TATTAACTATAGTCCTCCTATGG + Intergenic
1100745532 12:97641630-97641652 TATTAAGAATAGTCACCATGTGG + Intergenic
1105689195 13:22818904-22818926 TGTTAACCATAGTTACCCTCTGG + Intergenic
1105726477 13:23167329-23167351 TGTTAACAATAGCCACGATTTGG - Intergenic
1106328287 13:28715642-28715664 TGTTAACTGTAGTCACCCTGTGG - Intronic
1106776208 13:33012418-33012440 TATTAACTATAGTCACCATGTGG - Intergenic
1107044877 13:35983550-35983572 TATTGACTATAGTCACCCTGTGG - Intronic
1107102026 13:36603449-36603471 TATTCACTATAGCCAACATATGG + Intergenic
1107608855 13:42092307-42092329 TGTTCACAATAGTCAAGATATGG + Intronic
1107612693 13:42132327-42132349 TGTTAACTATAGTCATCCTACGG + Intronic
1107649695 13:42532468-42532490 TGTTAACTATAGTCACTCTATGG + Intergenic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1108226015 13:48290089-48290111 TGTTAATTAAAGTCATCCTACGG + Intergenic
1108797855 13:54053967-54053989 TGTTAACTATATTCACCGTACGG - Intergenic
1109632565 13:65070288-65070310 TGTTCACAATAGTCAATATATGG - Intergenic
1109743601 13:66589319-66589341 TGTTACCTATAGTCATCGTAAGG - Intronic
1109895550 13:68683575-68683597 TATTAACATTAGTCACCAAATGG - Intergenic
1110024988 13:70525727-70525749 TATTAGCTATAGTCACCTTGCGG - Intergenic
1111202522 13:84959201-84959223 TGTCAACTATAGTCACGACATGG + Intergenic
1111293303 13:86196255-86196277 TGTTCACTAAAATCACCACAAGG - Intergenic
1111306003 13:86413642-86413664 TATTAACTGTAGTCAGCATGAGG - Intergenic
1112202167 13:97287558-97287580 TGTTAAGTACAGTCATCCTATGG + Intronic
1112614025 13:100984997-100985019 AGTTAACTTTAGTGACCAGAAGG + Intergenic
1112831882 13:103462945-103462967 TGTTAACTACAGTTGCCCTAAGG - Intergenic
1112869973 13:103958657-103958679 TGTTATCTATAGTTTCAATATGG + Intergenic
1112944123 13:104905087-104905109 TGTTGACTATAGTCACTCTGTGG + Intergenic
1114679190 14:24470015-24470037 TGTTAACTATAGTTATCCTATGG - Intergenic
1114889803 14:26904770-26904792 TGTTCACAATAGCCAACATACGG + Intergenic
1115520672 14:34230173-34230195 TGTTAACTACAGTCATCCTATGG - Intronic
1116208302 14:41898474-41898496 GTTTAACTATGTTCACCATATGG - Intronic
1116320965 14:43462255-43462277 TGTTAACTATCATCACCTTATGG + Intergenic
1116631865 14:47346026-47346048 TGTTAACTATAGTCATTTTACGG - Intronic
1117043473 14:51789149-51789171 TGTTAACTCTAGTCATCCTGTGG + Intergenic
1117260146 14:54024119-54024141 TGTTCACAATAGTCAAGATATGG - Intergenic
1117367201 14:55040870-55040892 TAATAACTATAATCACCAGATGG + Intronic
1117632100 14:57704512-57704534 TGTCCAGTATAGTAACCATAGGG - Intronic
1117760035 14:59017008-59017030 TATTAACTATAGCCACCATATGG - Intergenic
1117865753 14:60147319-60147341 TATTAACTGTAGTCACCATGCGG - Exonic
1117895501 14:60481046-60481068 ATTTAACTGTAGTCACTATACGG - Intronic
1118101030 14:62602540-62602562 TGTTCACAATAGTCAAGATATGG + Intergenic
1118200665 14:63669063-63669085 TTTTAACTATATTCACTCTACGG + Intergenic
1118378388 14:65197246-65197268 TATTGACTATAGTCACCCTGTGG + Intergenic
1118757729 14:68857142-68857164 TATTGACTATAGTCACCCTGTGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121298046 14:92846081-92846103 TGTGAACTATAGTCACCCTATGG + Intergenic
1121628237 14:95402656-95402678 TGTTCACAATAGCCACGATATGG + Intergenic
1122293438 14:100691989-100692011 TGGGAAATATTGTCACCATAGGG + Intergenic
1122755485 14:103975869-103975891 TGTCAACTGTAGTCACCCCACGG + Intronic
1123098712 14:105779411-105779433 TGTTAGTTATAGTCACCCTATGG + Intergenic
1123899967 15:24866595-24866617 TTTTAACTAGAGAAACCATATGG + Intronic
1125126392 15:36227109-36227131 TGGGTACTATACTCACCATATGG + Intergenic
1125840042 15:42791825-42791847 TGTTAACTATAGTCAGTAATAGG - Intronic
1126610564 15:50524999-50525021 TGTTCACAATAGTCAAGATATGG + Intronic
1127058811 15:55161163-55161185 TATTAACTATAGTCACCTTGCGG - Intergenic
1129597729 15:76977722-76977744 TGTTAATTATAGTCATCCTAGGG + Intergenic
1129682842 15:77667695-77667717 TGCTAATTACAGCCACCATAAGG + Intronic
1130634925 15:85609176-85609198 TGCTAACTATAGTCACCCTTCGG + Intronic
1134309811 16:13065526-13065548 TGATAACTTTAGGCACCATCAGG + Intronic
1135876855 16:26209436-26209458 TAATAATTATAGTCACCATGTGG - Intergenic
1136489196 16:30594421-30594443 TGTTAACTATAGTCATCCTACGG - Intergenic
1137256715 16:46781155-46781177 TATTAACTATAGTCATCCTACGG + Intronic
1137490676 16:48929698-48929720 TATTAACTATGGTCCCCATGCGG + Intergenic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1138273796 16:55716289-55716311 TCCTAACTATAGTCTCCATTAGG - Intergenic
1138340041 16:56283073-56283095 TGTTATCTTTAGTTTCCATAGGG + Intronic
1138912782 16:61422434-61422456 TATTGACTATAGTCACCCTACGG + Intergenic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1139519334 16:67471560-67471582 TGTTAAATACAGTCACCCTATGG + Intronic
1139556065 16:67711425-67711447 TGGTTACTACAGTCACCATCAGG - Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1150884954 17:69074356-69074378 TGTTTACTATACTCACTATCTGG - Intergenic
1151034397 17:70781289-70781311 TGTTAACTATATTCACCCTATGG - Intergenic
1151394761 17:73815320-73815342 TGTTAACTGTAGTCATCCTATGG - Intergenic
1153169271 18:2296404-2296426 TGTTAACTATAGTCATTCTATGG - Intergenic
1153426691 18:4973533-4973555 TGTTCACAATAGCCACAATATGG + Intergenic
1155777966 18:29792170-29792192 TGTTAATTATAGAAACCACAGGG + Intergenic
1155983922 18:32209692-32209714 TGTTAACTACAGCAACCATCTGG - Intronic
1157685931 18:49642460-49642482 TATTAACTGTAGTCACCATGTGG + Intergenic
1157879907 18:51311650-51311672 TGTTGATTGTAGTCACCCTATGG - Intergenic
1159058706 18:63492232-63492254 GGTCAACTGTAATCACCATAGGG - Intronic
1159269221 18:66127565-66127587 TGTTCCCTAGAGTCTCCATATGG + Intergenic
1159297191 18:66508325-66508347 TATTAACTATAGTTACCATGTGG - Intronic
1159520896 18:69521753-69521775 TATTACCTATAGTCACTCTACGG - Intronic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1162669541 19:12243585-12243607 TATTCACAATAGTCAACATATGG - Intronic
1166285474 19:41824104-41824126 TGTTAAATATAGTCATCCTACGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
925455016 2:4008661-4008683 TGTTAACACTAGTCACCCAATGG + Intergenic
925559100 2:5168522-5168544 TATTAACTCTAGTCACCACGTGG - Intergenic
925767045 2:7246379-7246401 TGTGAAAAATAGTCACAATAAGG + Intergenic
926371747 2:12185591-12185613 TATTAACTGTAGTCACCATGTGG - Intergenic
927257777 2:21055336-21055358 TGTTACCTGTAGTCATCCTAAGG + Intergenic
928787003 2:34900207-34900229 TATTAACTATAGTCTTCATATGG + Intergenic
929326457 2:40617493-40617515 TATTGACTATAGTCACCCTATGG + Intergenic
930117221 2:47728613-47728635 TGTTACCTAAAGTCAGCATCTGG - Intronic
930288272 2:49461935-49461957 TGTTCACAATAGTCAAGATATGG - Intergenic
930772752 2:55144174-55144196 TGTTAACTATAGTCACGATGTGG - Intergenic
931436019 2:62247377-62247399 TGTTAACTATAATCACCCTAGGG + Intergenic
931736986 2:65204688-65204710 TATTAACCATGGTCACCATATGG - Intergenic
932998014 2:76881033-76881055 TGTCAACTATAGCCATCCTACGG - Intronic
933647567 2:84824942-84824964 TGGTGACTATAGTCACCTTTAGG - Intronic
935136468 2:100307672-100307694 TATTAACTGTAGTCAACATATGG - Intronic
935395216 2:102600899-102600921 TGTTAACTATAGAAACGATGTGG + Intergenic
935461332 2:103338464-103338486 TGTTAACTATAGTCACAATAGGG + Intergenic
936575822 2:113654321-113654343 TGTTAACAATAGCCAAGATATGG - Intergenic
936580389 2:113695218-113695240 TATTAACTATAGTCATCACGCGG - Intergenic
936793604 2:116181679-116181701 TTTTGACTTCAGTCACCATAAGG + Intergenic
936891945 2:117381227-117381249 TGTTAACTACAGTCATCCTACGG + Intergenic
937225179 2:120364595-120364617 TGTTAACTGTGGGCACCTTATGG - Intergenic
937444058 2:121941661-121941683 TGTTAACTGAAGTTCCCATATGG + Intergenic
938831935 2:135059676-135059698 TGTTAACTAAAGTCACTCTAAGG + Intronic
938957491 2:136312455-136312477 TGCTAACTATAGTCACTCTATGG + Intergenic
940570232 2:155422779-155422801 TGTTAACTATACTCATCCTACGG + Intergenic
940990955 2:160095881-160095903 TGTTCACTGTAGTCACCCTGTGG - Intergenic
941018475 2:160383690-160383712 TGTTAACTATAGTCATTCTATGG + Intronic
941037952 2:160588258-160588280 TTTTAACTATAGTCACTCTGTGG + Intergenic
941058859 2:160822181-160822203 TGTTGATTATAGTCACCCTGTGG + Intergenic
941529766 2:166653201-166653223 TATTAACTATAGTAGCCATGAGG + Intergenic
943338683 2:186650528-186650550 TATTAACTATAGTCAATCTACGG + Intronic
943357615 2:186876594-186876616 TATTAAATATAATCACCATGTGG + Intergenic
944015000 2:195025513-195025535 TATTCACTAAAGTCACCATGTGG - Intergenic
944611032 2:201408042-201408064 TGCCAACTATAGCCACCCTATGG + Intronic
945788008 2:214268368-214268390 TCTTCACAATAGTCACGATATGG + Intronic
947042825 2:225942988-225943010 TACTAACTGTGGTCACCATACGG + Intergenic
947997516 2:234541254-234541276 TATTAACTATGGTCACCATGTGG - Intergenic
1169895032 20:10494922-10494944 TAATAACTATAGTCACCATGAGG - Intronic
1170725315 20:18920881-18920903 TGTTACCTTTAGTTTCCATAGGG + Intergenic
1172215210 20:33230800-33230822 TGTTAACTGTAGGCACGATGTGG - Intergenic
1172879143 20:38187129-38187151 TTTTAATTACAGTCACCAAAGGG - Intergenic
1177464666 21:21459810-21459832 TATTAATTATAGTCACAATGCGG - Intronic
1177911178 21:27034378-27034400 TGTTAACTGTAGTCATCCTCTGG + Intergenic
1177958610 21:27633034-27633056 TGTTAACTATAGTCATTTTATGG - Intergenic
1180569954 22:16705115-16705137 TGATAATTATAGTCACCCTGTGG - Intergenic
1181391247 22:22583181-22583203 TGTTAACCATAGTCACATTGCGG + Intergenic
1181848330 22:25731216-25731238 TGTTGTCTATAGTCACTTTATGG + Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1182206076 22:28628506-28628528 TATTAACTATAGTCCTCATGTGG + Intronic
1182991603 22:34772986-34773008 TATTCACAATAGTCACCATGTGG + Intergenic
1183025283 22:35060965-35060987 TATTAACTATAGTCACCATGTGG - Intergenic
1185424587 22:50759137-50759159 TGTTAACAATAGCCAAGATATGG + Intergenic
949315737 3:2752662-2752684 TCTTAACTGTAGTCACCCTGTGG + Intronic
949796482 3:7856770-7856792 TGTTGACTCTTTTCACCATATGG - Intergenic
950225379 3:11229209-11229231 TGTTTACTATTGTCTCCTTATGG - Intronic
951382233 3:21997694-21997716 TGTTAACTTTAGATACCAAAAGG + Intronic
951652914 3:24972047-24972069 TATTAACTATATTCAGCCTATGG + Intergenic
951830124 3:26917273-26917295 TGTTAACTCTAGCCAGCAGATGG + Intergenic
952715700 3:36478290-36478312 AGTTAACAATAGTCACAATAGGG - Intronic
952844551 3:37676349-37676371 TGTTATCTGTAGCAACCATATGG + Intronic
953280825 3:41554647-41554669 TGTTAACTGTAGGCACCATATGG - Intronic
954530744 3:51317389-51317411 TATTAACTATAGTTACCACGTGG - Intronic
954805691 3:53218728-53218750 TGTTAATTATGGTCAGCCTACGG - Intergenic
956218464 3:66875443-66875465 TGTCTACTATAGACAGCATATGG - Intergenic
958125877 3:89354070-89354092 TGTTAACTATATTCCCCCAAGGG + Intronic
958439717 3:94141278-94141300 TGTTAACTATAGTCATCCTATGG - Intergenic
958599346 3:96274960-96274982 TATTAGCTATATTCACCATACGG - Intergenic
959487052 3:106938870-106938892 TGTTATCTTTAGTTTCCATAGGG + Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
960981796 3:123235635-123235657 AGTTAAAAAGAGTCACCATATGG + Intronic
961953691 3:130777381-130777403 TGTTAACTATAGTTACCCTACGG - Intergenic
962057783 3:131891012-131891034 TATTAACTATAGGCACTATGTGG - Intronic
962674191 3:137741731-137741753 TGTTAGCTATTGTCTCCAAAAGG + Intergenic
963370755 3:144396992-144397014 TATTAACTATAGTTACCACGTGG + Intergenic
963556805 3:146801418-146801440 TGGTAACCATAGTCACCATAGGG + Intergenic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
965769156 3:172162522-172162544 GGTTAAATACAGTTACCATAAGG - Intronic
966033724 3:175383482-175383504 TATTAACTACAGTTACCATGTGG + Intronic
966583911 3:181600022-181600044 TATTCACTATAGTCAAGATATGG - Intergenic
966737923 3:183204613-183204635 AGTTAACAAAAGTTACCATATGG + Intronic
970074964 4:12207711-12207733 TGTTAATTATAGTCACAAGAAGG + Intergenic
970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG + Intergenic
970881032 4:20931104-20931126 TATTCACAATAGTCAACATATGG + Intronic
971644919 4:29187222-29187244 TGTTAAATATTGTCACTATTTGG + Intergenic
971787779 4:31126751-31126773 TGTGAACTATATTAACCATTTGG - Intronic
972064983 4:34930870-34930892 TATTTACAATAGCCACCATATGG + Intergenic
972236643 4:37142256-37142278 TATTAACTGTAATCACCATATGG + Intergenic
973914316 4:55618037-55618059 TGTTCACTGTACTCAGCATATGG + Intronic
974068642 4:57103903-57103925 TATTAATTATAGTCATCATGAGG + Intronic
974568960 4:63619022-63619044 ATTTAACTATAGACAGCATAAGG + Intergenic
974651724 4:64762665-64762687 TCTTTATTATAGTCATCATAGGG + Intergenic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
974801118 4:66819431-66819453 TGTTTACAATAGCCACGATATGG + Intergenic
976618343 4:87101085-87101107 TTCTAACTATTGTCACCATTTGG + Intronic
977782907 4:100999260-100999282 TGTTAATTATAGTCATCCAATGG + Intergenic
978081588 4:104599600-104599622 TATTAACTCTAGTTACCATATGG + Intergenic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
980323710 4:131312458-131312480 TGTTTTATATAGTCACAATAAGG - Intergenic
980664816 4:135917668-135917690 TGTCAACTATAGTCATCCTACGG - Intergenic
981071834 4:140548985-140549007 TGGTGACTATATTCACCATTTGG - Intronic
981180851 4:141742313-141742335 CATTAACCATAGTCACCATACGG - Intergenic
982167214 4:152625070-152625092 TGTTTTCTTTAGTCAACATAAGG + Exonic
982881536 4:160724296-160724318 TATTCACTATAGTCAATATATGG - Intergenic
983100278 4:163617320-163617342 TGTTAGCTATATTCACTTTATGG - Intronic
983184570 4:164687093-164687115 TGTAAATTTTAGTCACAATACGG - Intergenic
983192625 4:164770902-164770924 TGGTAACTATGGTTACCATGTGG - Intergenic
983497917 4:168464759-168464781 TGTTAATTATATCCACCCTATGG + Intronic
983621641 4:169767904-169767926 TCTTAACTGTAGTCACAATGTGG - Intergenic
983669843 4:170223481-170223503 TGTTTACGATAGTCAAAATATGG + Intergenic
983857051 4:172659425-172659447 TGTTAACTGTAGTCGTCCTATGG + Intronic
984188130 4:176571399-176571421 TGTTAAACATAGTTACCATGTGG - Intergenic
984218012 4:176938357-176938379 TGTAAACTTTATGCACCATAAGG - Intergenic
984306212 4:177995077-177995099 TATTAACTATAGCCACTATGCGG - Intergenic
984921156 4:184765576-184765598 TGTTAGCTCTAGTCACCACGTGG - Intronic
986117249 5:4788167-4788189 TATTAACTATAATCATCATGTGG - Intergenic
986160047 5:5219284-5219306 TGTTAACTATCGTCACCCTATGG + Intronic
986234027 5:5891087-5891109 TGTTAACTATGGTCATCACTGGG + Intergenic
986837317 5:11653166-11653188 TGTTAATAATAGTCAAGATATGG - Intronic
987413668 5:17640207-17640229 TGTTAACTATAGTCACCATGTGG + Intergenic
987512666 5:18860444-18860466 TGTAAATTTTAATCACCATAGGG + Intergenic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
987987633 5:25169181-25169203 TATTTACTATAATCACCATGAGG - Intergenic
988111585 5:26829461-26829483 TGTCAACTGTAGTCACCCTATGG - Intergenic
988258708 5:28854151-28854173 TATTAACTATAGTCACCCTGTGG - Intergenic
988310061 5:29544791-29544813 TATTAACTATAGTCACCATGCGG + Intergenic
988394673 5:30681278-30681300 TATTAACTATAGTGACTATATGG - Intergenic
989210915 5:38858169-38858191 TGTTAGCTATAATCACCCTGTGG + Intronic
989610993 5:43291394-43291416 TGTATACTAAATTCACCATAAGG - Intronic
990741684 5:58919018-58919040 TGTTACCTTTAGTTTCCATAGGG - Intergenic
990783031 5:59387849-59387871 TGTTAACTATAGTCACCCTGAGG + Intronic
991602164 5:68363981-68364003 AGTTAACCATATTCACCCTATGG - Intergenic
993770831 5:91924109-91924131 TATTATCTATATTCACCATAAGG - Intergenic
994296134 5:98090551-98090573 TGTTAGCTATGGTCACCATGTGG + Intergenic
995192331 5:109330814-109330836 TGGTAGCTAAAGTCACCTTAGGG + Intergenic
995286415 5:110393991-110394013 TGTTGACTGTAGTCACCATGTGG + Intronic
995700615 5:114930740-114930762 TGATAGCTATAGTCAGCATAAGG - Intergenic
996314649 5:122148295-122148317 TGATACCTTTAGTCACAATAAGG + Intronic
996507234 5:124281268-124281290 TATTAACTATAGACACTATGAGG + Intergenic
996577533 5:124992762-124992784 TACTAACTATATTCACCATGAGG + Intergenic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
1000399352 5:160809592-160809614 TGTTAACAATAGTCATCTTACGG + Intronic
1000573112 5:162939443-162939465 TGTTCACTATAGTCCCCCTACGG - Intergenic
1000991714 5:167917852-167917874 TGTTGACAAAAGTCTCCATAAGG + Intronic
1001183996 5:169549585-169549607 TTCTAACTATAGCCACCATGAGG - Intergenic
1002839695 6:895079-895101 TGTTAACTGCAGTCATCCTATGG - Intergenic
1002982241 6:2149775-2149797 AGTTAAATATAGTCACCGTTGGG - Intronic
1004238436 6:13896583-13896605 TATTAACTGTAGTCATCCTATGG + Intergenic
1005530239 6:26697263-26697285 TATTAACTGTAGTCACCATACGG - Intergenic
1005540557 6:26804383-26804405 TATTAACTGTAGTCACCATACGG + Intergenic
1005776124 6:29132301-29132323 TGTTAACAACAGTCACGCTATGG - Intergenic
1006074496 6:31522487-31522509 TATTAAGTTTAGTCACCATAAGG - Intergenic
1007456678 6:41983532-41983554 TATTAACTATAATCACCATGTGG + Intronic
1008410349 6:51171453-51171475 TGTTAACTATAGACATCCTTGGG - Intergenic
1009011371 6:57846480-57846502 TATTAACTGTAGTCACCATACGG + Intergenic
1009031375 6:58062804-58062826 TGTAAACTATAGGGACCAAAAGG + Intergenic
1009405850 6:63311798-63311820 TATTAACTGTAGTCACCATGTGG + Intronic
1009602597 6:65821568-65821590 TGTTAACAATAGTCAAGATTTGG + Intergenic
1009831225 6:68938592-68938614 CATTAACCATAGTCACCATGCGG + Intronic
1010299068 6:74237675-74237697 TGTTAACAATAGTCAAGATTTGG - Intergenic
1010632479 6:78215063-78215085 TTTTAACTATAGTCACCCTATGG + Intergenic
1011220154 6:85046495-85046517 TGCTAACTATGGTGACCATAAGG - Intergenic
1012230653 6:96757357-96757379 TATTAACTATAGTCACCATGTGG - Intergenic
1012713282 6:102635908-102635930 TTTTAATTAGACTCACCATAAGG - Intergenic
1013545599 6:111153907-111153929 TGTTAACTGCAGAAACCATATGG - Intronic
1014345299 6:120262791-120262813 TATTAACTATAGCCACCATGTGG - Intergenic
1014353327 6:120371973-120371995 TGTTAACTATAGGCACAATGTGG - Intergenic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1016212871 6:141561878-141561900 TGCTGACTATAGTCACCCTGCGG + Intergenic
1016405694 6:143727381-143727403 TGTTAACAATAGCCAAGATATGG - Intronic
1016624522 6:146150610-146150632 TGTTAACTATAGTCACCCTGTGG + Intronic
1016642953 6:146371519-146371541 TATTGACTATAGTCACCCTACGG + Intronic
1016657626 6:146540145-146540167 TGTTAACTGTAGGCACAATGTGG + Intergenic
1020053118 7:5096292-5096314 TGTCAATTATAGTCACCCTATGG + Intergenic
1020442536 7:8233694-8233716 TGTTAACAATAGGCACCATGGGG - Intronic
1020516637 7:9129562-9129584 TATTAACTAGAGTCATCATGTGG + Intergenic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1022124715 7:27344550-27344572 TATTAACTATAGTCACCCTGTGG + Intergenic
1023137472 7:37066577-37066599 TATTAACTATAGTCATCCTACGG - Intronic
1023462278 7:40411709-40411731 TGTTAACTATAGTCAACCAACGG - Intronic
1023471481 7:40526348-40526370 TGTTAACTGTTTTCACCATCAGG + Intronic
1023490108 7:40730601-40730623 TATTAACTATAATCACCACTTGG + Intronic
1024108090 7:46113822-46113844 TATTGACTATAGTCACCCTGTGG + Intergenic
1024923210 7:54582988-54583010 TGCTAACTATAGTTATCCTATGG - Intergenic
1025569274 7:62537349-62537371 TTTTCACTATAGTCATCAAAGGG - Intergenic
1026395918 7:69954232-69954254 TGTTAACTATAGTCACTATGTGG - Intronic
1027543354 7:79496158-79496180 TGTTCACAATAGCCACGATATGG - Intergenic
1028205943 7:88017208-88017230 CGTTAAATATATTCACCCTACGG - Intronic
1028338475 7:89687929-89687951 TGTTAACTATAGTCAGCTCGTGG + Intergenic
1028869356 7:95750790-95750812 TATTTACAATAGTCAACATATGG - Intergenic
1030672626 7:112353869-112353891 TGTTACCTATAGTCATCCTACGG + Intergenic
1031559513 7:123221240-123221262 TGTTGACTATAGTCACTCTGTGG + Intergenic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1031909263 7:127497339-127497361 TGTTCACAATAGTCAAGATATGG + Intergenic
1033725870 7:144117928-144117950 TGTAAATTACAGTCACCATCAGG - Intergenic
1033932614 7:146542997-146543019 TATTAACTATAGTCATCATGTGG - Intronic
1036089057 8:5645329-5645351 TGTTAACTATAGCCATCTTACGG - Intergenic
1038645418 8:29357586-29357608 TGTTAACTATATTCACCCTACGG + Intergenic
1039108685 8:34018490-34018512 TGTTAATTATAGTTATCATATGG + Intergenic
1039215442 8:35265145-35265167 TGTTAACTGTAGTCTAAATAAGG - Intronic
1039318482 8:36400149-36400171 TGTTAACTGTAGTCACCCTATGG - Intergenic
1039360099 8:36866807-36866829 TATTAACTATAGTCACTTTACGG - Intronic
1039367165 8:36941418-36941440 TGAGAACTAAATTCACCATATGG + Intergenic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040061296 8:43105234-43105256 TGTTAATTATAGTCATCCTATGG + Intronic
1040758708 8:50811894-50811916 TATAAACTATAGTCACCAGAAGG - Intergenic
1040919173 8:52597978-52598000 TGTTATCTTTAGTTTCCATAGGG - Intergenic
1041755246 8:61306572-61306594 TATTAACAATAGCCAGCATATGG - Intronic
1041776807 8:61531961-61531983 TATTTACTATAGTCAAGATATGG - Intronic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1043115400 8:76246876-76246898 TGTTAACTATATTCACTGTATGG - Intergenic
1043384913 8:79738894-79738916 TGTTGACCATAGTCACCCTGTGG + Intergenic
1044069654 8:87741577-87741599 TATTAACAATAGTGACTATAAGG - Intergenic
1044167710 8:89007561-89007583 TATTAACTACAGTCACTATGTGG - Intergenic
1044934555 8:97280315-97280337 TGTTAACTATAGTATTCATTTGG + Intergenic
1045110082 8:98932080-98932102 TGTTAATTATTGTTACCATCAGG - Intronic
1045932236 8:107640860-107640882 TCCAAACTATAGTCACCCTAAGG + Intergenic
1046889879 8:119411211-119411233 TGTTGACTATAGTCACCCTATGG + Intergenic
1048160903 8:132020682-132020704 TATTCACAATAGTCAACATATGG + Intergenic
1050201987 9:3155388-3155410 CGTTAACTATTGTCATCCTATGG + Intergenic
1050357865 9:4799983-4800005 GGTTATCTAGAGTCACTATAAGG + Intronic
1051448352 9:17165918-17165940 TGTTAACTATAGAGACCTTTGGG + Intronic
1052077859 9:24166366-24166388 TATTAATGGTAGTCACCATATGG + Intergenic
1052985463 9:34483615-34483637 TGTTAACTAAAGTTATTATAAGG - Intronic
1055082896 9:72284621-72284643 TTTTAATTATAGTCATCCTAGGG + Intergenic
1055424475 9:76180256-76180278 TATTAACTCTAGTCATCATGAGG + Intronic
1055424829 9:76183648-76183670 TCTTAACAGTAGTCATCATACGG - Intronic
1055484443 9:76743809-76743831 TGTTAACTTTAGTTACCTTGGGG + Intronic
1055727558 9:79247751-79247773 TATTAACAATAGTCACCATGCGG - Intergenic
1058213128 9:102198417-102198439 TATTAACTATGGCCACCATATGG - Intergenic
1059614645 9:115935754-115935776 TTTTAACTATAGTCACCGTATGG + Intergenic
1059804611 9:117785082-117785104 TCTTAATTATAGTCACCAGGTGG + Intergenic
1059886833 9:118754227-118754249 TGTTTACAATAGCCAACATATGG + Intergenic
1060164251 9:121396169-121396191 TGTTAATTATAGTCATCCTATGG + Intergenic
1060469855 9:123939277-123939299 TTTTGAAAATAGTCACCATACGG + Intergenic
1186477905 X:9872835-9872857 TGTTAAATGTAGTTATCATAGGG + Intronic
1187605996 X:20884209-20884231 TTTTAACAATATTAACCATATGG + Intergenic
1187818045 X:23255016-23255038 TGTTGAATATAGTAACCCTACGG - Intergenic
1188266564 X:28083493-28083515 TGTTAACTATAGTTGCCCCATGG - Intergenic
1188287638 X:28347622-28347644 TGTTAACTATAGTCACCATGAGG + Intergenic
1188500568 X:30821255-30821277 TGTTAACTATGGTCACCAGGTGG - Intergenic
1188662099 X:32773444-32773466 TGGTAACTATAATCACTCTAGGG + Intronic
1189541191 X:41991724-41991746 TGTTAGCTATAGTTGCCCTACGG - Intergenic
1189627207 X:42911601-42911623 TATTTACTATAGTCAAGATATGG + Intergenic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1190992083 X:55562448-55562470 TATTAACTATTGTCACCATGTGG + Intergenic
1191218538 X:57959966-57959988 TGTTAATTATAGTTACCCTATGG - Intergenic
1192475793 X:71441612-71441634 TATTAACTATAGTCATTCTACGG + Intronic
1193057745 X:77172523-77172545 TGTTAACTGTAGCCATCCTATGG - Intergenic
1193211788 X:78815309-78815331 CCTTAACTATAGTCACCTTCCGG - Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1193822055 X:86177174-86177196 TGTTGACTGTAGTCACCCTGTGG + Intronic
1193825458 X:86220286-86220308 TGTTTACTATAGGCACTATGTGG + Intronic
1193933885 X:87590913-87590935 CATTTACTATAGTCAACATATGG - Intronic
1194232829 X:91345736-91345758 TGTTAGCTATAGTCATCCTATGG + Intergenic
1194363295 X:92982000-92982022 TATTGACTATAGTCACCTTGTGG - Intergenic
1195539940 X:106052274-106052296 TGTTCACAATAGCCAACATATGG + Intergenic
1196119367 X:112032465-112032487 TGTTCACAATAGACAACATATGG + Intronic
1196384714 X:115137095-115137117 TATTAACTATAGTCAACCTATGG + Intronic
1196942637 X:120792409-120792431 TATTTATTATAGTCACCATTTGG + Intergenic
1197538116 X:127717105-127717127 TATTAACCGTAGTCACCATAAGG - Intergenic
1198453106 X:136787531-136787553 TGTTAAACATAGTTACCATATGG + Intergenic
1198985685 X:142450176-142450198 TGTTAGCTGGAGTCACCATACGG + Intergenic
1199102204 X:143815626-143815648 TTTTGACTATAGTCACCTTGTGG - Intergenic
1199303583 X:146241024-146241046 TGTTAACCATAGTAAAGATATGG - Intergenic
1199866013 X:151850882-151850904 TATTAACTATAGTCACCATACGG - Intergenic
1200335252 X:155344074-155344096 TATTAACTATAGTCATCACATGG + Intergenic
1200351216 X:155497147-155497169 TATTAACTATAGTCATCACATGG - Intronic
1200671536 Y:6098249-6098271 TATTGACTATAGTCACCTTGTGG - Intergenic
1200738019 Y:6821468-6821490 TGTTATCTACAGTCACCGTAAGG + Intergenic
1200881827 Y:8221855-8221877 TGGTAAACGTAGTCACCATAGGG - Intergenic
1200956651 Y:8955476-8955498 TGGTGACTGTAGTCACCACAGGG + Intergenic
1201352622 Y:13061480-13061502 TGTTAACAATAGCAAACATATGG + Intergenic
1201725616 Y:17147480-17147502 GGTTGACTATAGTCACCCTGAGG - Intergenic
1201914268 Y:19165871-19165893 TAATAACTATATTCACCATGTGG + Intergenic
1202105969 Y:21366016-21366038 TGGTAACCATAGTCACCATAGGG - Intergenic
1202201666 Y:22357899-22357921 TGGTAACCATAGTTACCATAGGG + Intronic
1202234031 Y:22689219-22689241 TGGTAATCGTAGTCACCATAGGG + Intergenic
1202309125 Y:23506939-23506961 TGGTAATCGTAGTCACCATAGGG - Intergenic
1202561676 Y:26163653-26163675 TGGTAATCGTAGTCACCATAGGG + Intergenic