ID: 1080393696

View in Genome Browser
Species Human (GRCh38)
Location 11:31871218-31871240
Sequence GTGGCCAAACGCACAGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080393696_1080393701 -3 Left 1080393696 11:31871218-31871240 CCTATCCCTGTGCGTTTGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1080393701 11:31871238-31871260 CACAATGCAAAGGCGCCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080393696 Original CRISPR GTGGCCAAACGCACAGGGAT AGG (reversed) Intronic
900627735 1:3617006-3617028 GTGGCCAGACACACAGGCCTGGG + Intergenic
903855855 1:26337212-26337234 GTGGCCAGAGGCAGAGGGATGGG + Intronic
905865322 1:41373413-41373435 GTGTGCAAAGGCACAGGGATGGG + Intronic
906644398 1:47463458-47463480 GTGGGCAAAAGCACAGAGGTAGG + Intergenic
910125063 1:83831546-83831568 GTTGCCAAACACCAAGGGATTGG + Intergenic
912460263 1:109826053-109826075 GTGGCCCAAAGCAGAGTGATGGG - Intergenic
917142296 1:171848211-171848233 CTGGCCCAATGCAAAGGGATGGG - Intronic
917954510 1:180080003-180080025 TTGCCCAAAGTCACAGGGATAGG + Intronic
1065122414 10:22542691-22542713 GTAGCCAAACACACAGAGCTGGG - Intronic
1073498117 10:103912455-103912477 CTGACCAAACGCAAAAGGATAGG + Intronic
1074344629 10:112671679-112671701 GTGGCCATACGCACAGATCTTGG - Intronic
1075122324 10:119673083-119673105 ATGGGCAAAGGCACAGGGGTGGG - Intronic
1076278781 10:129227397-129227419 GTGTCCACATGCACAGGTATGGG + Intergenic
1080393696 11:31871218-31871240 GTGGCCAAACGCACAGGGATAGG - Intronic
1082783754 11:57305196-57305218 GTGGTCAAAGCCACAGGCATAGG - Intronic
1083324524 11:61866608-61866630 GGGGCCAAATGGCCAGGGATTGG - Exonic
1084087745 11:66862321-66862343 CTGGCCACACACACAGGCATAGG + Intronic
1086273706 11:85098351-85098373 CTGTCCAAATGCACAGGGACTGG + Intronic
1096877271 12:54639740-54639762 ATGGCCTAACACACAGGGAGGGG - Intergenic
1102099417 12:110266911-110266933 GGGCCCAGAGGCACAGGGATTGG - Intergenic
1112812903 13:103239620-103239642 ATGACCAATCGCACAGGGATAGG + Intergenic
1112848496 13:103673698-103673720 CTGGCCAAAGGCCCAGGAATAGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1127194388 15:56568451-56568473 GTGGCCAGAGGCACTGGGAAAGG + Intergenic
1128732928 15:70033309-70033331 GGGCACAGACGCACAGGGATGGG + Intergenic
1135582707 16:23641678-23641700 ATGGCCAAAGGGACAGGGGTTGG - Intronic
1144639302 17:16928733-16928755 GTGCCCATACTCACAGGCATAGG - Intergenic
1150627401 17:66850202-66850224 GAGGCCAAAAGAGCAGGGATGGG - Intronic
1150654934 17:67033290-67033312 CTGGCGAAACACACAGGGGTGGG - Exonic
1150822482 17:68446611-68446633 CTGGCAAAAGGCACAGTGATTGG - Intronic
1155310511 18:24518443-24518465 GCAGCCAAACGCCCAGGCATTGG - Intergenic
1155319082 18:24601192-24601214 GTGGCCAAATGTACTGAGATTGG - Intergenic
1160876264 19:1297601-1297623 GTGGACAATCGAACAGGGGTGGG - Intronic
1160992259 19:1864564-1864586 GGGGCCGAACGCAAAGGGCTGGG + Intergenic
1161623725 19:5313369-5313391 GTGGTCCATTGCACAGGGATGGG + Intronic
1168583598 19:57575612-57575634 GTCCCAAAATGCACAGGGATGGG - Intronic
925025940 2:607328-607350 GAGGCCACAGCCACAGGGATCGG + Intergenic
928610963 2:32992406-32992428 GTGGACAAAAGCCCAGGGATGGG + Intronic
929889720 2:45908825-45908847 GTGGGCAAAACCACAGAGATGGG + Intronic
938173342 2:129102282-129102304 CTGGCCTAACACTCAGGGATAGG - Intergenic
947637126 2:231685851-231685873 GTGGGCACACGCTCAGGCATAGG - Intergenic
948468585 2:238163767-238163789 GGGGCCACACGTACAGGGTTCGG - Exonic
948783782 2:240340507-240340529 AGGGCCAAACCCACAGGGCTGGG + Intergenic
1172598854 20:36169646-36169668 GTGGGCAAATGCCCAGAGATGGG - Intronic
1174890146 20:54383178-54383200 GTGGCCACAAGCACAGGATTAGG - Intergenic
1175631475 20:60541593-60541615 GCTGCCAAAAGCACAGGGATGGG + Intergenic
1178102439 21:29284249-29284271 GTGGCCAAGAGCACAGATATTGG + Intronic
1179835413 21:44028595-44028617 GTGTGGAGACGCACAGGGATGGG + Intronic
1181354602 22:22290467-22290489 GTGGTCAAACACACAGGGCATGG - Intergenic
1183971664 22:41482111-41482133 GTGGGCAAACGCTGAGGGAAGGG - Intronic
1184503080 22:44885656-44885678 GTGGCCAAATGCACAGGACCTGG + Intronic
951896625 3:27615455-27615477 GCAGCCAAATGCACAGGGACAGG - Intergenic
956667127 3:71652534-71652556 GTGGCCAACCCCACAGGGCCTGG - Intergenic
958546478 3:95558778-95558800 GTGGCTAAAAGCACAGGGGAAGG + Intergenic
962410325 3:135135683-135135705 GTGGCCACAGGCACAGAGAGGGG - Intronic
964310465 3:155386554-155386576 GTGGCCAAACACCCAGGCAAGGG + Intronic
966659324 3:182396941-182396963 GTGGCCCAAAGCACAGGGGAAGG + Intergenic
968868161 4:3227113-3227135 GTGGCCAAATGCAGCGGGGTTGG - Intronic
979736189 4:124088195-124088217 GTGGCCCAAACCACTGGGATTGG - Intergenic
982172651 4:152676834-152676856 GTGGCCAAACAGAGAGGAATGGG - Intronic
988549947 5:32191326-32191348 GTGGCCTCACTCACAGGTATGGG + Intergenic
988896873 5:35684452-35684474 GTGGCCAAACACAATGGAATAGG - Intronic
994054399 5:95399522-95399544 GTGGGCACAGTCACAGGGATTGG + Intronic
999250238 5:150178218-150178240 GTGGCCTAATCCACATGGATGGG + Intronic
1004883178 6:20028362-20028384 CTGGCCACACCCACAGGGCTGGG - Intergenic
1011099574 6:83707901-83707923 CGGGCCAAACGCTCACGGATCGG - Exonic
1013468958 6:110443909-110443931 GTGGCCAAACTCATAGAGACAGG + Intronic
1015869787 6:137764531-137764553 GTTGCAAAAGGCACAGGGCTAGG - Intergenic
1018608128 6:165620599-165620621 GTGGCCAAAGGCAGAGGAAGAGG + Intronic
1021429104 7:20539180-20539202 GTCTCCACACTCACAGGGATAGG - Intergenic
1026787145 7:73308815-73308837 GTGGCAAAACGCACCCGGCTCGG + Exonic
1028067254 7:86402232-86402254 ATGGCCAAAAGCACATGTATAGG + Intergenic
1030107453 7:105999042-105999064 GTGGCCACACTCACAGGGAAGGG - Intronic
1032385531 7:131520378-131520400 CTGGACAACCGCACAGGGATAGG - Intronic
1035043210 7:155945912-155945934 CTGCCGAAACGCACAGGGAAAGG - Intergenic
1036588662 8:10147993-10148015 GTGGCCAAGTGCACAGGTACGGG - Intronic
1041484595 8:58360587-58360609 GTAGTCAAACGGACAGGGTTGGG + Intergenic
1049437643 8:142595108-142595130 GTGGACAGACCCACAGGGGTGGG - Intergenic
1056825220 9:89872419-89872441 ATGCCCCAAAGCACAGGGATGGG - Intergenic
1057691283 9:97288744-97288766 GTGGCCAAGGGCACAGGGAGAGG + Intergenic
1059641807 9:116224387-116224409 GAGGCCAAAGGCAGAGGGAATGG - Intronic
1060557994 9:124519284-124519306 GTGGGCAAGCCCCCAGGGATAGG - Exonic
1196242287 X:113355869-113355891 GTGACCAAGCACAGAGGGATAGG - Intergenic
1196757688 X:119172240-119172262 GTGCCCAAAGGCCCAGGGACAGG - Intergenic
1198411985 X:136379816-136379838 GTAGTCAAAATCACAGGGATCGG - Intronic