ID: 1080396127

View in Genome Browser
Species Human (GRCh38)
Location 11:31891660-31891682
Sequence TAGGGAGAACATCTTGCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080396120_1080396127 19 Left 1080396120 11:31891618-31891640 CCCTGTGTCTTCAGAGATAAAGA 0: 9
1: 41
2: 88
3: 133
4: 511
Right 1080396127 11:31891660-31891682 TAGGGAGAACATCTTGCGAATGG 0: 1
1: 0
2: 0
3: 10
4: 90
1080396121_1080396127 18 Left 1080396121 11:31891619-31891641 CCTGTGTCTTCAGAGATAAAGAT 0: 7
1: 30
2: 82
3: 133
4: 381
Right 1080396127 11:31891660-31891682 TAGGGAGAACATCTTGCGAATGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080396127 Original CRISPR TAGGGAGAACATCTTGCGAA TGG Intronic
903586156 1:24416737-24416759 AAGGGAGTACAGCTTGCAAAGGG + Intronic
904055212 1:27665519-27665541 TAGGGAGAACAGTTTGCATATGG - Intergenic
904264020 1:29307467-29307489 TAGGGAGGACTCCTTGGGAATGG - Intronic
916361901 1:163979532-163979554 TGGGGAGAACAGCTTGTGAAGGG + Intergenic
918549646 1:185727443-185727465 TTGAGAGGACATCTTGAGAAGGG + Intergenic
922812681 1:228426578-228426600 TAAGGAGAACATCTTTCATATGG - Intergenic
1068628642 10:59276610-59276632 TAGGCAGAACCTTTTGCAAAGGG + Intronic
1069185495 10:65417541-65417563 TAGGGAGTACATCTTCCATATGG - Intergenic
1072016542 10:91352674-91352696 TAGGGAGAAAAGCTTGCTTATGG + Intergenic
1075073213 10:119332725-119332747 AAGGGAGACCAGCTTGTGAATGG - Intronic
1075836266 10:125455527-125455549 TAGGGACAACCTCTGGTGAAGGG - Intergenic
1078075681 11:8158249-8158271 TAGGGAGAACATCGTGACAAAGG + Intronic
1079643885 11:22839183-22839205 TAGGTATAACATCCTGAGAAGGG - Intergenic
1080396127 11:31891660-31891682 TAGGGAGAACATCTTGCGAATGG + Intronic
1083158614 11:60841052-60841074 TAGGAAGAACATCTTGGAAGTGG - Intergenic
1084058779 11:66655668-66655690 TAGAGAGAATATCTTGAGCAAGG + Intronic
1086405267 11:86494022-86494044 TGGGGGGAATATCTTGCAAACGG + Intronic
1095698859 12:45170592-45170614 GAGGGAGAACATGTTCCGCAAGG + Intergenic
1096595634 12:52693251-52693273 TAGGGAGATCATCCTGGAAAAGG - Intronic
1097739742 12:63226827-63226849 TATGGAGAGCCTCTTGAGAAGGG + Intergenic
1099502185 12:83427632-83427654 TAGGAAGAATATCTTGAAAACGG - Intergenic
1112833939 13:103490709-103490731 TACAGAGAACATCTAGAGAATGG - Intergenic
1113445552 13:110363662-110363684 TAGAGAGAATATCTTGCCAATGG - Intronic
1114189260 14:20428648-20428670 TAGGGAAAACATATAGGGAAAGG - Intergenic
1114297153 14:21340254-21340276 TAGGGAGAAGAGCTTGCTCAAGG + Intronic
1118003654 14:61545936-61545958 GAGAGAGGACATCTTGTGAATGG - Intronic
1118198523 14:63650522-63650544 TGGTGAGAACATCCTGTGAAGGG + Intergenic
1119415125 14:74464812-74464834 CAGTGAAAACATCTTGAGAAAGG + Intergenic
1120632472 14:86906989-86907011 TATGGAGCACATGTTGAGAAGGG + Intronic
1120707448 14:87759529-87759551 TATGGAGAAAATCTTGGGAATGG + Intergenic
1122416660 14:101553043-101553065 TAGGGCAAACACCTTGAGAATGG - Intergenic
1123951738 15:25285297-25285319 TAGGGAGAAAAGCATGGGAAGGG - Intergenic
1131964459 15:97826679-97826701 GAGGGAGAACAACTAGAGAAAGG - Intergenic
1132426948 15:101725472-101725494 AAGGGAGAAAATTTTGAGAAAGG + Intergenic
1137488639 16:48912437-48912459 CAGGGAGAACACCATGGGAAGGG + Intergenic
1138148517 16:54634059-54634081 TAGGGAGACCATTTTGAAAATGG + Intergenic
1139816520 16:69678623-69678645 TGGGGAGAACATTTTGGAAATGG + Intronic
1146501997 17:33372534-33372556 TAGGGAGAAGATGCTGGGAAGGG - Intronic
1151143910 17:72020948-72020970 TAGGGAGAGCATCTTCCTATGGG + Intergenic
1159575491 18:70170990-70171012 TAGGAAGAACATATTTGGAAGGG + Intronic
1163077962 19:14912670-14912692 TAGGGAAAACATCTTAACAAAGG - Intergenic
928317998 2:30260584-30260606 CAGGGAGAACAGCTTGGCAAGGG + Intronic
929644923 2:43616755-43616777 TAGGGACCACCTCTTGTGAAGGG - Intergenic
933343974 2:81060303-81060325 TAGGGAGAGAATCTGGCAAATGG + Intergenic
933512429 2:83257999-83258021 TAGGGAGGACATCTTTCACATGG + Intergenic
936924762 2:117725078-117725100 TAGGGAGGACATCTTTCGCCTGG + Intergenic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
939416982 2:141912699-141912721 TAGGGAGGACATCTTTCACATGG - Intronic
940296418 2:152130127-152130149 TAGGGAGAACCTGTAGTGAAAGG - Intronic
940796013 2:158079683-158079705 CAGGGAGAACATATTGGAAAAGG - Intronic
942108557 2:172657703-172657725 TAGGGAGAGCATCTTTCACATGG - Intergenic
945702041 2:213183849-213183871 GAGGAAGAAAATCTTGCAAAAGG - Intergenic
947399797 2:229720161-229720183 TAGAGAGACCATTTTGCCAATGG + Intergenic
1172608836 20:36234405-36234427 TAGGGATAACAGATTGCTAAAGG - Intergenic
1178029053 21:28504239-28504261 CAGGGAGTACATCTTGCATAAGG - Intergenic
1180112856 21:45672369-45672391 TAGGGAGTACATCTTTCTTAGGG + Intronic
1182916538 22:34038037-34038059 TAGGGATAACATCTTCCTCATGG + Intergenic
957676963 3:83379482-83379504 TAGGGAGAACATCTTTCATATGG + Intergenic
960993360 3:123325745-123325767 CAGGGAGAACTCCTTGCAAATGG - Intronic
962930736 3:140033459-140033481 TGGGGAGGACATCTGGCTAAAGG - Intronic
963806676 3:149729510-149729532 TAGTGAGAAGAACTTGAGAACGG - Intronic
967467132 3:189820555-189820577 TAGGGAGAGCATCATCAGAAGGG + Intronic
969191639 4:5525960-5525982 TAGGGAGGACATCTTTCACATGG + Intronic
971336450 4:25727924-25727946 CAGGCAGAACATCTTGCTGAGGG - Intergenic
974034860 4:56809109-56809131 TAGGGAGAACATCTTTCACAGGG - Intergenic
976269369 4:83215878-83215900 TAGCCAAAACATCTTGAGAAAGG + Intergenic
978803438 4:112776503-112776525 TAGGGAGCACATCTTCCATATGG + Intergenic
981664702 4:147210601-147210623 AAGGGAGAACATCTAGGAAATGG - Intergenic
984100813 4:175483401-175483423 CAGGGAGAACATCTTTCTTATGG + Intergenic
986627571 5:9736928-9736950 TAGGGAGAACTTAATGAGAAAGG - Intergenic
990628341 5:57640067-57640089 TAGGAAGAAGATCCTGCAAATGG - Intergenic
990813221 5:59752542-59752564 TAGGGAGTAAATTTTGTGAAGGG - Intronic
995864570 5:116677582-116677604 TAGGAAGACCACCTTGAGAAAGG - Intergenic
999839610 5:155411158-155411180 TAGGGGGAACATCTTACAAATGG - Intergenic
1006555157 6:34859538-34859560 CAGGGACAACATCTTGTGCATGG - Exonic
1009726737 6:67544370-67544392 TTGGGAGAAAAACTTGCAAATGG - Intergenic
1010352651 6:74893257-74893279 TAGGGAAAATATCTTGCTCAAGG - Intergenic
1012987695 6:105892670-105892692 CAGAGAGAACAGCTTGTGAAAGG - Intergenic
1013803418 6:113971269-113971291 TAGGGTGAACAACCTGCGCAAGG + Exonic
1016531866 6:145067181-145067203 TATAGAGAGCATCTTGGGAAGGG + Intergenic
1017529129 6:155270185-155270207 TGGGGAGAACAGTTTGGGAATGG + Intronic
1024107545 7:46108417-46108439 TGGGGAGTAAACCTTGCGAAGGG + Intergenic
1024966954 7:55032143-55032165 TTGGCAGAACATCTTGTGAATGG - Intronic
1028525683 7:91783259-91783281 TAGGGAGAACATCTCAGGAATGG - Intronic
1031337756 7:120557568-120557590 TAGGGAGAACTCCTTGGAAAAGG - Intronic
1034388769 7:150765500-150765522 TAGGGAGAACACCTTTCACATGG + Intergenic
1036729916 8:11253633-11253655 CAGGGAGAAGAGCCTGCGAAGGG - Intergenic
1039665115 8:39517601-39517623 TGGGGAGAACAGCTTGAAAAAGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041483999 8:58353936-58353958 TAGGGAGAACATTTGGCAGATGG + Intergenic
1042146631 8:65736565-65736587 TAGGGACAAGGTCTTGCTAATGG - Intronic
1042429704 8:68690962-68690984 TAGGGAGAACATCTTCCATATGG + Intronic
1042985479 8:74578559-74578581 TAGTGAGAACATTTTGCAGATGG + Intergenic
1044030620 8:87230874-87230896 TATGGAGAATATCTAGTGAAAGG + Intronic
1045946662 8:107804337-107804359 TAGGGTGAAGATTTTCCGAAAGG - Intergenic
1050135894 9:2463955-2463977 TAGGAAGCATATCTTGCCAAAGG + Intergenic
1050224616 9:3438059-3438081 TATGGAGAACATCTTGGAGATGG - Intronic
1051331822 9:16031787-16031809 TAGGGGGAACATGTTGAGATGGG + Intronic
1057281141 9:93712535-93712557 TAGGGAGCACATCTTACCCAAGG + Intergenic
1059837349 9:118170707-118170729 CAGGGAGAAAATCCTGGGAAGGG - Intergenic
1188987319 X:36779395-36779417 TAGGGAGAGCATCTATCCAATGG - Intergenic