ID: 1080397327

View in Genome Browser
Species Human (GRCh38)
Location 11:31902187-31902209
Sequence ACAAGAACTCTTGCGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080397327_1080397331 13 Left 1080397327 11:31902187-31902209 CCCCAAACCGCAAGAGTTCTTGT 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1080397331 11:31902223-31902245 TCCCCATCCATTAGTAAGAATGG 0: 1
1: 0
2: 0
3: 11
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080397327 Original CRISPR ACAAGAACTCTTGCGGTTTG GGG (reversed) Intronic
905928240 1:41767330-41767352 ACCAGAGCTCTAGCGGTTGGGGG - Intronic
911528866 1:99019749-99019771 ACAAGTACTGTTGGGGTTTAGGG + Intergenic
912508998 1:110175677-110175699 ACTAGAACCCTGGCTGTTTGAGG + Intronic
920788174 1:209062759-209062781 AAAAGGATTCTTGCTGTTTGTGG - Intergenic
1064145912 10:12826303-12826325 ACAGTCACTCTTGCGGATTGAGG + Intronic
1064657115 10:17567310-17567332 ACAAAAACTTTTGAGGTGTGGGG - Intergenic
1069363221 10:67668526-67668548 ATCAGAACTCTTGCGCTTTGGGG + Intronic
1075895930 10:125994433-125994455 ACTCAAACTCTTGCCGTTTGCGG + Intronic
1078590519 11:12637104-12637126 ACATGAACTCTCTCGGTTTGAGG - Intergenic
1080397327 11:31902187-31902209 ACAAGAACTCTTGCGGTTTGGGG - Intronic
1083519615 11:63296204-63296226 GTAAGAACTGTTGCTGTTTGTGG + Intronic
1083943694 11:65912201-65912223 ACAAGGACTCTTGGGAGTTGTGG + Intergenic
1087791015 11:102406499-102406521 ACAAGAACCTTTGCTGTTAGTGG - Intronic
1090561137 11:127934142-127934164 ACAAAAACTCTGGTGGTTTTGGG - Intergenic
1092771679 12:11902787-11902809 CCTAGAAGTCTTGCCGTTTGAGG + Intergenic
1100440707 12:94614593-94614615 AGCAGCACTCTTGCAGTTTGGGG + Intronic
1103111377 12:118281976-118281998 GCTAATACTCTTGCGGTTTGTGG + Intronic
1109246472 13:59959991-59960013 ACAAGAAGTCTGGTGGTTGGTGG - Intronic
1111209404 13:85057502-85057524 ACAAGATATCTGGCGGTTGGGGG - Intergenic
1113297105 13:108970862-108970884 ACAAGAATTCTTGGGGTTGAAGG + Intronic
1116349060 14:43835636-43835658 ACAAGAACTTGTGTGTTTTGGGG - Intergenic
1121966479 14:98311528-98311550 ACAACAACCCTAGCGGTTTAGGG + Intergenic
1125210058 15:37204007-37204029 GCAAGAATGCTTGAGGTTTGGGG + Intergenic
1125919333 15:43516291-43516313 ACTAGTACTCTTGGGGGTTGAGG - Intronic
1141184926 16:81780023-81780045 ACCTGAACTCTTGCGCTGTGCGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1148593938 17:48837662-48837684 AGAAAAACTTTTGAGGTTTGAGG + Intronic
1158342148 18:56478030-56478052 ACAAGAACCCTTAAGGTATGTGG - Intergenic
1158705444 18:59788464-59788486 ACCACAAGTCTTGAGGTTTGGGG + Intergenic
1168423321 19:56219285-56219307 ACAAGAAATGTGTCGGTTTGTGG - Intergenic
928674132 2:33634083-33634105 AGAAGAACTCTTTCTGGTTGGGG - Intergenic
930771938 2:55137910-55137932 ACATGCACTATTGCGGTGTGGGG - Intergenic
934810937 2:97276063-97276085 AGAACAAGTCTTCCGGTTTGTGG - Intergenic
934826755 2:97431876-97431898 AGAACAAGTCTTCCGGTTTGTGG + Intergenic
938238683 2:129726123-129726145 ATAAGAACTCATGAGGGTTGGGG + Intergenic
1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG + Intronic
1177635518 21:23782579-23782601 ACAATAATTTTTGCAGTTTGAGG + Intergenic
956689383 3:71861928-71861950 ACAAGAACACTTGCAGTTTCTGG + Intergenic
976165079 4:82245835-82245857 ACAAGAAGTCTGGCAGTTTCAGG - Intergenic
977423815 4:96839368-96839390 ACAAGAACTATTCTGATTTGGGG - Intergenic
977658802 4:99558714-99558736 ACAAGAACTGTTGCAGGTTTTGG - Intronic
978282720 4:107036596-107036618 ACAACAACTCCAGCGGTTGGAGG + Intronic
984806902 4:183759153-183759175 ACATGGACTCATGCGGTATGTGG - Intergenic
986358328 5:6950573-6950595 CCAGGAACTCTTGCGGTTTCTGG - Intergenic
986908654 5:12526362-12526384 ACAAGAACTCTATCCCTTTGAGG - Intergenic
993829753 5:92740300-92740322 ACAACTACTCTTGTTGTTTGTGG - Intergenic
999685103 5:154095732-154095754 ACCAGAAATGTTGGGGTTTGGGG + Intronic
1001395658 5:171418610-171418632 ACAAGAACACCTACGTTTTGGGG + Intergenic
1008325612 6:50177440-50177462 TCTAGAATTCTTGCAGTTTGAGG + Intergenic
1015790730 6:136961930-136961952 ACAAGAACTCTGGACGTGTGGGG + Intergenic
1016988320 6:149911128-149911150 TAAAGAACTCTTGCGGTGGGCGG - Intergenic
1021407999 7:20296321-20296343 ACCACAACTTTTGCAGTTTGAGG + Intergenic
1021813804 7:24428361-24428383 TCAAGAACCTTTGCTGTTTGGGG + Intergenic
1028955419 7:96684139-96684161 ATAACAACTATTGCAGTTTGAGG - Intronic
1029908957 7:104123623-104123645 GCCACAACTCTTGCAGTTTGAGG + Intergenic
1045738769 8:105328846-105328868 ATAAGTACTCTTGCGTTTTTTGG + Intronic
1047083567 8:121491805-121491827 AAAAGTACTCTTTCGGTGTGAGG + Intergenic
1047825258 8:128566215-128566237 AGAAGAAATCATGCAGTTTGGGG - Intergenic
1048602951 8:135938364-135938386 GCAATAACTTTTGCAGTTTGAGG - Intergenic
1050719483 9:8569450-8569472 AGAAGAACTCTTTCTCTTTGAGG + Intronic
1055197591 9:73615133-73615155 ACAAGAACTGGTGTGGTTGGAGG + Intergenic
1055600536 9:77913057-77913079 ACTAGAACTCTTACAGCTTGTGG + Intronic
1058393470 9:104523267-104523289 AAAAAAACTCTTGAGGTTTTGGG - Intergenic
1060790328 9:126481602-126481624 ACAGGAACTCCTGAGGTTGGGGG + Intronic
1189326633 X:40116054-40116076 AGAAGAGCTCTTGGGATTTGAGG + Intronic
1189419557 X:40844615-40844637 CCAAGACCTCATGGGGTTTGGGG + Intergenic