ID: 1080402375

View in Genome Browser
Species Human (GRCh38)
Location 11:31947807-31947829
Sequence CTATGGATGTGGCTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 3, 1: 3, 2: 8, 3: 16, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080402375_1080402383 5 Left 1080402375 11:31947807-31947829 CCCACAGGAAGCCACATCCATAG 0: 3
1: 3
2: 8
3: 16
4: 186
Right 1080402383 11:31947835-31947857 GAGGGAGAGTACTACATCAAGGG 0: 18
1: 172
2: 283
3: 310
4: 438
1080402375_1080402382 4 Left 1080402375 11:31947807-31947829 CCCACAGGAAGCCACATCCATAG 0: 3
1: 3
2: 8
3: 16
4: 186
Right 1080402382 11:31947834-31947856 AGAGGGAGAGTACTACATCAAGG 0: 18
1: 188
2: 276
3: 319
4: 492
1080402375_1080402384 18 Left 1080402375 11:31947807-31947829 CCCACAGGAAGCCACATCCATAG 0: 3
1: 3
2: 8
3: 16
4: 186
Right 1080402384 11:31947848-31947870 ACATCAAGGGAACACCCCATAGG 0: 98
1: 246
2: 333
3: 388
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080402375 Original CRISPR CTATGGATGTGGCTTCCTGT GGG (reversed) Intronic