ID: 1080402375 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:31947807-31947829 |
Sequence | CTATGGATGTGGCTTCCTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 216 | |||
Summary | {0: 3, 1: 3, 2: 8, 3: 16, 4: 186} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080402375_1080402383 | 5 | Left | 1080402375 | 11:31947807-31947829 | CCCACAGGAAGCCACATCCATAG | 0: 3 1: 3 2: 8 3: 16 4: 186 |
||
Right | 1080402383 | 11:31947835-31947857 | GAGGGAGAGTACTACATCAAGGG | 0: 18 1: 172 2: 283 3: 310 4: 438 |
||||
1080402375_1080402382 | 4 | Left | 1080402375 | 11:31947807-31947829 | CCCACAGGAAGCCACATCCATAG | 0: 3 1: 3 2: 8 3: 16 4: 186 |
||
Right | 1080402382 | 11:31947834-31947856 | AGAGGGAGAGTACTACATCAAGG | 0: 18 1: 188 2: 276 3: 319 4: 492 |
||||
1080402375_1080402384 | 18 | Left | 1080402375 | 11:31947807-31947829 | CCCACAGGAAGCCACATCCATAG | 0: 3 1: 3 2: 8 3: 16 4: 186 |
||
Right | 1080402384 | 11:31947848-31947870 | ACATCAAGGGAACACCCCATAGG | 0: 98 1: 246 2: 333 3: 388 4: 391 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080402375 | Original CRISPR | CTATGGATGTGGCTTCCTGT GGG (reversed) | Intronic | ||