ID: 1080402382 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:31947834-31947856 |
Sequence | AGAGGGAGAGTACTACATCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1293 | |||
Summary | {0: 18, 1: 188, 2: 276, 3: 319, 4: 492} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080402380_1080402382 | -7 | Left | 1080402380 | 11:31947818-31947840 | CCACATCCATAGGAAAAGAGGGA | 0: 13 1: 148 2: 269 3: 295 4: 478 |
||
Right | 1080402382 | 11:31947834-31947856 | AGAGGGAGAGTACTACATCAAGG | 0: 18 1: 188 2: 276 3: 319 4: 492 |
||||
1080402376_1080402382 | 3 | Left | 1080402376 | 11:31947808-31947830 | CCACAGGAAGCCACATCCATAGG | 0: 7 1: 5 2: 10 3: 19 4: 179 |
||
Right | 1080402382 | 11:31947834-31947856 | AGAGGGAGAGTACTACATCAAGG | 0: 18 1: 188 2: 276 3: 319 4: 492 |
||||
1080402375_1080402382 | 4 | Left | 1080402375 | 11:31947807-31947829 | CCCACAGGAAGCCACATCCATAG | 0: 3 1: 3 2: 8 3: 16 4: 186 |
||
Right | 1080402382 | 11:31947834-31947856 | AGAGGGAGAGTACTACATCAAGG | 0: 18 1: 188 2: 276 3: 319 4: 492 |
||||
1080402374_1080402382 | 18 | Left | 1080402374 | 11:31947793-31947815 | CCACTGCAGTTTGGCCCACAGGA | 0: 1 1: 1 2: 3 3: 26 4: 225 |
||
Right | 1080402382 | 11:31947834-31947856 | AGAGGGAGAGTACTACATCAAGG | 0: 18 1: 188 2: 276 3: 319 4: 492 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080402382 | Original CRISPR | AGAGGGAGAGTACTACATCA AGG | Intronic | ||