ID: 1080402383

View in Genome Browser
Species Human (GRCh38)
Location 11:31947835-31947857
Sequence GAGGGAGAGTACTACATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1221
Summary {0: 18, 1: 172, 2: 283, 3: 310, 4: 438}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080402380_1080402383 -6 Left 1080402380 11:31947818-31947840 CCACATCCATAGGAAAAGAGGGA 0: 13
1: 148
2: 269
3: 295
4: 478
Right 1080402383 11:31947835-31947857 GAGGGAGAGTACTACATCAAGGG 0: 18
1: 172
2: 283
3: 310
4: 438
1080402374_1080402383 19 Left 1080402374 11:31947793-31947815 CCACTGCAGTTTGGCCCACAGGA 0: 1
1: 1
2: 3
3: 26
4: 225
Right 1080402383 11:31947835-31947857 GAGGGAGAGTACTACATCAAGGG 0: 18
1: 172
2: 283
3: 310
4: 438
1080402375_1080402383 5 Left 1080402375 11:31947807-31947829 CCCACAGGAAGCCACATCCATAG 0: 3
1: 3
2: 8
3: 16
4: 186
Right 1080402383 11:31947835-31947857 GAGGGAGAGTACTACATCAAGGG 0: 18
1: 172
2: 283
3: 310
4: 438
1080402376_1080402383 4 Left 1080402376 11:31947808-31947830 CCACAGGAAGCCACATCCATAGG 0: 7
1: 5
2: 10
3: 19
4: 179
Right 1080402383 11:31947835-31947857 GAGGGAGAGTACTACATCAAGGG 0: 18
1: 172
2: 283
3: 310
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080402383 Original CRISPR GAGGGAGAGTACTACATCAA GGG Intronic