ID: 1080402384

View in Genome Browser
Species Human (GRCh38)
Location 11:31947848-31947870
Sequence ACATCAAGGGAACACCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1456
Summary {0: 98, 1: 246, 2: 333, 3: 388, 4: 391}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080402375_1080402384 18 Left 1080402375 11:31947807-31947829 CCCACAGGAAGCCACATCCATAG 0: 3
1: 3
2: 8
3: 16
4: 186
Right 1080402384 11:31947848-31947870 ACATCAAGGGAACACCCCATAGG 0: 98
1: 246
2: 333
3: 388
4: 391
1080402381_1080402384 1 Left 1080402381 11:31947824-31947846 CCATAGGAAAAGAGGGAGAGTAC 0: 19
1: 169
2: 242
3: 222
4: 337
Right 1080402384 11:31947848-31947870 ACATCAAGGGAACACCCCATAGG 0: 98
1: 246
2: 333
3: 388
4: 391
1080402376_1080402384 17 Left 1080402376 11:31947808-31947830 CCACAGGAAGCCACATCCATAGG 0: 7
1: 5
2: 10
3: 19
4: 179
Right 1080402384 11:31947848-31947870 ACATCAAGGGAACACCCCATAGG 0: 98
1: 246
2: 333
3: 388
4: 391
1080402380_1080402384 7 Left 1080402380 11:31947818-31947840 CCACATCCATAGGAAAAGAGGGA 0: 13
1: 148
2: 269
3: 295
4: 478
Right 1080402384 11:31947848-31947870 ACATCAAGGGAACACCCCATAGG 0: 98
1: 246
2: 333
3: 388
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080402384 Original CRISPR ACATCAAGGGAACACCCCAT AGG Intronic