ID: 1080403862

View in Genome Browser
Species Human (GRCh38)
Location 11:31961224-31961246
Sequence CTAAAATCAAGGTGTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5617
Summary {0: 2, 1: 32, 2: 357, 3: 1594, 4: 3632}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080403857_1080403862 -3 Left 1080403857 11:31961204-31961226 CCTAAATGGATGCCAGTGGGCTA 0: 1
1: 1
2: 3
3: 27
4: 198
Right 1080403862 11:31961224-31961246 CTAAAATCAAGGTGTCGGCCGGG 0: 2
1: 32
2: 357
3: 1594
4: 3632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080403862 Original CRISPR CTAAAATCAAGGTGTCGGCC GGG Intronic
Too many off-targets to display for this crispr