ID: 1080405293

View in Genome Browser
Species Human (GRCh38)
Location 11:31973317-31973339
Sequence CAATTTGCCTAGAGGGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080405293_1080405298 8 Left 1080405293 11:31973317-31973339 CCCTCGGCCCTCTAGGCAAATTG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1080405298 11:31973348-31973370 ATGGAATCTCCCTCGTGCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1080405293_1080405300 10 Left 1080405293 11:31973317-31973339 CCCTCGGCCCTCTAGGCAAATTG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1080405300 11:31973350-31973372 GGAATCTCCCTCGTGCTAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1080405293_1080405299 9 Left 1080405293 11:31973317-31973339 CCCTCGGCCCTCTAGGCAAATTG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1080405299 11:31973349-31973371 TGGAATCTCCCTCGTGCTAAGGG 0: 1
1: 0
2: 1
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080405293 Original CRISPR CAATTTGCCTAGAGGGCCGA GGG (reversed) Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
920525042 1:206660067-206660089 TAAATTGCCTAGAGGGCCCTGGG - Intronic
1065106131 10:22388060-22388082 CAATTTGTTTATAGGGCCTAGGG + Intronic
1080405293 11:31973317-31973339 CAATTTGCCTAGAGGGCCGAGGG - Intronic
1088775281 11:113076397-113076419 CCATTGGCCTAGAGGGGCCATGG - Intronic
1089768180 11:120783686-120783708 CAAAATGCATAGAGGGACGAGGG - Intronic
1090108485 11:123877653-123877675 CAATTCCCCTAGAGTCCCGAGGG - Intergenic
1095069454 12:37823003-37823025 CAATTTGCCTTGAGGCCTGTGGG + Intergenic
1103643597 12:122372797-122372819 CCATTTGCCTAGATTGCTGATGG - Intronic
1109887273 13:68558428-68558450 CTATTTGCCTAGCGGGCCCTTGG + Intergenic
1112990846 13:105512479-105512501 CAATTCTCCTAGATGGCCGGGGG - Intergenic
1141437947 16:84011477-84011499 CAATGGGGCTAGAGGGCCGGGGG + Intronic
1146339429 17:32007049-32007071 CAGTTTCCCTAGAGGGCGGGAGG + Intergenic
1148178251 17:45585507-45585529 CAGTTTCCCTAGAGGGCGGGAGG - Intergenic
1150996183 17:70320283-70320305 CAATTTGGCTAGTGGGCAGTTGG - Intergenic
1153527795 18:6014359-6014381 CAATTTGCCTACAGGATGGATGG - Intronic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1167626265 19:50591755-50591777 CCATTTGCATAGCGTGCCGAGGG + Intergenic
927940323 2:27099461-27099483 CAATTTGCCATCAGGGCCCAGGG - Exonic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
940992348 2:160110685-160110707 CAATTTGCTTAGAGGACCCTGGG + Intronic
946135868 2:217646464-217646486 CCATCTGCCTAGAGGGGCCAGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1179415922 21:41198797-41198819 CAAGTTGCCTAGAAGGGTGATGG - Intronic
1179984097 21:44911744-44911766 CATTTTGCCTCTGGGGCCGAGGG - Intronic
1182249033 22:28984874-28984896 GAATTTGCCTGAAGGGCCAATGG - Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
949332167 3:2934544-2934566 GTATTTGCCCAGAAGGCCGATGG + Intronic
956357115 3:68406047-68406069 CATTTTGCTTACAGGGACGAGGG + Intronic
957129303 3:76202894-76202916 CACTCTGCCTAGAGAGCCCAAGG - Intronic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
966107890 3:176359581-176359603 CAATTTGCCTAGGGGGCTTCGGG + Intergenic
985698073 5:1353104-1353126 CAATTTGACTGGAGCGTCGAAGG - Intergenic
991561188 5:67955456-67955478 CAATTTGAGTACAGGCCCGAAGG - Intergenic
1001878264 5:175219406-175219428 CAATTTGCCAAGTGGGACAAAGG + Intergenic
1029984966 7:104914590-104914612 CAATTTGCGGAGAGGGCAGAGGG + Intergenic
1030884317 7:114919993-114920015 CAATTTACTTATAGGGCCGATGG + Intergenic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1038259322 8:25979361-25979383 CAATGTGACTCGAGGGCCGGGGG - Intronic
1050991301 9:12155853-12155875 CAGAATGCCTAGAGGGCCAATGG - Intergenic
1052568162 9:30185572-30185594 CAAGTTTCCCAGAGGGCCCATGG - Intergenic
1053464156 9:38292696-38292718 CAATCTGCCTAGAGGGCTCTGGG + Intergenic
1056485687 9:87054945-87054967 CAATTTGCCTAGGGGGACACAGG + Intergenic
1060978358 9:127778617-127778639 CAATTTGCCAAGATGACAGAGGG - Exonic
1062516751 9:136940696-136940718 CAAGTTGCCCAGGAGGCCGAGGG + Exonic
1186688063 X:11946340-11946362 CAATGTGTCTAGAGGACGGAGGG - Intergenic
1188808430 X:34620854-34620876 CAATTTGTCTTAAGGGCCTAAGG + Intergenic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1198844239 X:140892915-140892937 CAATTTGCCTCAAAGGCCAAAGG - Intergenic
1199829225 X:151532337-151532359 CAGTATGCCAAGAGGGCTGAGGG + Intergenic