ID: 1080406279

View in Genome Browser
Species Human (GRCh38)
Location 11:31982344-31982366
Sequence CCATCACCACAAAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080406279_1080406284 22 Left 1080406279 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG 0: 1
1: 0
2: 4
3: 33
4: 398
Right 1080406284 11:31982389-31982411 GAATCATGGAAAGATTATTGAGG 0: 1
1: 0
2: 1
3: 16
4: 207
1080406279_1080406285 27 Left 1080406279 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG 0: 1
1: 0
2: 4
3: 33
4: 398
Right 1080406285 11:31982394-31982416 ATGGAAAGATTATTGAGGCCTGG 0: 1
1: 0
2: 2
3: 41
4: 487
1080406279_1080406282 0 Left 1080406279 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG 0: 1
1: 0
2: 4
3: 33
4: 398
Right 1080406282 11:31982367-31982389 CAAAGGTGCAAAAAAGCAAATGG 0: 1
1: 1
2: 4
3: 43
4: 559
1080406279_1080406283 8 Left 1080406279 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG 0: 1
1: 0
2: 4
3: 33
4: 398
Right 1080406283 11:31982375-31982397 CAAAAAAGCAAATGGAATCATGG 0: 1
1: 0
2: 2
3: 62
4: 729
1080406279_1080406286 28 Left 1080406279 11:31982344-31982366 CCATGTTCTTTTTGTGGTGATGG 0: 1
1: 0
2: 4
3: 33
4: 398
Right 1080406286 11:31982395-31982417 TGGAAAGATTATTGAGGCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080406279 Original CRISPR CCATCACCACAAAAAGAACA TGG (reversed) Intronic
900946010 1:5831846-5831868 CCAACACAACACAGAGAACACGG + Intergenic
902164590 1:14560044-14560066 CATTCACCACAAAAAGAGAAGGG - Intergenic
903210190 1:21813874-21813896 CCGTCACCAAAAAAAAAAAAGGG - Intronic
904215002 1:28912618-28912640 CCATCTCAAAAAAAAGAAAAAGG - Intronic
904739108 1:32658549-32658571 CCATCTCCAAAAAAAAAAAAAGG - Intronic
905074485 1:35257730-35257752 CCCTCACCAAAAAAAGAAAAAGG + Intergenic
907174652 1:52507813-52507835 CTATCACAAAAAAAAGAAAAAGG - Intronic
910997639 1:93125622-93125644 CCATAAACACAAACAGTACATGG + Intronic
911128137 1:94360718-94360740 TCATCATCACAAGAACAACATGG + Intergenic
911538388 1:99128172-99128194 ACATCTCAACTAAAAGAACAAGG - Intergenic
911675295 1:100651911-100651933 CTATCACCACAGAAAGAAAGAGG - Intergenic
911875154 1:103152442-103152464 TCATCAATGCAAAAAGAACAAGG + Intergenic
912579297 1:110705712-110705734 CCATTACCACAAAAACATTATGG + Intergenic
914913866 1:151806357-151806379 CCTTCTCCACAACAAGAGCAGGG + Intronic
915050470 1:153066016-153066038 ACATCACAACTAAAAGAACGAGG + Intergenic
915919745 1:159965946-159965968 ATATCACCACAAAAATATCAAGG - Intergenic
916376960 1:164165813-164165835 CCACCACAACAAAGGGAACATGG + Intergenic
916981067 1:170137646-170137668 CCATAATCACCAAAACAACATGG + Intergenic
917532059 1:175844293-175844315 CCATCTCTAAAAAAAGATCATGG - Intergenic
918322508 1:183377707-183377729 CAATAACAACAAAAAGTACAAGG + Intronic
918531022 1:185523255-185523277 CCACTACCACAAGAAGAGCATGG + Intergenic
918927994 1:190812480-190812502 GCATCACAACTAAAAGAACTAGG + Intergenic
918933050 1:190882339-190882361 CCATCTCAACAAAAAAAAAAGGG - Intergenic
918995735 1:191757025-191757047 CCATCTCCAGGAAAAGAACAAGG + Intergenic
919231643 1:194781401-194781423 ACATCACAACTAAAAGAACTAGG + Intergenic
922292980 1:224224346-224224368 CCATATCATCAAAAAGAACAAGG - Intergenic
923188015 1:231592751-231592773 CTCTCACCACAAAGTGAACAAGG + Intronic
923261969 1:232276193-232276215 CCATAACAACGAAAAGTACAGGG - Intergenic
924887608 1:248236484-248236506 ACATCACAACTAAAAGAACTAGG + Intergenic
1063916165 10:10884820-10884842 CACTCAACACAAAAAGACCAAGG - Intergenic
1064254660 10:13733437-13733459 CCATCTCCAAAAAAAAAACCAGG - Intronic
1064880316 10:20044706-20044728 ACATCTCCACAATCAGAACAAGG + Intronic
1065516478 10:26528933-26528955 CCCTCCCCAAAGAAAGAACAGGG + Intronic
1067164564 10:43855143-43855165 ACATCACCACCAAGGGAACATGG + Intergenic
1067362732 10:45597078-45597100 CCATCTCCAAAAAAAAAAAAGGG + Intergenic
1067589529 10:47497313-47497335 CCATCACAAAAAAAAAAAAAAGG + Intergenic
1068170019 10:53381244-53381266 GCATTAACACAAAAAGAAAAAGG + Intergenic
1068253564 10:54476749-54476771 AGATGACCACAAAAAGAACCTGG - Intronic
1068366694 10:56059934-56059956 ACATCATAACAAAAAGAACACGG - Intergenic
1068454752 10:57239439-57239461 TCATTATCACAAAAACAACATGG - Intergenic
1068704900 10:60064360-60064382 CAATTGCCACAAAAAGAAAAGGG + Intronic
1069281303 10:66657932-66657954 CAATCAGCAAAAAAAGTACAAGG - Intronic
1069340842 10:67406495-67406517 ACATCACAACTAAAAGAACTAGG + Intronic
1069545012 10:69321429-69321451 CCAGCCCCACAGGAAGAACAGGG - Intronic
1071488732 10:86121650-86121672 CCATGACCACAATAATACCAGGG + Intronic
1071674713 10:87644615-87644637 TCACCACCACAAGAACAACATGG - Intergenic
1073929125 10:108554422-108554444 TCATTACCACAAGAAGAGCATGG - Intergenic
1073969985 10:109036967-109036989 CCAACACCCCAAAAGGAAAATGG + Intergenic
1073998969 10:109348331-109348353 CCTCCACCACAATAATAACATGG + Intergenic
1075486477 10:122826187-122826209 CCATCCCCGCCAGAAGAACATGG + Intergenic
1075788300 10:125065295-125065317 AAATCATCACAAAGAGAACAAGG - Intronic
1076332876 10:129683951-129683973 CCATCATCACAAAAGGACCCTGG + Intronic
1076493070 10:130876931-130876953 CCATTACCACAAGAACAGCATGG + Intergenic
1077648570 11:3948930-3948952 CAATTACAACAAAAATAACATGG + Intronic
1077760018 11:5084737-5084759 CCATCACCACTCCAAGACCATGG - Intergenic
1080233390 11:30042945-30042967 CCATCACCACCAAAAGCTCTTGG + Intergenic
1080348644 11:31356155-31356177 ACAACAACAAAAAAAGAACAAGG + Intronic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1083536683 11:63474893-63474915 CCATGGTCAAAAAAAGAACAAGG - Intronic
1084540755 11:69785287-69785309 CCATCAACAGAAATAGAAAATGG - Intergenic
1084765337 11:71304712-71304734 CTATCTCCACAAAAACAACCAGG + Intergenic
1084865482 11:72052764-72052786 CCATCTCAAAAAAAAAAACAAGG + Intronic
1085578691 11:77630861-77630883 TCTTCACCCCAAAAAGAACCTGG - Intronic
1086464677 11:87040656-87040678 CCATCACAAAAAAAAAAAAAAGG + Intronic
1087602415 11:100333546-100333568 CCATCATCACCAAAACAGCATGG + Intronic
1087893726 11:103564445-103564467 CCATCTCCAAAAAAAAAAAAGGG - Intergenic
1088780285 11:113127672-113127694 CAATCTCCACTAAAAGAAAAAGG + Intronic
1089429293 11:118408155-118408177 CCATCTCAAAAAAAAGAAAAAGG + Intronic
1090603630 11:128398317-128398339 CCACCACCAACAAAAAAACAGGG - Intergenic
1090656945 11:128853534-128853556 TCATCACCCCCAAAAGAACCTGG - Intronic
1090886101 11:130878199-130878221 CCAACATCACAAAAGGAACAGGG + Exonic
1091024816 11:132132661-132132683 CCCTCATTACAATAAGAACAGGG + Intronic
1091091678 11:132776945-132776967 CCATCATCACCAAAGGAACTTGG + Intronic
1091168522 11:133501151-133501173 GGATCACCGCAAACAGAACATGG + Intronic
1091882197 12:3989057-3989079 TCATCTCCACAAAAGGGACAAGG - Intergenic
1092822742 12:12368447-12368469 CCATCTCAAAAAAAAGAAGAAGG - Intronic
1092838224 12:12512315-12512337 TCACCACAACAAAAAGAGCATGG - Intronic
1093239839 12:16656698-16656720 ACATCACAACTAAAAGAACTAGG - Intergenic
1093388338 12:18586121-18586143 ACATCACAACTAAAAGAACTAGG + Intronic
1093391918 12:18634203-18634225 ACATCACAGCAAAAAGAGCATGG - Intronic
1094002854 12:25715013-25715035 TCATGACCACCAAAAGAAAAGGG - Intergenic
1095100062 12:38171626-38171648 CCATAATCACAAAAACAGCATGG + Intergenic
1095207289 12:39453251-39453273 CCACCACCACAACAACAAAAAGG + Intergenic
1095755477 12:45761596-45761618 ACATCACCTAAAAAAGAGCAGGG - Intronic
1096079802 12:48825831-48825853 CCATCTCAAAAAAAAGAAAAGGG - Intronic
1096127920 12:49133491-49133513 CCATCTCCAAAAAAAAAAAAGGG + Intergenic
1096137494 12:49214741-49214763 CCAACACTAAAAGAAGAACAAGG - Intronic
1097735977 12:63180984-63181006 TCATCCCCACATAAAGAGCATGG + Intergenic
1098648588 12:72937646-72937668 TCATCATCACAAGAAGAGCATGG + Intergenic
1099693008 12:85984438-85984460 CCATCACCAAATAAATAAAAGGG - Intronic
1099739898 12:86620784-86620806 TCATTACCACAAGAAGAATAAGG - Intronic
1100096116 12:91039510-91039532 CCACCACCACCACAAAAACAGGG + Intergenic
1101499787 12:105292360-105292382 TTCTCACCACAAAAATAACAAGG + Intronic
1102370010 12:112374996-112375018 CCATCACCACAATCAAAATAGGG + Intronic
1104069863 12:125335313-125335335 TCATTTCAACAAAAAGAACAAGG - Intronic
1104191229 12:126483477-126483499 CCATCACTAGGGAAAGAACAAGG - Intergenic
1104859668 12:131917577-131917599 CCACCACCCCAAAAGGGACAGGG - Intronic
1105008250 12:132736585-132736607 CCATCAACACAGCAAGAACAGGG + Intronic
1105051138 12:133052213-133052235 CCCTCCCCAGAAAAAGATCATGG - Intronic
1105272564 13:18892029-18892051 CCAACACCACAAAAGGGACATGG + Intergenic
1105351954 13:19623868-19623890 CCCACACCCCAAAATGAACATGG - Intergenic
1105849897 13:24323913-24323935 TCATCATCACAAGAACAACATGG + Intergenic
1106972733 13:35162698-35162720 CAATCATCAGAAAAAGAAAATGG + Intronic
1107018248 13:35726091-35726113 CCATGACCAGGAGAAGAACAGGG + Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1108319003 13:49268658-49268680 CTATCTCCAAAAAAAGAAAAAGG + Intronic
1109109829 13:58302648-58302670 CCATCATCATAAAAAGAACATGG - Intergenic
1109313078 13:60718159-60718181 CCATCACCACATAAACAGAAAGG + Intergenic
1109363524 13:61326651-61326673 ACATCACAATTAAAAGAACAAGG + Intergenic
1109483853 13:62993041-62993063 CCAACATCACAAAAAGCCCAGGG - Intergenic
1110149911 13:72238919-72238941 TCATCATCACAAGAATAACATGG + Intergenic
1110228010 13:73140163-73140185 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1111185009 13:84722265-84722287 CCATCTTCAAAAAAAGATCATGG + Intergenic
1111326647 13:86705967-86705989 CCATAATCACTAAAACAACATGG + Intergenic
1111702412 13:91707450-91707472 CCATCTCTACAAAAAAAATAAGG + Intronic
1112352413 13:98647178-98647200 CCATTACAAAAAAAATAACAAGG + Intergenic
1112388797 13:98964095-98964117 ACATCAAGATAAAAAGAACACGG + Intronic
1112753958 13:102609733-102609755 TCATCATCACAAGAACAACAAGG + Intronic
1112945704 13:104924425-104924447 CCATCATCACCAAAACAGCATGG + Intergenic
1114952766 14:27777711-27777733 CCAACATGACAAAAAGAAAAAGG - Intergenic
1115117687 14:29902253-29902275 CCATCTCCAAAAAAAAAAAAAGG + Intronic
1116858497 14:49974722-49974744 CCATCTCGAAAAAAAGAAAAAGG - Intergenic
1117640450 14:57792821-57792843 CCATCACCAAGCAATGAACACGG - Intronic
1117686666 14:58260617-58260639 GCATAAACACAAAAAGATCAAGG - Intronic
1118682846 14:68261300-68261322 CAATCACCACAAAAGGAAAAGGG - Intronic
1118896862 14:69952554-69952576 GCATCTCCATAAAAAGAAAAAGG - Intronic
1118964516 14:70567455-70567477 CCAACACCAGGAAATGAACATGG + Intergenic
1119306921 14:73615082-73615104 CCATCTCAAAAAAAAAAACAAGG + Intronic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1121079388 14:91095480-91095502 CCCTTACCAAAGAAAGAACATGG - Intronic
1121828794 14:97032658-97032680 TCATCACCCCAAAAAGAAGCTGG - Intergenic
1125076369 15:35623551-35623573 CCATCAACACTAAATAAACAGGG + Intergenic
1125878397 15:43169595-43169617 CAATCAGCACAAAAAGGACCCGG - Exonic
1126520075 15:49583050-49583072 ACATCACAACTAAAAGAACCAGG + Intronic
1126544063 15:49853426-49853448 GTATCACCACAAAATGAAGAAGG - Intergenic
1127039457 15:54958179-54958201 CCATCACCACAAAGACCACAGGG + Intergenic
1127085969 15:55424864-55424886 CCATCTCCAAAAAAAAAGCAAGG - Intronic
1127108969 15:55647107-55647129 CCATCTCCACTCAAAGAAAAAGG + Intronic
1127703981 15:61529122-61529144 ACATCCCCACAAAAATCACAGGG - Intergenic
1127891025 15:63251047-63251069 TCATCCCCACAAAAAGATTAGGG + Intronic
1130722466 15:86402697-86402719 CCATCACCACAAAAGGAAACGGG - Intronic
1131772792 15:95758649-95758671 CCATGTCCAGAAATAGAACATGG - Intergenic
1131928083 15:97408162-97408184 CCATCACCACAATCAAATCATGG - Intergenic
1131977034 15:97957354-97957376 CACTCACCACAAAAAGCAGAAGG + Intergenic
1133834807 16:9358464-9358486 CCATAACCACAAAGAAATCATGG - Intergenic
1134145337 16:11756155-11756177 CCATCTCAAAAAAAAGAAAAGGG + Intronic
1135400593 16:22163848-22163870 CCACCACCAGCAAAAAAACATGG + Intergenic
1135422081 16:22312124-22312146 TCATCACCACAAAAAGAACCAGG - Intronic
1136528443 16:30848885-30848907 CCATCACAAAAAAAAAAAAAAGG + Intronic
1136968223 16:34941015-34941037 CCATCACCAAAAAATAAAAAAGG - Intergenic
1137384687 16:48030519-48030541 CCAACGCCATAAACAGAACAAGG + Intergenic
1137581849 16:49638407-49638429 GCAGGCCCACAAAAAGAACAAGG - Exonic
1137672317 16:50286220-50286242 CCATCTCTACAAAAAATACATGG + Intronic
1138322457 16:56127999-56128021 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1138938110 16:61755810-61755832 CCACCACCAAAAAAAGAAGAAGG - Intronic
1139397764 16:66654162-66654184 TCATCACCCCAGGAAGAACATGG + Intronic
1139581074 16:67873844-67873866 CCTTCATCCCAGAAAGAACACGG - Intronic
1139971489 16:70778566-70778588 CCATAACCCCAAAAAGAAACCGG + Intronic
1140291834 16:73666424-73666446 CCATCTCCACAAAAATACTAAGG + Intergenic
1140317789 16:73915786-73915808 TCAACCCCACAAAAAGAAGAGGG + Intergenic
1140630109 16:76841797-76841819 CAATAGCCACAAAAAGAATAAGG - Intergenic
1141569225 16:84924270-84924292 CCATCTCTGCAAAAATAACAGGG + Intergenic
1143696439 17:8623580-8623602 CCCTCACCACAAATTAAACAGGG + Intronic
1145072230 17:19820496-19820518 CCATCATTGCAGAAAGAACAAGG - Intronic
1145754071 17:27377490-27377512 ACATCATCACAAGAAGAAAAAGG + Intergenic
1146965762 17:37028444-37028466 ACATCACCAACAAAAAAACAAGG + Intronic
1147324193 17:39662601-39662623 CCAGCAACACAAACAGACCAGGG - Intronic
1203166172 17_GL000205v2_random:97812-97834 CCATCACAACAAAAACTACATGG - Intergenic
1153516425 18:5906829-5906851 CCCTCACCAAAAAAAAAAAATGG - Intergenic
1153847068 18:9059752-9059774 CCATTGACACAAAAAGCACACGG - Intergenic
1154464347 18:14629612-14629634 CCAACACCACAAAAGGGACATGG + Intergenic
1154985764 18:21549417-21549439 CCGTCTCCAAAAAAAAAACAAGG - Intronic
1155165735 18:23230966-23230988 CCATCAGCACCCCAAGAACAGGG - Intronic
1156629221 18:38946531-38946553 CCATCATCATAAAAAGTACACGG + Intergenic
1157574229 18:48732999-48733021 CCATCATCAGAAAAAGAAGGAGG + Intronic
1158039889 18:53080308-53080330 CCATCTCCACAGAAAGAGCCTGG + Intronic
1158108664 18:53915028-53915050 CTATCACAACAAAAACAACATGG - Intergenic
1158676656 18:59526269-59526291 ACATCACAACTAAAAGAACTAGG - Intronic
1159328781 18:66960413-66960435 CCATTACCAGAAAACGACCAAGG - Intergenic
1163259663 19:16180921-16180943 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1163447731 19:17357287-17357309 CCATCTCAAAAAAAAGAAAAAGG + Intronic
1163970158 19:20785689-20785711 CCAGCCCCAGAAAAAGAAAATGG - Intronic
1164980688 19:32611583-32611605 CCATCTCAAAAAAAAGAAAATGG - Intronic
1165389526 19:35530315-35530337 CCAAAAACACAAAAAGAAGATGG - Intergenic
1165589459 19:36954882-36954904 CCCTCTCCAAAAAAAGAAAAAGG - Intronic
1166553043 19:43679465-43679487 CCATCTCAAAAAAAAGAAGAAGG + Intergenic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
1166870453 19:45867280-45867302 CCCTCCCCAGAAAAAGAAAAGGG - Intronic
1167224400 19:48227796-48227818 CCATCACAAAAAAAAAAAAAAGG + Intronic
1168578874 19:57536689-57536711 CCATAACCAGCAAGAGAACAAGG - Intronic
925818330 2:7775121-7775143 CCACTGCCACAAAAAGTACAAGG + Intergenic
926431740 2:12794018-12794040 CCATCACAAAAAAAAAAAAAAGG - Intergenic
926527212 2:13995539-13995561 CCATAACAACAAAAACAGCATGG + Intergenic
927586837 2:24315692-24315714 TCATTATCACAAAAACAACAAGG - Intronic
928402576 2:30989961-30989983 CCATCACCAGCAACAGGACAAGG - Intronic
928633741 2:33220938-33220960 CTGTCACCACTAAAGGAACAGGG - Intronic
929254326 2:39792872-39792894 CCATTACCAAAAACAGACCACGG + Intergenic
929704335 2:44194716-44194738 CCATCTCAAAAAAAAGAAGAAGG + Intronic
931009760 2:57896799-57896821 CCACCACCAAAAAAATAAAAAGG + Intergenic
933396477 2:81738357-81738379 CCATAGACACAAAAAGAAAAAGG + Intergenic
933600960 2:84329661-84329683 CAAACACCATAAATAGAACAGGG + Intergenic
933605337 2:84376538-84376560 GCCTCAACTCAAAAAGAACATGG + Intergenic
933947725 2:87301286-87301308 CCATCACCACCAAAGAATCAGGG + Intergenic
934699642 2:96429283-96429305 CCATCAACACAACAAAACCAAGG + Intergenic
934987388 2:98897666-98897688 CCATTCCCACAAAAATAAGAGGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935855786 2:107271422-107271444 CCACCAACACAAAGAGAAAAGGG - Intergenic
936332478 2:111560303-111560325 CCATCACCACCAAAGAAGCAGGG - Intergenic
936614235 2:114032600-114032622 CCAACACCAGAATCAGAACATGG - Intergenic
937747704 2:125434540-125434562 CCATCTCTACAAAAAGTAAATGG + Intergenic
938762947 2:134441883-134441905 CCAGCACCTCAACAAGGACAAGG + Exonic
938927222 2:136055076-136055098 CCACCACCACAAAAATCACTGGG - Intergenic
940016138 2:149107165-149107187 ACATCATCACAAGAAGAAAAAGG - Intronic
940246282 2:151620546-151620568 CCATCACTTGAAAATGAACATGG - Intronic
941688611 2:168474181-168474203 CCATCACATTAAAAAGAAAATGG - Intronic
943868890 2:192966410-192966432 CCTTCACCATAGAAAGAAAAAGG - Intergenic
944177667 2:196850866-196850888 GCAGCAGCAAAAAAAGAACAGGG + Intronic
944466183 2:200002154-200002176 TCCTCACCACAAAAAGAAGCTGG + Intronic
944693252 2:202177555-202177577 CCATCTCTAAAAAAAGAAAAAGG - Intronic
945065174 2:205942077-205942099 CCACCACCATGAGAAGAACAAGG - Intergenic
945066495 2:205951958-205951980 CAATCAGAAAAAAAAGAACAGGG + Intergenic
945549034 2:211196494-211196516 CCACCACCCCAAAAAGAAGAAGG + Intergenic
945579993 2:211581362-211581384 AAATCACCACTGAAAGAACATGG + Intronic
946015310 2:216599487-216599509 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
946375154 2:219303358-219303380 CCCTAACCACAAAAAGATGATGG + Intronic
946505927 2:220300779-220300801 CCATCCACCCAAAAAGAAAAGGG + Intergenic
946673127 2:222127938-222127960 CCATTCCCACTAAAGGAACACGG + Intergenic
947629916 2:231645416-231645438 CTGTCACCACAAAAAAAAAACGG - Intergenic
1171441854 20:25170470-25170492 CCATCTCCAAAAAAACAAAAAGG + Intergenic
1172710154 20:36915730-36915752 CCATCTCCAAAAAAAAAAAAAGG + Intronic
1172891019 20:38264254-38264276 CCACCACCACAACAACAAAAAGG + Intronic
1174089311 20:48034431-48034453 CAAGCACCACAAAAATACCAGGG + Intergenic
1174813442 20:53666755-53666777 CCATCTCCAAAAAAAAAAAAGGG - Intergenic
1175140370 20:56856413-56856435 CCAGCACAACAACAAAAACATGG + Intergenic
1175755748 20:61528596-61528618 CCATCTCCACAAAAAAGAAAAGG + Intronic
1176162881 20:63657511-63657533 CCTTCACCACAACAGGCACATGG + Intergenic
1176405583 21:6361284-6361306 CCATCGCAACAAAAACTACATGG + Intergenic
1176810191 21:13528777-13528799 CCAACACCACAAAAGGGACATGG - Intergenic
1176881416 21:14199170-14199192 ACATCACAACTAAAAGAACTAGG + Intronic
1179452734 21:41476615-41476637 GCATCACTGCAAAAAGAACAGGG + Exonic
1179518030 21:41922998-41923020 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1179968664 21:44821233-44821255 CCCCCACCTCAAAAAGAAAAGGG + Intergenic
1180971613 22:19819031-19819053 CCATCACCTCCACAAGACCACGG + Intronic
1180980114 22:19874412-19874434 CCATCACCACAAAAGCACCAAGG + Intergenic
1181687116 22:24537030-24537052 CCACCACCACCAAAAAAAGAAGG - Intergenic
1182734298 22:32520305-32520327 CCATCTCTACAAAAAAAAAAAGG - Intronic
1184317799 22:43710788-43710810 CACTCCCCACAAAATGAACATGG + Intronic
949385411 3:3496860-3496882 CCGTCACCACTAAAAGAATGGGG - Intergenic
950285566 3:11742179-11742201 CCATCACCACAAAAATCCCTTGG + Intergenic
953231897 3:41072743-41072765 CCATCATCCCAAAGAGAAGATGG + Intergenic
954050949 3:47976797-47976819 CATTCACAACAAAAAGAACTTGG + Intronic
954143606 3:48622954-48622976 CCATCTCAAAAAAAAGAAAAAGG + Intergenic
954344838 3:49988113-49988135 CCAACACAACCAAGAGAACAAGG - Intronic
954821441 3:53332507-53332529 CAACAACCATAAAAAGAACAAGG - Intronic
955283064 3:57612983-57613005 CCGTCACCAAAAAAAGAAAAAGG - Intergenic
955324190 3:57997083-57997105 CCATCTCTACAAAAAGTACAGGG - Intergenic
956375948 3:68613619-68613641 CCAACACCACAAGAAGCACTAGG - Intergenic
960434434 3:117608081-117608103 CCAACACAATAAAAAGAAAATGG + Intergenic
960483880 3:118227189-118227211 CCATAACAACAAAAATAACAGGG + Intergenic
962186386 3:133264720-133264742 CACTTACCATAAAAAGAACAGGG + Intronic
962216874 3:133530180-133530202 CCATCACCATGAGAAGAATATGG - Intergenic
963363683 3:144307748-144307770 CCCTCTCCCCAAAAAGAAAATGG - Intergenic
963592286 3:147276526-147276548 ACATCACCATTAAAAGAACTAGG + Intergenic
963783600 3:149511051-149511073 CCATCTCTACAAAAAGAAGGAGG - Intergenic
964922553 3:161914929-161914951 CCATTACCACAGAATGAAGATGG + Intergenic
964930593 3:162017139-162017161 TCATTATCACAAAAACAACATGG - Intergenic
965566453 3:170123786-170123808 CCATCTCAAAAAAAAGAAAAAGG + Intronic
966672623 3:182544925-182544947 CCATGACCACAGAAACAAAAAGG + Intergenic
966745532 3:183272257-183272279 CCTTCACTACAGAAAGAACTAGG + Exonic
967013900 3:185464442-185464464 CCATTATCACAAAAACAGCATGG - Intronic
969544335 4:7814808-7814830 CCATCACCACAATCAAGACACGG - Intronic
969993436 4:11287858-11287880 CTATCACCAGGAAAAGAAAAGGG - Intergenic
970070842 4:12158207-12158229 CCATCACAATTAAAAGAACTAGG - Intergenic
970417335 4:15872344-15872366 CCATGACCAAAAAATGAACATGG + Intergenic
970971364 4:21988039-21988061 CCCTCATCACACAATGAACAGGG - Intergenic
974452448 4:62083959-62083981 CTATCATCAAAAAAAGAATAGGG - Intergenic
976080295 4:81347423-81347445 CCCTCCCCTCAAACAGAACATGG - Intergenic
976914547 4:90354888-90354910 CCACCACCACAAAGAGCACTGGG - Intronic
977125906 4:93167555-93167577 CCACCACCACCAACAGAAAATGG + Intronic
977423330 4:96831655-96831677 CCATCACTTCAAGAAGATCATGG - Intergenic
978547089 4:109882087-109882109 CCATGATTTCAAAAAGAACAAGG + Intergenic
978739320 4:112119484-112119506 TCAGCACCACACAAACAACATGG - Intergenic
980152419 4:129063442-129063464 CTACCCCCACAAAAAAAACATGG - Intronic
980502408 4:133673472-133673494 CCATCATCAGAAAAAGAAGTGGG - Intergenic
981947365 4:150363320-150363342 CCTTCCCCAGAAACAGAACAAGG + Intronic
981962738 4:150560979-150561001 CCATCTCAAAAAAAAGAAAAAGG + Intronic
983708354 4:170686125-170686147 CCAACACCAAAAAAAAAAAAAGG - Intergenic
983899264 4:173115949-173115971 ACATCACAACTAAAAGAACTAGG + Intergenic
985906723 5:2843546-2843568 CCATCACCCCAAAAAGAAATCGG + Intergenic
985944652 5:3168662-3168684 TCATCACAGCAAAAAGCACATGG + Intergenic
985983643 5:3492620-3492642 GCATCACCACAACCACAACACGG + Intergenic
986210955 5:5671813-5671835 CAATCAGCACAAAAAGCTCAAGG - Intergenic
986403309 5:7400326-7400348 ACATCACCATAAAAGAAACAAGG - Intronic
987338390 5:16917685-16917707 CCATCTCTACAAAAAAAAAAAGG + Intronic
987455883 5:18146124-18146146 TCATCATCACAAGAAGAGCATGG + Intergenic
987980111 5:25073232-25073254 CCATCTCAAAAAAAAGTACATGG + Intergenic
988151823 5:27392931-27392953 CCAGAACCACAATAAAAACAAGG + Intergenic
988653688 5:33183153-33183175 CCCTCACCACAAACAGACCACGG - Intergenic
988726066 5:33927646-33927668 CCATCTCAAAAAAAAGAAAAAGG + Intergenic
989165312 5:38428007-38428029 CCATCAACACAATAAAAAGATGG - Intronic
989556395 5:42801115-42801137 TCATCACCACCATAAGCACAAGG - Exonic
989621344 5:43387616-43387638 CCACCACCACAACAACAAAAAGG - Intronic
990053504 5:51539054-51539076 CCAAAACCAGACAAAGAACATGG - Intergenic
992144240 5:73829383-73829405 CCATCTCAAAAAAAAGAAGAAGG - Intronic
992518092 5:77517009-77517031 CCATCTCCAAAAAAAAAAAAAGG + Intronic
993020825 5:82588378-82588400 CCAACAGAATAAAAAGAACAAGG + Intergenic
993146367 5:84098832-84098854 ACATCACAACTAAAAGAACTAGG + Intronic
994206961 5:97045979-97046001 CCATCTCAAAAAAAAGAAAAAGG + Intergenic
995230549 5:109756628-109756650 CCAGCACCACTACAACAACACGG - Intronic
995821913 5:116244906-116244928 ACATCACAACTAAAAGAACTAGG + Intronic
997244715 5:132337738-132337760 CCATCTCCAAAAAAAAAAAAAGG - Intronic
997468838 5:134105293-134105315 CTATCCTCACAAAAGGAACAGGG + Intergenic
998225794 5:140325302-140325324 CCAACCCCAGAAAAAGAAAAAGG - Intergenic
999796577 5:154994510-154994532 CCATCTCAAAAAAAAGAAAAAGG - Intergenic
1000096293 5:157973688-157973710 ACAACACAACAAAAGGAACAGGG - Intergenic
1000909060 5:166999095-166999117 CCATCTCCACAGAATAAACAGGG - Intergenic
1002827289 6:785121-785143 CCATCTCCACAAGAAGCCCAGGG + Intergenic
1003348490 6:5293516-5293538 TCTTCACCACAAAAATCACATGG - Intronic
1003555973 6:7140908-7140930 CCCTCCCCAGAAACAGAACAGGG - Intronic
1004190074 6:13456036-13456058 CCATCATCCCAAGAAGGACATGG + Intronic
1004414043 6:15408091-15408113 CCATCTCTACAAAAAATACAAGG + Intronic
1004600942 6:17149274-17149296 CCATCTCCAAAAAAAAAAAATGG + Intergenic
1004627483 6:17390539-17390561 ACATCACCACAAGAAGAAGAAGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006712460 6:36086227-36086249 ACATCACAACTAAAAGAACTAGG + Intronic
1010994795 6:82520724-82520746 CCATTACATCAAAAAGAAAAAGG + Intergenic
1011278228 6:85650566-85650588 CAGTAACTACAAAAAGAACAGGG + Intergenic
1011287670 6:85742492-85742514 CCATCATCACCAAAACAGCATGG - Intergenic
1011436796 6:87347049-87347071 CCATCACCACAATCACAACATGG + Intronic
1013851543 6:114521947-114521969 CCATCACCACTAATAAAACCTGG + Intergenic
1014933426 6:127360600-127360622 CCAACACAACAAAAAAAATATGG + Intergenic
1014966666 6:127761685-127761707 TCAGCACTACAAAAAGAAAAGGG - Intronic
1015014730 6:128398305-128398327 CCATCACCACTCAGAAAACAAGG + Intronic
1015604186 6:134938388-134938410 CTATTAGCAGAAAAAGAACAAGG + Intronic
1015849314 6:137555199-137555221 CCATAGTCACCAAAAGAACATGG - Intergenic
1015910824 6:138165899-138165921 CCATCAGGACAAAGAGAACAAGG - Intronic
1016164802 6:140927459-140927481 CCATCTGTACAAAAAGAAGAAGG + Intergenic
1016721241 6:147301346-147301368 CCATAATCACAAAGGGAACATGG - Intronic
1018213952 6:161508846-161508868 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1018474488 6:164126367-164126389 CCATCATCACCAAAATAGCATGG - Intergenic
1018959337 6:168436147-168436169 CCATCACCACTTACTGAACAGGG - Intergenic
1019003974 6:168780795-168780817 CCATCTCCAGAAAAAAAAAAGGG - Intergenic
1020157600 7:5739241-5739263 CCACCACCACAAAAAAAGCATGG + Intronic
1020205435 7:6111353-6111375 CCATCACCACAAAAGGATCAAGG + Exonic
1021150454 7:17144563-17144585 CCACCACCCCAAAAACCACACGG + Intergenic
1021270181 7:18575098-18575120 CTATCACCAAAAATAGAAAATGG - Intronic
1021702493 7:23333486-23333508 TCATCAGCAAAACAAGAACATGG - Intronic
1021929902 7:25569736-25569758 TCTTCATCACAAAAAGAAAAAGG - Intergenic
1021954099 7:25806687-25806709 CCATCCACACAAAAGGAAAAGGG + Intergenic
1023230705 7:38025158-38025180 CAATCTTCACCAAAAGAACATGG + Intronic
1023470701 7:40515118-40515140 CCATGACCACAATCAAAACACGG + Intronic
1024856487 7:53786459-53786481 ACATCACCACAATAAGAAAGAGG + Intergenic
1025266826 7:57468413-57468435 TCATCCCCACTAGAAGAACATGG - Intronic
1025960611 7:66217882-66217904 CCATCTCAAAAAAAAGAAAAAGG - Intronic
1025991187 7:66498158-66498180 CCATCTCAAAAAAAAGAAAATGG + Intergenic
1026020590 7:66702005-66702027 CCATCAACTCAAAAAGGGCAGGG + Intronic
1026636341 7:72085182-72085204 ACATTATCACAAGAAGAACATGG + Intronic
1026640435 7:72119773-72119795 TCACCACCACAAGAAGAGCATGG + Intronic
1027213441 7:76168016-76168038 CCATCTCAAAAAAAAGAAAATGG + Intergenic
1027282312 7:76617686-76617708 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1027328586 7:77067080-77067102 CCATCATCACCAAAACAGCATGG - Intergenic
1028399688 7:90411438-90411460 CCATATACAGAAAAAGAACATGG + Intronic
1029053548 7:97715810-97715832 CCATAATAACAAAAATAACATGG + Intergenic
1030256715 7:107517700-107517722 CCATCACAAAAAAAAAAAAAAGG - Intronic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1032053839 7:128669128-128669150 CCCCCACCACAAAAACAATAGGG + Intergenic
1032821341 7:135527039-135527061 CCATCCCAACAAAAAAAAAAAGG + Intergenic
1033658354 7:143388029-143388051 CCAGCACCACACAAATAACAGGG - Intronic
1033902968 7:146166073-146166095 ACACCACCACCAAAAAAACAGGG - Intronic
1035184301 7:157113783-157113805 TCACTACCACAAAAACAACATGG - Intergenic
1037040842 8:14230743-14230765 CCACCACCAAAAAAAAAAGAAGG - Intronic
1037489014 8:19378872-19378894 CCATCTCTACAAAAAAAACATGG + Intronic
1037637208 8:20710815-20710837 GCATAACCACAAAAAAAACAGGG - Intergenic
1039070988 8:33649159-33649181 TCACCACCACAAAGTGAACATGG - Intergenic
1039203332 8:35121197-35121219 TCATCATCTCTAAAAGAACAGGG + Intergenic
1039216571 8:35278413-35278435 TTTTCACAACAAAAAGAACAAGG - Intronic
1040455594 8:47594360-47594382 CCATCTCAAAAAAAAGAAAAAGG + Intronic
1040850807 8:51898999-51899021 CTACCACCACAATAACAACACGG + Exonic
1041266494 8:56070563-56070585 CCATCTCCACAAAAAAAGCCAGG + Intronic
1042322933 8:67497219-67497241 CCACCACTCCAAAAAGAACCTGG + Intronic
1043038520 8:75229593-75229615 ACATAACCACAAACAGAAAAAGG - Intergenic
1044338747 8:91022141-91022163 CAACCACCACAAAAAGAATGGGG + Intronic
1044589985 8:93904840-93904862 CCATGAACATAAAAAGTACAAGG + Intronic
1045452295 8:102339523-102339545 CCATCACAAAAAAAAAAAAAAGG + Intronic
1045753737 8:105516692-105516714 CCCTCGCCAAAAAAAGAAAAGGG - Intronic
1047265783 8:123307465-123307487 CCATCTCAAAAAAAAGAAAAAGG - Intergenic
1047729039 8:127710876-127710898 CCACCTCTACAACAAGAACATGG + Intergenic
1047930262 8:129721546-129721568 CCATTTCCACAAGAAGATCATGG - Intergenic
1048630493 8:136237329-136237351 CAATTACCATGAAAAGAACATGG - Intergenic
1049968104 9:797579-797601 ACACCACCTCAAAAAGAAGATGG + Intergenic
1050440787 9:5661279-5661301 CAATCAAAGCAAAAAGAACAAGG - Intronic
1050577644 9:7014884-7014906 CCTTCAATACAAAAAGAAGATGG - Intronic
1051756908 9:20411228-20411250 CCAGCAAGACAAAAGGAACAGGG - Intronic
1051769916 9:20566296-20566318 CCATCTCAAAAAAAAGAAGAGGG + Intronic
1051819400 9:21147219-21147241 ACATCACACCAAAAAGAACTAGG - Intergenic
1052479560 9:29006282-29006304 CCTTTAGGACAAAAAGAACACGG + Intergenic
1054839960 9:69727564-69727586 CCAGCATCACAAATTGAACAGGG + Intronic
1055469617 9:76598284-76598306 CCATCTCTACTAAAAGGACAAGG + Intergenic
1056196307 9:84232211-84232233 CGATAGCCACAATAAGAACAAGG - Intergenic
1056446336 9:86669765-86669787 CCATTACCAGGAAAAAAACAGGG - Intergenic
1056835246 9:89949613-89949635 CACTCACCATAACAAGAACAAGG + Intergenic
1057043170 9:91862323-91862345 CCATCACCAAAAAAAAAAGGAGG + Intronic
1057667150 9:97055039-97055061 CCATCATCATGAAAAGAAAATGG + Intergenic
1058339021 9:103871384-103871406 CCATCATCAGACAAAGAAAAAGG - Intergenic
1060079329 9:120627462-120627484 CCATCTCAAAAAAAAGAAAAAGG - Intronic
1062331735 9:136047920-136047942 CCATCACCCCAAACACACCAAGG + Intronic
1203439965 Un_GL000195v1:180889-180911 CCATCGCAACAAAAACTACATGG + Intergenic
1186069050 X:5797755-5797777 CCATAACTAAAAAAAGAAGAGGG + Intergenic
1186824350 X:13323802-13323824 TCATCACCACATAATGACCATGG + Intergenic
1187623623 X:21086206-21086228 CCATCACCACAACAGGCCCATGG - Intergenic
1188184912 X:27101837-27101859 CTATCACCATAAGAAGGACAAGG - Intergenic
1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG + Intergenic
1189743800 X:44149262-44149284 CCATCACCATGAAAAGAACATGG + Intronic
1191222931 X:58009964-58009986 CCATAATCACCAAAAGAGCATGG - Intergenic
1191834796 X:65453114-65453136 CCATCATCACCAAAACAGCATGG + Intronic
1192575597 X:72240793-72240815 CCATCTCAAAAAAAAGAAAAGGG + Intronic
1192584640 X:72309315-72309337 CCATCTCCCCAAAAAGGAAAGGG - Intergenic
1193423394 X:81311777-81311799 CCATAGTCACAAAAACAACATGG - Intergenic
1193512940 X:82428603-82428625 CCATCACATTAAAAAGAAAAGGG + Intergenic
1194145796 X:90260733-90260755 CCATCACTGCAAAAAAGACACGG + Intergenic
1194257467 X:91652459-91652481 CCATCACCACCACCAGCACACGG + Intergenic
1194998809 X:100622063-100622085 CCATCACAAAAAAAAAAAAAGGG + Intergenic
1195084742 X:101403429-101403451 CCATCTCAAAAAAAAAAACAAGG - Intronic
1195388660 X:104338008-104338030 ACATCACAACAACAAGAAAAGGG - Intergenic
1197232214 X:124017212-124017234 CCATCTCCATAAAAAAAAAAAGG - Intronic
1197639156 X:128948984-128949006 GCATAACCACAAATAGAGCAAGG + Intergenic
1198220396 X:134594703-134594725 CCAGCATCAGAAACAGAACAGGG - Intronic
1198430141 X:136557254-136557276 CCATCACCTAAAGAAGAACATGG - Intergenic
1198953678 X:142102427-142102449 CCATTACCCCAAAAAGCAGATGG + Intergenic
1199112687 X:143954165-143954187 TCATTATCACAAAAACAACATGG - Intergenic
1199170808 X:144732789-144732811 TCATCATCACAAAAACAGCATGG + Intergenic
1199425581 X:147697440-147697462 CCAGAAGCACAAAAAGAACCTGG - Intergenic
1200491546 Y:3830028-3830050 CCATCACTGCAAAAAAGACACGG + Intergenic
1200576125 Y:4891405-4891427 CCATCACCACCACCAGCACACGG + Intergenic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic
1201273487 Y:12278059-12278081 CCATCTCTACAAAAATAACCTGG + Intergenic