ID: 1080408001

View in Genome Browser
Species Human (GRCh38)
Location 11:31997057-31997079
Sequence GTGCCCACCCGGACTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2897
Summary {0: 1, 1: 85, 2: 532, 3: 1058, 4: 1221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080407992_1080408001 29 Left 1080407992 11:31997005-31997027 CCACGTTCTCCTGCCTGCTTTTA 0: 1
1: 60
2: 225
3: 391
4: 880
Right 1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG 0: 1
1: 85
2: 532
3: 1058
4: 1221
1080407994_1080408001 20 Left 1080407994 11:31997014-31997036 CCTGCCTGCTTTTATTCTGGCTG 0: 1
1: 5
2: 12
3: 41
4: 317
Right 1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG 0: 1
1: 85
2: 532
3: 1058
4: 1221
1080407995_1080408001 16 Left 1080407995 11:31997018-31997040 CCTGCTTTTATTCTGGCTGTGTT 0: 2
1: 27
2: 71
3: 216
4: 545
Right 1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG 0: 1
1: 85
2: 532
3: 1058
4: 1221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080408001 Original CRISPR GTGCCCACCCGGACTGAGGG TGG Intronic
Too many off-targets to display for this crispr