ID: 1080412431

View in Genome Browser
Species Human (GRCh38)
Location 11:32038410-32038432
Sequence CTGGTGAGACAGAAAAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 466}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080412431_1080412436 14 Left 1080412431 11:32038410-32038432 CCTTGTCTTTTCTGTCTCACCAG 0: 1
1: 0
2: 2
3: 71
4: 466
Right 1080412436 11:32038447-32038469 CTTTAGGCAGTGTTACATGTAGG 0: 1
1: 0
2: 0
3: 13
4: 110
1080412431_1080412438 23 Left 1080412431 11:32038410-32038432 CCTTGTCTTTTCTGTCTCACCAG 0: 1
1: 0
2: 2
3: 71
4: 466
Right 1080412438 11:32038456-32038478 GTGTTACATGTAGGGTGAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 107
1080412431_1080412437 15 Left 1080412431 11:32038410-32038432 CCTTGTCTTTTCTGTCTCACCAG 0: 1
1: 0
2: 2
3: 71
4: 466
Right 1080412437 11:32038448-32038470 TTTAGGCAGTGTTACATGTAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
1080412431_1080412433 -2 Left 1080412431 11:32038410-32038432 CCTTGTCTTTTCTGTCTCACCAG 0: 1
1: 0
2: 2
3: 71
4: 466
Right 1080412433 11:32038431-32038453 AGCCCTAAATCTTACGCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080412431 Original CRISPR CTGGTGAGACAGAAAAGACA AGG (reversed) Intronic
900386901 1:2414759-2414781 CTGGTCAGCCAGGAAGGACATGG - Intergenic
900623013 1:3596045-3596067 CTGGGGAGACAGAGGAGACCTGG + Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
904788226 1:32998440-32998462 GTCGGGAGACAGAAAAGACCAGG - Intergenic
904797437 1:33067673-33067695 CTGGTGAGACAGAAAGTATAAGG - Intronic
904842175 1:33379514-33379536 CTACTGACACAGAAAAGACACGG - Intronic
905297587 1:36963943-36963965 CTGGTGAGGATGAAGAGACAGGG + Intronic
905324176 1:37138733-37138755 CTGCTGAGACAGAAGAGATGTGG + Intergenic
905943495 1:41883080-41883102 CTGGTCACACAGAAAATACAGGG + Intronic
905997272 1:42392186-42392208 CTGGGGAGAGAGAAAAATCAAGG - Intronic
906342618 1:44993988-44994010 CTAGTGTGATAGAGAAGACATGG - Intergenic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
906484180 1:46221810-46221832 CTGGAGAAACTGAAAAGGCATGG - Intergenic
906577644 1:46905169-46905191 CTGGTGAGACAGAACATATAAGG - Intergenic
907530458 1:55090593-55090615 CTAGTGAGAGGGAAAAGACTGGG + Intronic
907634879 1:56124334-56124356 ATGGTGAGACAGAAAATCTATGG - Intergenic
908155903 1:61352897-61352919 TTGGTGAGATAGAAAGGAAAAGG + Intronic
909480619 1:76125771-76125793 CTGGTGTTAAAGAAAAGGCAGGG - Intronic
910081693 1:83349602-83349624 AAGATGAGACAGAAGAGACAAGG - Intergenic
910210240 1:84784975-84784997 CTGATGTGGCAGCAAAGACAAGG - Intergenic
910662231 1:89686207-89686229 CAGGTGGGACAGAAAGAACATGG - Intronic
912170857 1:107097667-107097689 CTGGTGAGGCTGAAGAGAAAAGG - Intergenic
912412156 1:109486997-109487019 CTGGTGACAGAAAGAAGACATGG + Exonic
912442137 1:109707293-109707315 CTGGTGAGACAGAAAGTATAAGG - Intronic
912609036 1:111024237-111024259 CTGGTGAAAGGGAAAAGATATGG - Intergenic
912879357 1:113392460-113392482 CTGCTGAGAAAGAAATGAGAAGG - Intronic
914314755 1:146499771-146499793 CTATTGAGAGAGAGAAGACATGG + Intergenic
914499596 1:148233617-148233639 CTATTGAGAGAGAGAAGACATGG - Intergenic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
915932128 1:160067380-160067402 CTGGAGAGACCGAAGTGACATGG + Intronic
915974797 1:160378171-160378193 CTGGTGGGACAGGAAAGTGACGG + Intergenic
916009204 1:160689427-160689449 CTGGTGAGACAGAAAGTATAAGG + Intronic
918086766 1:181252172-181252194 CTGGTGAGACAGAAAGTATAAGG - Intergenic
918470118 1:184863018-184863040 CTGGTGAGAAACAACACACAGGG - Intronic
919425280 1:197422090-197422112 CTGATGAGAAAGAAAAGAAGAGG + Intronic
919495969 1:198268411-198268433 CTGGTGAGATTGAAAAGAAGAGG - Intronic
920110978 1:203586807-203586829 ATAGTGAGACAGATCAGACAAGG - Intergenic
920368512 1:205461804-205461826 CTGATGATTCAGGAAAGACAGGG - Intergenic
920944356 1:210514690-210514712 GAGATGAGACAGAAAGGACAAGG + Intronic
923305156 1:232681784-232681806 CTGCTGGGACAGAAAAGCCAGGG + Intergenic
923411529 1:233714808-233714830 CTGGTGAGGAAGAAAGCACAGGG + Intergenic
924081356 1:240401421-240401443 ACGTTGAGACAGAAAATACACGG + Intronic
924115170 1:240738291-240738313 CTGGTAAGACAAAGAAGAGATGG + Intergenic
924313081 1:242766450-242766472 CTTCTGACAAAGAAAAGACAAGG + Intergenic
924835921 1:247647292-247647314 CTTGTGCTACAGGAAAGACATGG - Intergenic
1062767742 10:78705-78727 CTGCTGAGACAGAGTAGAAATGG + Intergenic
1063300948 10:4848436-4848458 CTGAGCAGACAGCAAAGACAGGG - Intergenic
1064087423 10:12355837-12355859 CTGGAGCCACAGAAAATACAAGG + Intronic
1064424829 10:15221398-15221420 CTGGTGGGAGTGAAAAGAGAGGG + Intronic
1065706139 10:28473054-28473076 ATGGTGAGAAATAAAAGACAGGG - Intergenic
1066789733 10:39049192-39049214 CTGCTGAGACAGAAAATATAAGG - Intergenic
1067123478 10:43495179-43495201 CTGGGGACACTGAAAACACAGGG - Intergenic
1067327361 10:45281992-45282014 CTGGAAAGACAGAAAGGACTGGG + Intergenic
1067556377 10:47276224-47276246 CTGGGGAGACTGAGGAGACACGG - Intergenic
1068579335 10:58721233-58721255 CTGGGGAGAGAGAAAAACCATGG - Intronic
1068913922 10:62407762-62407784 ATGGTAAGATAGAAAATACATGG + Intronic
1069162569 10:65109297-65109319 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1069190270 10:65478745-65478767 CTGGAGAAACAGACAAGAAAAGG + Intergenic
1069933143 10:71897022-71897044 CTGTGGAGGCAGAGAAGACAAGG - Intergenic
1070971649 10:80572110-80572132 AGGGTGAGACAGAAGAGACTTGG + Intronic
1072565801 10:96615729-96615751 CAGGTGAGAAAGAAGAGGCATGG + Intronic
1072730700 10:97844330-97844352 CTGATGATTCAGAAAAGAGAGGG - Intergenic
1073040264 10:100599343-100599365 CTGGTGAGGAAGCAGAGACAAGG + Intergenic
1073354254 10:102841236-102841258 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1073996226 10:109318085-109318107 CTAATGAGACAGATAAGACCAGG - Intergenic
1074008154 10:109449241-109449263 CTGCTGAGACAGTAAGGACCTGG + Intergenic
1074143346 10:110696316-110696338 CTGGAGAGAAAAAAAAGCCAGGG - Intronic
1074652960 10:115545883-115545905 ATGGTGAAACAGAGAAGTCAGGG + Intronic
1075220272 10:120578638-120578660 CTGGGGAGGCAGAAAAGACCAGG - Intronic
1076939591 10:133593057-133593079 CTGGTGAGTCAGTAAACAAAGGG - Intergenic
1078606178 11:12777701-12777723 GCTGTGAGACAGAAAATACAAGG - Intronic
1078839569 11:15065842-15065864 CTGGTGAGACAGAAAGTATAAGG + Intronic
1080056955 11:27916420-27916442 CTGGTCTGAGAGACAAGACAGGG - Intergenic
1080412431 11:32038410-32038432 CTGGTGAGACAGAAAAGACAAGG - Intronic
1080621282 11:33989194-33989216 CAGGTGAGAAAGAGAAGACAGGG + Intergenic
1081434736 11:43014785-43014807 CTGATGGGAGAGAAAACACACGG + Intergenic
1081619631 11:44611668-44611690 CTACTGAGACAAAAAGGACAGGG - Intronic
1081781676 11:45717321-45717343 CTGGGAGGACAGGAAAGACAGGG + Intergenic
1082309774 11:50632381-50632403 CTGGTGAGACAGAAAATATAAGG + Intergenic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084429660 11:69104142-69104164 CTTGTGAGAGAGAAAACACCTGG - Intergenic
1085951691 11:81340235-81340257 CAGATAAAACAGAAAAGACAAGG - Intergenic
1086236706 11:84640165-84640187 ATGGAGAAACAGAAAAGACCTGG + Intronic
1086450855 11:86915253-86915275 CTGGTAAGACAGAAAACTCAGGG + Intronic
1087888604 11:103509974-103509996 TTGGTATGACAGAAAAGTCAGGG + Intergenic
1089571124 11:119410655-119410677 CTGTTGAGAAAGAAAAGGCTGGG - Intergenic
1090270701 11:125383993-125384015 CTGGGGAGACAGACCAGAGAGGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091773439 12:3168771-3168793 GTGGAGACACAGAAAAGAGAGGG - Intronic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1092757315 12:11775927-11775949 CTGGTGAGACTGAAAATACCAGG - Intronic
1093668513 12:21843870-21843892 CTGGAAAGTCAGAAAAGACAAGG + Intronic
1094156238 12:27339589-27339611 CTGGTGAGACTGCAAAGAAAAGG - Intronic
1094322828 12:29204276-29204298 CTGAAGAGACAGTGAAGACACGG + Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1094865707 12:34528060-34528082 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1095258983 12:40076576-40076598 CTGTTCACACAGCAAAGACATGG - Intronic
1096390509 12:51225068-51225090 CAGGTGAAAGAGAAAATACATGG - Intergenic
1096787286 12:54024463-54024485 CTGGGGAGAGAGAGGAGACAGGG + Intronic
1097334246 12:58364524-58364546 ATGGGGAGACAGAACACACAAGG + Intergenic
1098069075 12:66652333-66652355 CAGGTGAGAGAGAAAAGCCCAGG - Intronic
1098337567 12:69419744-69419766 ATAGTGAGCCAGAAAAGACCTGG + Intergenic
1098384462 12:69904168-69904190 GTGGGGAGACAGAAAGGAAAAGG - Intronic
1098409474 12:70165261-70165283 CAGGTGAGACACAAAAGAGGAGG + Intergenic
1098767925 12:74513817-74513839 ATTGAGAGTCAGAAAAGACATGG + Intergenic
1099068264 12:78011890-78011912 CAGGTGAGAAAGAGAGGACATGG + Intronic
1099464000 12:82960175-82960197 CTGGTGAGACAATGAAGAAAAGG + Intronic
1099555374 12:84103142-84103164 CTGGTGAGACAGAAAGTATGAGG + Intergenic
1100817026 12:98396499-98396521 ATGGTGAAAAAAAAAAGACAGGG + Intergenic
1102152259 12:110696993-110697015 TGTGGGAGACAGAAAAGACAGGG + Intronic
1106846419 13:33742452-33742474 CTGGTGAGAGAGGAAGCACAGGG - Intergenic
1106891492 13:34250964-34250986 CTTGTGACCCAGAAAAGATAAGG + Intergenic
1107432209 13:40350303-40350325 CTGGTAAGAAAGATGAGACAGGG + Intergenic
1107588633 13:41880620-41880642 CTGTTCAGACATGAAAGACAGGG - Intronic
1107736107 13:43400048-43400070 GTGGTGAGAATGAAAGGACAAGG - Intronic
1107782013 13:43913545-43913567 CTGGTGATACAAAACAGAGAGGG + Intergenic
1107904774 13:45051783-45051805 CTGATGGGACAAAAAATACAAGG - Intergenic
1108107310 13:47025092-47025114 CAAATGAGACAGAAAAGGCATGG + Intergenic
1108813339 13:54258396-54258418 CTGTTTATACAGAAAACACATGG - Intergenic
1108857586 13:54813759-54813781 TTGGTAAGAAAAAAAAGACATGG - Intergenic
1109075926 13:57834251-57834273 TGAGTGAGACAGAAAAGCCAAGG - Intergenic
1109366030 13:61357104-61357126 CTGGTCAGAAAGAAGAGACATGG + Intergenic
1110252746 13:73398975-73398997 ATGTTGATACAGAAAGGACATGG - Intergenic
1112471903 13:99696952-99696974 CTGTTGAAACAGAGAAGACAGGG - Intronic
1112935933 13:104798477-104798499 CTATTCAGACATAAAAGACAAGG + Intergenic
1112999111 13:105611538-105611560 CTGGGGAGACAGAGCAGACCCGG + Intergenic
1113123401 13:106949133-106949155 CTGGGGAAAGAGAAAAGAAAAGG + Intergenic
1113427030 13:110216714-110216736 CTAGTGACCCAGAAAAAACAGGG - Intronic
1114185803 14:20401286-20401308 CAGGTGAGTCAGAAAAGGAAAGG + Intronic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1114375198 14:22138788-22138810 CAGCTGAGCCAGAAAATACAAGG + Intergenic
1114401693 14:22416132-22416154 CTGGTCATAGAGAAAGGACAAGG + Intergenic
1114560009 14:23582771-23582793 CTGTAGGGACAGAAAAGAAAGGG - Intergenic
1114918740 14:27299049-27299071 CTTGTGAGGCAGAAAAAACAAGG - Intergenic
1115405380 14:33009666-33009688 TTAGTGAGACAGAAAAGATAAGG - Intronic
1116179148 14:41513634-41513656 CAGTGGAGACAGCAAAGACACGG + Intergenic
1116544810 14:46151820-46151842 ATGGGGAGACATAAAAGATAGGG - Intergenic
1117334448 14:54744949-54744971 TTGGTGAGACAGAGAAAACAGGG - Intronic
1117546270 14:56797052-56797074 TTGGTGTGACAGAAAAGACTGGG - Intergenic
1118882846 14:69843444-69843466 CTGTTGGGAGAGAGAAGACAAGG - Intergenic
1118912715 14:70075296-70075318 CTGGTGAGAGAGAAAAGGAAGGG - Intronic
1120241700 14:81957419-81957441 CGGTTTAGATAGAAAAGACAGGG + Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120397014 14:83980812-83980834 CTGGAGAGACAGACAAAATAAGG - Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1120737980 14:88076683-88076705 CTGGTGAGACAGCAAAAGCCTGG + Intergenic
1121279709 14:92689623-92689645 CTTGTGAGACAGACAAGTCCAGG - Intergenic
1121435882 14:93919092-93919114 CTGGTGGGACAAAAGTGACATGG - Intronic
1122448936 14:101788036-101788058 TTGGTGAGACAGCAAGGAAAGGG + Intronic
1123092765 14:105749113-105749135 CTGGGCAGACAGAAAACCCAAGG + Intergenic
1124008923 15:25819430-25819452 CTGGTGAGACTGCAGAGAAAAGG + Intronic
1124840122 15:33233647-33233669 ATGAAGAGACAGCAAAGACATGG - Intergenic
1125052964 15:35322563-35322585 GTAGTGATACAGAAAAGACAAGG - Intronic
1125363007 15:38884410-38884432 CTTATTAGAAAGAAAAGACATGG - Intergenic
1125567713 15:40689846-40689868 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1126963707 15:54027674-54027696 CTGTTGAGACAGAAAACCCAGGG - Intronic
1127309265 15:57738003-57738025 CTGGTGAGAGAGACCAGAGAGGG - Intronic
1127935690 15:63635389-63635411 CTGTTGAGACAGATCAGACTTGG - Intronic
1128072875 15:64808155-64808177 CTGCTGGGACAGAAATGGCAGGG - Intergenic
1129457656 15:75684170-75684192 CTGGTGGAACAGAAAGGGCATGG - Intronic
1129726145 15:77902789-77902811 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130274201 15:82468152-82468174 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130466546 15:84195526-84195548 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1130497718 15:84478010-84478032 CTGGTGGAACAGAAAGGGCATGG - Intergenic
1130588843 15:85200119-85200141 CTGGTGGAACAGAAAGGGCATGG + Intergenic
1131241860 15:90751725-90751747 CTAATGAGACAGAAAGAACAGGG - Intronic
1131426908 15:92353226-92353248 CAGGAGAGACAGAAAACAAAGGG - Intergenic
1135105573 16:19646251-19646273 GTGGTGAGAAAGAGAGGACATGG - Intronic
1135962821 16:27011970-27011992 CTGATGTAACAGAAAAGTCAAGG - Intergenic
1136408600 16:30064037-30064059 CTGGAGGGCCAGAAAAGAGAGGG + Exonic
1137554677 16:49463118-49463140 CTGGAGAGACAGAGAAGAGAAGG - Intergenic
1137741302 16:50778365-50778387 ATGGTGAGAAAAAATAGACATGG + Intronic
1138666083 16:58569949-58569971 CTGATGAAAGAAAAAAGACAAGG + Intronic
1138767800 16:59624804-59624826 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1140032475 16:71349541-71349563 CTGGGGAGACAAATAAGACTGGG + Intergenic
1140043311 16:71423942-71423964 CTGGGGAGACAGAGAAGGCTTGG + Intergenic
1140691720 16:77491014-77491036 CTTGTGAGGCAGAAGAGACCAGG + Intergenic
1140695220 16:77525796-77525818 CTGGTGATACCCAAAAAACAGGG + Intergenic
1140948678 16:79795376-79795398 GTGGTGTGAAAGAAAATACAAGG - Intergenic
1141639359 16:85332580-85332602 CTGGTGGGACTGAGAAGCCAGGG + Intergenic
1142855963 17:2730494-2730516 CTGGGGGGAAAGAAAAGAAAAGG + Intergenic
1143386855 17:6536102-6536124 ATGATGAGAAAGAAAACACAGGG + Intronic
1143594083 17:7903802-7903824 CTGGTGAGAGGGAAAACAAACGG - Intronic
1145801525 17:27689115-27689137 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1145822841 17:27852867-27852889 CTGATGAGGCAGAAAGGAAAGGG + Intronic
1146159636 17:30552980-30553002 CTGGTGAGACTGAAGGGCCATGG + Intergenic
1147214173 17:38889894-38889916 GTGGTGAGAGAGAAAACACACGG - Intronic
1147910771 17:43854600-43854622 CTTGGGAGAGAGAAAGGACATGG + Intronic
1148715503 17:49712840-49712862 AGGGTGAGACAGATATGACAAGG - Intronic
1150346786 17:64410899-64410921 CTGGCCACACAGACAAGACATGG - Intronic
1151229039 17:72668891-72668913 CATGTGAGACAGAAAAGGCAGGG + Intronic
1151417452 17:73975751-73975773 CTGGTGACAGGGAAAAGACCTGG - Intergenic
1152840938 17:82567640-82567662 CAGGGGGCACAGAAAAGACAGGG - Intronic
1153070822 18:1102358-1102380 CTGGTGAGGCTGCAAAGAAAAGG - Intergenic
1153992509 18:10412939-10412961 TTGGTGAGATAGAGAAGAGATGG - Intergenic
1155088420 18:22481636-22481658 TTGGTGAGAAAGTAAAGAAAAGG + Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155320849 18:24617547-24617569 CGGGTCACACAGTAAAGACATGG + Intergenic
1156663002 18:39370219-39370241 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
1156781029 18:40851096-40851118 CTGGTGATAGAGAAATGGCAAGG - Intergenic
1156954917 18:42950924-42950946 CTGGTGAGACTGCAGAGAAAGGG + Intronic
1158009435 18:52711858-52711880 TTGGAGATACAGAAAAGTCAGGG - Intronic
1158568813 18:58579255-58579277 CTGGTGAGTCAGAAAACTCAGGG - Exonic
1158871289 18:61690861-61690883 ATGGTGATACAGAAAAGTGAGGG + Intergenic
1159111321 18:64059552-64059574 CTGGTGAGACTGCAGAGAAAAGG - Intergenic
1160093064 18:75845308-75845330 GGAGGGAGACAGAAAAGACAGGG + Intergenic
1163901423 19:20103898-20103920 TTTTTCAGACAGAAAAGACACGG - Intronic
1164048515 19:21563653-21563675 TTGGTGACAGAGAAAAGATATGG - Intergenic
1164288997 19:23850279-23850301 TTGGTGAGACAGAAAGTATAAGG + Intergenic
1164330205 19:24247149-24247171 CTGGTGAGAGAGAAAGTATAAGG - Intergenic
1164377994 19:27706326-27706348 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1164532793 19:29060945-29060967 CTGGGGAACCAGAAAACACATGG + Intergenic
1165010224 19:32840636-32840658 CTGCTGGGAGAGAAAGGACATGG - Intronic
1165291573 19:34890137-34890159 TAGGTGGGCCAGAAAAGACAGGG - Intergenic
1165293546 19:34907828-34907850 TAGGTGGGCCAGAAAAGACAGGG - Intergenic
1166184591 19:41131577-41131599 CTGGAGACACTGAAAAGAGATGG + Intergenic
1166574309 19:43823256-43823278 CTTATGAGAAATAAAAGACATGG + Intronic
1166872885 19:45881766-45881788 AAGGAGAGACAGAAAAGAAAAGG - Intergenic
1167074204 19:47239314-47239336 CTGGTGAGACAAAATAGAGCTGG + Intergenic
1167172639 19:47843426-47843448 GTGATGAGACAGGAAACACATGG - Intergenic
1168715618 19:58525462-58525484 CTGATGGGACAGAGAAGACATGG + Intronic
925571405 2:5316412-5316434 TTGGTGAGACAGGAGTGACATGG + Intergenic
926040331 2:9667602-9667624 CTAGTGAGGCAGAAAAGGAATGG + Intergenic
926171700 2:10556782-10556804 CTCCTGAGAAAGCAAAGACACGG + Intergenic
926702811 2:15815114-15815136 CTGGTGAGACAGAAGGCACGTGG - Intergenic
926790557 2:16567103-16567125 CTGGGGATAAAAAAAAGACAGGG + Intronic
926797118 2:16628077-16628099 CTGGGAAGCCAGGAAAGACAGGG + Intronic
927930317 2:27039670-27039692 CTGGGGAGACAGACACTACAGGG - Intronic
928337466 2:30410014-30410036 ATGGTAGGACAGAAAACACATGG - Intergenic
928592332 2:32830351-32830373 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
928983074 2:37156300-37156322 CTGATGAGACAGGAAAGCTACGG + Intronic
929619527 2:43340801-43340823 CAGGTGAGAAAGTAAAGACAGGG + Intronic
929660293 2:43777520-43777542 CTGGTGACACAAAAAGGTCAAGG + Intronic
929782649 2:44967074-44967096 CTGGTGAAGGAGAGAAGACACGG + Intergenic
930943060 2:57036619-57036641 TTGGTGAGGCAGAATAGAAAGGG - Intergenic
930998453 2:57751577-57751599 TTAGTGAGAGAGAAAATACAAGG - Intergenic
931600081 2:63994319-63994341 CTGGTGAGACAGAAAGTATAAGG - Intronic
932090712 2:68803845-68803867 CTGTTGAGACAGAGAAGGGAGGG + Intronic
932626690 2:73302142-73302164 AAGGTGAGAGAAAAAAGACAAGG + Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
933894135 2:86795045-86795067 CGGGTGACACAGAGAAGAGAAGG - Intronic
934019308 2:87928682-87928704 CTGGTGAGACTGTAGAGAAAAGG - Intergenic
934146935 2:89104166-89104188 TTGGAGAGACAGAAATTACAGGG - Intergenic
934222331 2:90096429-90096451 TTGGAGAGACAGAAATTACAGGG + Intergenic
934980035 2:98832058-98832080 CTGCTCAGACAGGAAAGTCAAGG + Intronic
935142376 2:100364743-100364765 CTGGTGAGACAGAAAGTATAAGG + Intergenic
935634243 2:105237639-105237661 CTCGTGAGACAGACATGAGAGGG - Intergenic
935899031 2:107770713-107770735 CTGGCGAGCCAGAGAAAACAGGG - Intergenic
936122461 2:109758684-109758706 GTGTTCAGACTGAAAAGACAAGG - Intergenic
937140454 2:119595748-119595770 GTGGTGAGAAAAATAAGACATGG + Intronic
938473575 2:131588326-131588348 CTGGTGAGAATGAAGAGAAAAGG + Intergenic
938603855 2:132872248-132872270 CAGGTGAGACAGGAATGCCAAGG + Intronic
939680890 2:145130492-145130514 CTAGTCAGAAAAAAAAGACATGG + Intergenic
941234523 2:162953546-162953568 CTGGTGCAACACAAAAGCCATGG + Intergenic
941299753 2:163786508-163786530 CTTGTGAGGCAGAAAAGCTAAGG + Intergenic
942833414 2:180263933-180263955 CTGGTGAGAATGAAAAGTCTAGG + Intergenic
943004303 2:182370794-182370816 CTGTTGAAACAGAAAAGTTATGG + Intronic
943683204 2:190789472-190789494 CTGGTGAGAGTGGAAAGACATGG - Intergenic
944828755 2:203511702-203511724 ATGGGGAGACAGCAAAGACATGG - Intronic
945363484 2:208921861-208921883 CTGGTGAGGCTGTAAAGAAAAGG - Intergenic
945723346 2:213446589-213446611 CTGGTGAGACAGAAAGTATAAGG - Intronic
946576618 2:221082536-221082558 CTGGTGAGGCAGAAAGGCCCTGG - Intergenic
947252837 2:228126972-228126994 CTGGTGAGAGAAATAAAACAAGG - Intronic
947363036 2:229365415-229365437 CTGTTGAGATAGAAAACCCAGGG + Intronic
948324772 2:237105718-237105740 CTGGTGAGAAAGCAGAGAAAAGG + Intergenic
1169186464 20:3621219-3621241 GTGCTGAGCCAGAAAGGACAGGG + Intronic
1170104515 20:12738916-12738938 CAGGTGAGAGAGAAAAAAGAGGG + Intergenic
1170248150 20:14247049-14247071 ATGGTTAGACAGAAAAAACTGGG - Intronic
1170792103 20:19516865-19516887 CTGTGGAGTCAGAGAAGACATGG + Intronic
1172485633 20:35296335-35296357 CTTGTGAGAGACAATAGACAAGG - Intergenic
1173542085 20:43861618-43861640 CTGGTCACACAGCCAAGACAAGG - Intergenic
1174802977 20:53580768-53580790 CTTGCCAGACAGAAAGGACAAGG + Intronic
1175534798 20:59702016-59702038 CTATCGAGACAGGAAAGACATGG - Intronic
1177301802 21:19256272-19256294 CTGGAGAGAAAGAAAAGCCTTGG + Intergenic
1177346381 21:19877588-19877610 CTGGTGAGGCTGAAGAGAAAAGG + Intergenic
1178188486 21:30253296-30253318 CTGGTGAGAATGAGAAGAGAAGG + Intergenic
1179087830 21:38236130-38236152 CAGGTAAGACAGAAAACAGAGGG - Intronic
1179091964 21:38274637-38274659 GAGGTAAGACAGAAAAGAAAGGG - Intronic
1179263738 21:39783348-39783370 CTGGTGAGAATGAACAGAAATGG - Intronic
1180081860 21:45490813-45490835 CTGGAGAGACAGGAAGGAAATGG - Intronic
1180122453 21:45762929-45762951 GTGATGAGACAGAAAAGCCATGG - Intronic
1180605696 22:17057494-17057516 CTGATGAGACAAAGAACACAGGG - Intergenic
1180991421 22:19939442-19939464 CTGGTGAGACAGAAAGTGTAAGG - Intronic
1181683696 22:24514229-24514251 CTGGTCAGGCAGATAAGAAATGG + Intronic
1181898594 22:26133174-26133196 CTAGTGATACAGCAAAAACATGG - Intergenic
1182548912 22:31090755-31090777 GTGGGGAAAGAGAAAAGACAGGG - Intronic
1183166099 22:36148491-36148513 CAGGTGACACAGAGAAGACGTGG + Intronic
1183396975 22:37577135-37577157 CTGGAGAGAGAGGAAAGAAAAGG + Intronic
1184654139 22:45932660-45932682 CTGGGGACATAGAAATGACATGG - Intronic
1184934718 22:47712894-47712916 ATGGAGAGACAGAAAATGCAAGG - Intergenic
949915966 3:8964847-8964869 AGGGAGAGAGAGAAAAGACAGGG + Intergenic
950133498 3:10564057-10564079 CTGGTGAGAAAGAAACTTCAGGG + Intronic
950446963 3:13044011-13044033 CTGGTGCCACAAAAAAGACAAGG + Intronic
950880374 3:16318057-16318079 CTGGTGTGACAGGGAAGTCAGGG + Intronic
951732487 3:25825716-25825738 CTGGTGAGACTGCACAGAAAAGG + Intergenic
952007928 3:28863836-28863858 CTGGTGAGAGGGAAAGGAGAAGG - Intergenic
952031767 3:29151407-29151429 CTGATGCCACAGAAAACACAAGG - Intergenic
952092329 3:29902975-29902997 CTGGTAAGAGAGAAATGAAATGG + Intronic
954006677 3:47596820-47596842 CTGATGAGACAGAAAGGAATAGG + Intronic
954847623 3:53573622-53573644 CTGGGGAGACAGACAATAAATGG - Intronic
954896384 3:53978710-53978732 CAGGAGAGACAGAAAAGCCCAGG - Intergenic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955784799 3:62526032-62526054 CTGGGGAGAAAGAGAAGTCAAGG + Intronic
955949861 3:64232259-64232281 ATGGTGAGCCACAAAAGGCATGG - Intronic
955968846 3:64416710-64416732 CTGGTGAGGCTGCAAAGAAAAGG + Intronic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
956420745 3:69084510-69084532 ATGGTGAAACAGAGAAAACATGG + Intergenic
956734354 3:72226477-72226499 CTGCTGAGAGAAATAAGACAAGG - Intergenic
957013498 3:75035590-75035612 CTGTTGAAACAGAAAATAAAAGG - Intergenic
957353863 3:79057693-79057715 CTGGTGAGACAGAAAGTATAAGG - Intronic
957607660 3:82423595-82423617 CTGGGGCTACAGAAAATACAAGG - Intergenic
958656782 3:97012289-97012311 CTGGTGAGGCTGCAAAGAAAAGG - Intronic
959132964 3:102380762-102380784 CTGGTGGTACAGAACAGCCAAGG - Intronic
959649745 3:108740100-108740122 CATTTGAGGCAGAAAAGACAGGG + Intergenic
959888340 3:111527420-111527442 CTGGTGAGACAGAAAGTATAAGG - Intronic
960228472 3:115195670-115195692 CTGATGAAACAGAAGAGAGAAGG + Intergenic
960756174 3:121015802-121015824 CTGATGAGACAGGAAGGCCAAGG - Intronic
961032668 3:123620160-123620182 CTGGTGAGAAAGAAAGGGCTGGG - Intronic
961034025 3:123629805-123629827 CAGGTGACCAAGAAAAGACAGGG - Intronic
961237340 3:125378531-125378553 CTGGTGAAGCAGGAAAGAGATGG - Intergenic
961922882 3:130446362-130446384 CTGGTGAGACAGAAAGTATAAGG + Intronic
962994418 3:140611379-140611401 CTGGGGAGTCTGAACAGACATGG - Intergenic
963710302 3:148739483-148739505 CTGGTGAGTCAAAGAAGAAAAGG + Intronic
965091594 3:164170107-164170129 CTGGTGTGAGACAAAAGACAGGG - Intergenic
965942655 3:174203449-174203471 CTTGTGAGACAGGGAAGCCATGG + Intronic
966134051 3:176678327-176678349 CTGGTGAGACTGTGAAGAAATGG + Intergenic
966489423 3:180510602-180510624 CCGGTGAGACTGAAAACAGAAGG + Intergenic
966664539 3:182456258-182456280 CTGGTGAGGATGAAAAGAAAGGG - Intergenic
966877294 3:184330087-184330109 CTGTTAAGAAAGAAAAGACTGGG + Intronic
967280935 3:187822920-187822942 CTGGTGGGAAATGAAAGACAGGG + Intergenic
968009380 3:195263674-195263696 ATGGTGAGAGAAAACAGACAAGG + Intronic
969008938 4:4044991-4045013 CTGGTGAGACAGAAAGTATAAGG + Intergenic
969449814 4:7266557-7266579 CTGTGGAGAGAGTAAAGACAGGG - Intronic
969683382 4:8655739-8655761 CTGGTGATACAGCAAATGCAGGG + Intergenic
970602374 4:17650518-17650540 CTGTGGAGTCAGAAAAGCCAGGG + Intronic
970926833 4:21461725-21461747 CATGTGAGGCAGGAAAGACATGG - Intronic
972140153 4:35948720-35948742 CTCTTGAGACAGAACATACAAGG - Intronic
973590483 4:52436027-52436049 AAGTTCAGACAGAAAAGACAAGG - Intergenic
974240638 4:59241615-59241637 CTGATGAGAAAAACAAGACATGG + Intergenic
974605381 4:64144262-64144284 CTGGTGAGACAGAAAGTATAAGG + Intergenic
974713954 4:65641233-65641255 CTAGAGAGGCAGAAAGGACACGG + Intronic
974942382 4:68485012-68485034 CCTGTGAACCAGAAAAGACAAGG - Intronic
975351143 4:73348699-73348721 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
975914294 4:79305146-79305168 GAGGTGATTCAGAAAAGACATGG - Intronic
975955086 4:79827260-79827282 CTGGTGAGACAGAAAGTATAAGG + Intergenic
975985709 4:80199830-80199852 CTTGGGAGAAAGAAAAGAAAGGG - Intronic
976201907 4:82587194-82587216 GTGATGAGACAGAAAAGAGAAGG - Intergenic
977297632 4:95228578-95228600 CTGGTGAAACAGCAGAGCCAGGG + Intronic
979091250 4:116485218-116485240 CTGGTGAGACTGCAGAGAAAAGG - Intergenic
979950464 4:126886408-126886430 CTGGAGAACCAGAAAAGCCAGGG - Intergenic
980978703 4:139635554-139635576 CTGGTGAGATAGAAAGTATAAGG - Intergenic
981813372 4:148801142-148801164 CTGGGGAGAGAGGAAAGACATGG - Intergenic
982456470 4:155615481-155615503 CTGGTGAAAAGGAAATGACAAGG - Intergenic
982669592 4:158304540-158304562 ATTGTGAGACTGAGAAGACAAGG - Intergenic
982808594 4:159798092-159798114 TTGGAGGGACAGAAAAGTCAAGG + Intergenic
984171364 4:176363212-176363234 CTGGTGAGACTGCAGAGAAAAGG - Intergenic
984226743 4:177044406-177044428 TTAGTGAGAAAGAAAGGACAGGG - Intergenic
984413933 4:179433088-179433110 CTTGTGTGACAGAAACTACATGG + Intergenic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
986455834 5:7916952-7916974 CTATTGAGACAAAAAAGATATGG + Intergenic
987686828 5:21215375-21215397 AAGGAGAGACAGAGAAGACAAGG + Intergenic
988218391 5:28307579-28307601 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
988707846 5:33743154-33743176 CTGGAGAGGCAGAAAAGGAAGGG + Intronic
988888006 5:35580574-35580596 CTGAGGATACACAAAAGACAGGG - Intergenic
989318634 5:40109882-40109904 CTGGTGAGACAGAAAGTATGAGG - Intergenic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
991676966 5:69097469-69097491 CTTGTCAGAAAGAAAAGAAAGGG - Intronic
992235348 5:74703399-74703421 CTGAGGACACAGAAAAGACCGGG - Intronic
992879765 5:81096183-81096205 CTTGTCAGGCAGAAAAGAAATGG - Intronic
993096054 5:83479420-83479442 CCTGGGAGACATAAAAGACAAGG - Intronic
993413431 5:87598584-87598606 CTGGTGAGGCTGAAGAGAAAAGG - Intergenic
993881955 5:93373787-93373809 CTGGTGAGACTGCATAGAAAAGG + Intergenic
994089462 5:95796993-95797015 GTGCTCAGGCAGAAAAGACAGGG - Intronic
994348077 5:98711454-98711476 CTGGTGAACCAGATAAGTCAAGG - Intergenic
995738589 5:115330062-115330084 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
996538908 5:124608510-124608532 CTGGTGAGGAAGAAGAGTCAAGG + Intergenic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997299468 5:132792061-132792083 CTGTAGAGGCAGAAAAGCCAAGG - Intronic
998817984 5:146032746-146032768 CTGGTAACACAGAAATGACTGGG + Intronic
999071013 5:148744099-148744121 CTGGTGAGACTGCAAAGAGAAGG + Intergenic
1000180187 5:158801638-158801660 ATGGTGAGAAGGAAAAGAGAGGG + Intronic
1000897182 5:166869191-166869213 CTGGGTAGACAGAGAAGAGAAGG - Intergenic
1001183583 5:169544963-169544985 ATTTTCAGACAGAAAAGACATGG - Intergenic
1001248492 5:170124816-170124838 CTGCTTGGACTGAAAAGACAAGG + Intergenic
1001295601 5:170496743-170496765 CGGGTGAGACTGAAATGACGGGG - Intronic
1001521823 5:172399783-172399805 CTGGTGAGACAGAAAGTATAAGG - Intronic
1001683546 5:173576139-173576161 CTGGTGAAACAGACATGAAAAGG + Intergenic
1001810858 5:174627166-174627188 CTGGGGAGATGGACAAGACACGG - Intergenic
1001877527 5:175214349-175214371 CTGGTGAGTCAGAATTGAGAAGG + Intergenic
1001932557 5:175683676-175683698 GTGGATAGACAGAAAGGACAGGG - Exonic
1003007813 6:2398031-2398053 GTGGTGACACTGAAAAGAGAAGG + Intergenic
1003981474 6:11394313-11394335 CTGGTGAGTAAAAACAGACATGG + Intergenic
1004425804 6:15506230-15506252 CTGGTGCGCCTGTAAAGACATGG - Intronic
1004426364 6:15509857-15509879 CAGGAGAGAAAGAAAAGGCAGGG + Intronic
1004483834 6:16047004-16047026 CAGGTGAGAGAGAAAGCACAAGG + Intergenic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1005151501 6:22756927-22756949 TTGGAGAGAAAGAAAAGGCAGGG + Intergenic
1005620768 6:27618003-27618025 AGGGTGAGACAGTAAAGAAAGGG - Intergenic
1006331092 6:33391680-33391702 CCTGCGAAACAGAAAAGACAAGG + Exonic
1006501403 6:34461429-34461451 CTGGTTAAAAAGAAAGGACATGG - Intergenic
1006909706 6:37555964-37555986 AGGGAGAGAAAGAAAAGACAGGG - Intergenic
1007256155 6:40530416-40530438 TCATTGAGACAGAAAAGACATGG + Intronic
1007761346 6:44135305-44135327 CTGGGGACAGAGAACAGACAGGG - Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008727657 6:54441707-54441729 CTGTGGAGCCAGAAAGGACATGG + Intergenic
1008745519 6:54665381-54665403 TTGTTGAGACAGAGAAAACAGGG - Intergenic
1008835298 6:55820226-55820248 CTGGAGAGACAGCACAGCCATGG + Intronic
1009325522 6:62344485-62344507 CTGGTGAGGCTGAAGAGAAAAGG + Intergenic
1010096167 6:72048928-72048950 CAGGTGAGACAGGGAAGAAAAGG + Intronic
1010143010 6:72633065-72633087 CTGGTGAGACTGCAGAGAAAAGG - Intronic
1010396731 6:75401353-75401375 GTGGTAAGAGAGAAAAGACCTGG - Intronic
1010492191 6:76489704-76489726 CTGGTGAGAGAGAAAGTATAAGG + Intergenic
1010692434 6:78926178-78926200 CTGGTGAGGCTGCAAAGAAAAGG + Intronic
1012267326 6:97161543-97161565 CTGATGAGACTGAAAACAAAAGG + Intronic
1012366243 6:98444107-98444129 CCAGAGAGACAGAAAAAACATGG + Intergenic
1012875631 6:104722022-104722044 TTGCTGAGACAGGAAAGACTGGG + Intergenic
1012978211 6:105802581-105802603 CTGATGATGCAGAAAAGAGAAGG - Intergenic
1013122425 6:107152335-107152357 GTGTTGAGACAGAAAAGTCCAGG + Intergenic
1013433081 6:110073359-110073381 CTGGTGAGACTGCAGAGAAAAGG + Intergenic
1014453297 6:121606885-121606907 CTGGTGAGGCTGCAAAGAAAAGG - Intergenic
1014733973 6:125069775-125069797 CTGGTGAGGCTGCAAAGAAAAGG - Intronic
1015075426 6:129151073-129151095 CTGATGATAGAGAAAAAACATGG + Intronic
1015630246 6:135225031-135225053 GTGTTTAGACAGAAAACACAGGG - Intergenic
1016223505 6:141705527-141705549 CTGGAGATACAGAAATGAAAAGG - Intergenic
1018604530 6:165583646-165583668 CTGGCTTGACAGAAAAGAAAAGG + Intronic
1019408152 7:894624-894646 CTGGAGAGTCAGAAGAGTCAGGG - Intronic
1020091536 7:5344890-5344912 ATGGAGAGACAGGAAAGACATGG + Intronic
1020556989 7:9682652-9682674 CTGGGAAGACAGAAAAGAAAGGG - Intergenic
1020651044 7:10876593-10876615 CTGGTGAGACTGCAGAGAAAAGG - Intergenic
1020950085 7:14664515-14664537 CTGGAGAGGGAGAAAATACAAGG - Intronic
1020967921 7:14895924-14895946 TTGCTGAGACAGAAAATATAAGG - Intronic
1021003981 7:15370526-15370548 CTGGTGAGGCTAAAAAGAAAAGG - Intronic
1022025198 7:26441831-26441853 CTGGTGAGACGTCAAAGATAGGG + Intergenic
1022215539 7:28257147-28257169 CTGGTGAGAGAGATGAGAAAAGG - Intergenic
1022311737 7:29202867-29202889 CTGTTGGGACAGCAAAGAAATGG + Intronic
1022863159 7:34389218-34389240 CAGGAGAGACAGAAGAGACTTGG - Intergenic
1023054287 7:36279174-36279196 CTGGTGAAGCAGAAAACTCAAGG - Intronic
1023225072 7:37960656-37960678 CAGATGAGACAAAACAGACAAGG + Intronic
1024553228 7:50581136-50581158 CTGGTGAGATAGAAAGTATAAGG - Intergenic
1024712830 7:52036491-52036513 CAGGTCAGACAGAATAGTCAGGG + Intergenic
1026023043 7:66725716-66725738 CTGGTATGACAGAGAGGACATGG + Intronic
1027965719 7:85004125-85004147 CGTGGGAGACAGAAAAAACATGG + Intronic
1028219140 7:88174800-88174822 CAGGTGAGAGAGAAAAGAAATGG - Intronic
1029915353 7:104203361-104203383 CAGGTGAGACAGAAACTACGTGG + Intronic
1031701805 7:124935367-124935389 CTAGTGATTCTGAAAAGACAGGG + Intergenic
1031751098 7:125575160-125575182 CTGATTAGACAGAATATACAGGG - Intergenic
1031818174 7:126466563-126466585 CTGGGGAATCAGAAAAGCCAGGG + Intronic
1032468640 7:132162530-132162552 CTGAGGAGACAGGAAAGAAAGGG + Intronic
1032514572 7:132497025-132497047 CTATTGATACAGAAAAGAAAAGG + Intronic
1032538609 7:132685088-132685110 CTGGTTAGAAAGAGAAGGCAAGG - Intronic
1033378646 7:140790181-140790203 CTGATGCAACAGAAAAGAAAGGG - Intronic
1033770199 7:144542087-144542109 CTGGTGAGGCTGAAGAGAAAAGG + Intronic
1035141005 7:156760896-156760918 CTAGTGAGACAGAAACAAAAGGG + Intronic
1036044084 8:5120198-5120220 CTGGAGAGACAGAGAAGGAATGG + Intergenic
1036250211 8:7155656-7155678 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1036367277 8:8131794-8131816 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1036389351 8:8311040-8311062 CTGGAGGCACAGAAAAGCCAAGG + Intergenic
1036883603 8:12533868-12533890 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1037220998 8:16520498-16520520 CAGATGAGAAAGAAATGACAAGG + Intronic
1037524820 8:19714452-19714474 CTGGAGAGAGAGAATAGAGATGG - Intronic
1037624255 8:20593749-20593771 CTGCTGAGAAGGACAAGACATGG + Intergenic
1037880091 8:22569061-22569083 CCTGTGAGACAGCAAAGAGAAGG - Intronic
1037917157 8:22779530-22779552 ATGGAGAGACAGAAAAGCCCAGG + Intronic
1037940166 8:22945251-22945273 CTGATGAGAACGAAAAGAGAGGG + Intronic
1038327370 8:26581773-26581795 CTGATGAGTCAGAACACACAGGG - Intronic
1039038126 8:33381909-33381931 ATGGTAAGCAAGAAAAGACATGG - Intronic
1039972997 8:42336037-42336059 TTCCTGAGACAGAACAGACAAGG + Intergenic
1040594874 8:48827586-48827608 CTGACGGGACAGCAAAGACAGGG + Intergenic
1040671814 8:49700805-49700827 CTAGGGAGTCAAAAAAGACATGG + Intergenic
1042433033 8:68730354-68730376 CTGATGAGTCATAAAAGCCAAGG - Intronic
1042731523 8:71940107-71940129 CTGGGGAGGGAGAAAAGAAAAGG - Intronic
1043274549 8:78376958-78376980 CAGCTGAGACAGAGCAGACAGGG - Intergenic
1043788869 8:84437490-84437512 CTGGTGAGGCTGCAAAGAAATGG - Intronic
1044208662 8:89522906-89522928 CTGGTCAGACTGGAAAGAAAAGG + Intergenic
1045910774 8:107407064-107407086 CAATTGAAACAGAAAAGACATGG + Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046783882 8:118245144-118245166 CTGGTGAAGCAGAAAATAAATGG - Intronic
1047416997 8:124672724-124672746 CTGTTGAGCCAGGAAAGGCAAGG + Intronic
1047493177 8:125390673-125390695 CTGGGGAGTCAGCAAAGACCTGG - Intergenic
1047727578 8:127697256-127697278 CTGGAGAGTCAGAAAGGCCAAGG - Intergenic
1048219694 8:132529971-132529993 CTGGTGAGGCAAAAGAGCCATGG + Intergenic
1048846399 8:138606955-138606977 CTTGTGAGACAGAACAGAGGAGG - Intronic
1049184428 8:141242004-141242026 CAGGTCAGACAGAAAAGAGCAGG + Intronic
1049299983 8:141864422-141864444 CACGTGAGAGGGAAAAGACAGGG + Intergenic
1049394843 8:142395188-142395210 CCACAGAGACAGAAAAGACAAGG + Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050481554 9:6092829-6092851 CTGGTGAGGCTGAAGAGAAAAGG - Intergenic
1051148673 9:14057852-14057874 CTGGAGAGGAAGAAAAGACTTGG + Intergenic
1052687905 9:31777560-31777582 CAGGTGAGACAGAAAGTATAAGG - Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1056210985 9:84365155-84365177 CTGGTGAGAATGAAGAGAAAAGG - Intergenic
1056714422 9:89016537-89016559 CTTCTGAAACAGAAAACACAAGG + Intronic
1058544862 9:106050527-106050549 GTGGGGATAAAGAAAAGACAGGG - Intergenic
1058818130 9:108704381-108704403 CTGGAGAGACAGGAAATCCAGGG - Intergenic
1058854198 9:109044182-109044204 CTGGTTTGTCAGAAAAGAGAGGG - Intronic
1059167947 9:112096979-112097001 CTGCTGATACAGACAGGACAAGG + Intronic
1059198711 9:112394999-112395021 CTGGTGAGACAGAAAGTGTAAGG + Intronic
1059365331 9:113782290-113782312 GTGGGGAGAGAGAGAAGACATGG + Intergenic
1059786750 9:117594428-117594450 CTGCTGATACAGAATCGACAAGG - Intergenic
1060104819 9:120866966-120866988 CTGGAGAGACAGAGGAGCCAAGG + Intronic
1060234201 9:121851025-121851047 CTGGCAAGCCATAAAAGACATGG + Intronic
1062231938 9:135486724-135486746 CCGGAGAGACTGGAAAGACAGGG + Exonic
1062354186 9:136154132-136154154 CTGGGGGGACAGGAAAGACTGGG - Intergenic
1187107822 X:16262215-16262237 CTGGGGAGACAGAAAAAAAAAGG - Intergenic
1188823302 X:34800568-34800590 CTGGTGAGACAGAAAGTATAAGG - Intergenic
1188973074 X:36640650-36640672 CTGGTGGGTCTTAAAAGACAAGG + Intergenic
1189509286 X:41645803-41645825 CTGGTGAGACAGAAAGTATAAGG - Intronic
1189557879 X:42164209-42164231 CTGGTGAGGCAGAAAGTATAAGG + Intergenic
1189731349 X:44024076-44024098 CTACTGAGAAAGAAAAGAAAAGG + Intergenic
1189978553 X:46486714-46486736 CTGGTGAGACAGAAAGTATAAGG + Intronic
1190600083 X:52082703-52082725 CTGGTGAGGCTGCAAAGAAAAGG - Intergenic
1190709179 X:53054180-53054202 CTGGTGAGAGAGAAAGGATGTGG + Intronic
1190842113 X:54154896-54154918 ATGTGGAGACAGAAAAGAGAAGG + Intronic
1191125245 X:56947333-56947355 CTGGTGAGACAGAAAGCATAAGG - Intergenic
1192117851 X:68428496-68428518 CTGGTGGGAGAGACAAGACGTGG - Intronic
1192214090 X:69146025-69146047 CTGGGAAGACTGAGAAGACAGGG - Intergenic
1192552673 X:72066594-72066616 GTGGTGAGGCAGAAAGGACAAGG + Intergenic
1192604223 X:72497532-72497554 CTGATAAATCAGAAAAGACATGG - Intronic
1193163762 X:78258607-78258629 CTGGTGAGGCTGCAAAGAAAAGG - Intergenic
1193254828 X:79335480-79335502 CTGGTGAGGCTGCAAAGAAAAGG - Intergenic
1194170541 X:90575279-90575301 TTTGTGAGGCAGCAAAGACATGG - Intergenic
1195348100 X:103971398-103971420 CTGGTTGGAAAGACAAGACAAGG + Intergenic
1195359342 X:104067443-104067465 CTGGTTGGAAAGACAAGACAAGG - Intergenic
1195442812 X:104917876-104917898 CAGAAGAGACAGAAAAGACATGG + Intronic
1195540617 X:106058683-106058705 ATGGTGAGACAGAAGGCACAGGG + Intergenic
1195781485 X:108470275-108470297 CTGGTGAGACTGCAGAGAAAAGG - Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196736332 X:118983870-118983892 TTTGTGAGACAGAAAATCCAGGG - Intronic
1198845288 X:140903831-140903853 CTGGAGAGACAGCAACAACAAGG - Intergenic
1199125219 X:144110457-144110479 CTGGTGAGACTGTAGAGAAAAGG + Intergenic
1200516784 Y:4153039-4153061 TTTGTGAGGCAGCAAAGACATGG - Intergenic
1200861223 Y:7994755-7994777 CTGGTGAGACAGAAAGTATAAGG + Intergenic
1200877463 Y:8173012-8173034 CTGGTAATATAGAAAATACAGGG + Intergenic
1201475483 Y:14376782-14376804 CTAGTGAGACATAAATTACAAGG + Intergenic
1201777772 Y:17685277-17685299 CTAGTGAGACAGAAAGTATAAGG - Intergenic
1201823786 Y:18220715-18220737 CTAGTGAGACAGAAAGTATAAGG + Intergenic
1202247026 Y:22830446-22830468 CTGGTGAGACAGAATGTATAAGG + Intergenic
1202400015 Y:24464194-24464216 CTGGTGAGACAGAATGTATAAGG + Intergenic
1202470766 Y:25205892-25205914 CTGGTGAGACAGAATGTATAAGG - Intergenic