ID: 1080413509

View in Genome Browser
Species Human (GRCh38)
Location 11:32048549-32048571
Sequence GTGGCTAAACAAATCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080413509_1080413518 30 Left 1080413509 11:32048549-32048571 CCATGTTTGATTTGTTTAGCCAC 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1080413518 11:32048602-32048624 ATGGTTCCAACAGAAATCCTAGG 0: 1
1: 0
2: 0
3: 18
4: 146
1080413509_1080413510 -8 Left 1080413509 11:32048549-32048571 CCATGTTTGATTTGTTTAGCCAC 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1080413510 11:32048564-32048586 TTAGCCACTCCCATATAAGAAGG 0: 1
1: 0
2: 5
3: 13
4: 180
1080413509_1080413514 11 Left 1080413509 11:32048549-32048571 CCATGTTTGATTTGTTTAGCCAC 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1080413514 11:32048583-32048605 AAGGAGTGACTTTTTCCCCATGG 0: 1
1: 0
2: 1
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080413509 Original CRISPR GTGGCTAAACAAATCAAACA TGG (reversed) Intronic
900709715 1:4105933-4105955 GTGGCTAGACAAACAATACAAGG + Intergenic
907393870 1:54176527-54176549 GTCTCAAAACAAAACAAACAGGG + Intronic
909340593 1:74527233-74527255 GTGGCTAAAGAAATGAAAGGAGG + Intronic
910418050 1:87022553-87022575 ATGGCTAAATAAAATAAACATGG + Intronic
915723405 1:158000692-158000714 GTGGCTGAATAAATTAAATATGG - Intronic
917643105 1:177002471-177002493 ATAGCTAAACAAATAAAACCAGG + Intronic
917879847 1:179324137-179324159 GTAACTAAATAAATAAAACAGGG - Intronic
918458534 1:184752825-184752847 GTGGCTGAACAAGTCAACCTTGG + Intronic
920599234 1:207305820-207305842 GTGATTAAACATATTAAACATGG + Intergenic
920923226 1:210315752-210315774 GTCTCTAAAAAAATTAAACAAGG + Intergenic
921656026 1:217738124-217738146 GTGGCTAAAGACAGCAAGCATGG - Intronic
1065435910 10:25703512-25703534 ATGGCTTAAAAAAACAAACACGG - Intergenic
1065892826 10:30135614-30135636 GTGGCTACAGAGTTCAAACAGGG + Intergenic
1067528096 10:47050375-47050397 GTGGCTAGACAAATCAGCCCTGG - Intergenic
1070077229 10:73148848-73148870 ATGGCTAAATAATTCAAACAGGG + Intronic
1070186449 10:74067467-74067489 GTTTCTCAAAAAATCAAACATGG + Intronic
1070875238 10:79798763-79798785 GTGAATAAATAAACCAAACACGG + Intergenic
1071642167 10:87320936-87320958 GTGAATAAATAAACCAAACACGG + Intergenic
1072932553 10:99679445-99679467 GTGGTTAAAAAAATCAAGCCAGG + Exonic
1075064537 10:119280673-119280695 GTGCCTCAAAAAATTAAACACGG - Intronic
1075468907 10:122673244-122673266 GTGGCTGAGAAAATCAGACATGG + Intergenic
1077824634 11:5792347-5792369 GTTCCTCAAAAAATCAAACACGG - Intronic
1077878616 11:6329071-6329093 GTTGCTAATCAATTCAACCAAGG + Intergenic
1078612667 11:12835162-12835184 GTAGCTAAAAAAAACCAACAAGG - Intronic
1079062656 11:17262954-17262976 GGGTATAAACAAATCAAATATGG + Intronic
1079385596 11:19976559-19976581 GTTGCTAAGCTAATCAAACAAGG - Intronic
1080287545 11:30633027-30633049 GTTGCTAAAGAAATGAAATAAGG + Intergenic
1080413509 11:32048549-32048571 GTGGCTAAACAAATCAAACATGG - Intronic
1080524642 11:33102535-33102557 GTGGGTAAACAAAACACCCATGG + Intronic
1086753960 11:90534783-90534805 GTTGCTATATAAATCAAATAAGG - Intergenic
1087018342 11:93576857-93576879 GTGAATAAATAAATTAAACATGG - Intergenic
1092567978 12:9688415-9688437 GTTTCAAAATAAATCAAACAAGG + Intronic
1092767038 12:11862125-11862147 GGGGCTAAACAAAACAAAATGGG - Intronic
1093176845 12:15922263-15922285 CTGGCTAATCATTTCAAACAGGG - Intronic
1095970417 12:47897905-47897927 CTGGCTAATCAAAGCACACAGGG - Intronic
1098082343 12:66801295-66801317 GTTTTTAAAAAAATCAAACATGG + Intronic
1100385851 12:94104118-94104140 GTGGCTGATAAAATCAAGCAAGG + Intergenic
1100520555 12:95371250-95371272 GTTACTAAAAAAATTAAACATGG - Intergenic
1100888167 12:99095444-99095466 GTGGCTAAACAGTTCAGAGAAGG + Intronic
1101690103 12:107070542-107070564 GAGGCTAAAGAAAGAAAACAAGG + Intronic
1105066603 12:133206070-133206092 ATGGCTAATGCAATCAAACAAGG - Intergenic
1107728491 13:43324212-43324234 GTGGCTTAACACTTGAAACAAGG + Intronic
1109781895 13:67122110-67122132 GTGTCTACACAAATAAAATATGG + Intronic
1111289791 13:86150563-86150585 GTGGCTAAGCAAATCCCACCAGG + Intergenic
1111829884 13:93314586-93314608 GTAGCTAAACAAGGCAACCAAGG - Intronic
1114061734 14:19024433-19024455 GAAGCTAAATAAATTAAACATGG - Intergenic
1114100527 14:19375573-19375595 GAAGCTAAATAAATTAAACATGG + Intergenic
1114360231 14:21963726-21963748 CTAGCTGAACAAAACAAACATGG - Intergenic
1114573224 14:23690219-23690241 GTAGGTAAACAAAACAGACAAGG - Intergenic
1115899797 14:38132707-38132729 GAATCTAAACAAATCAAACCTGG + Intergenic
1116765763 14:49068922-49068944 GTGGGTATAAAAATTAAACAAGG + Intergenic
1117709553 14:58511248-58511270 CTAGCTAAAGAAATCTAACAAGG - Intronic
1117722862 14:58644530-58644552 GATGCTAAAAAAATAAAACAGGG - Intronic
1119563648 14:75610414-75610436 TTAGCTAAAAAAATAAAACACGG + Intronic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1121907177 14:97757191-97757213 GATGCTCAACAAATAAAACAGGG - Intronic
1126126877 15:45302406-45302428 GTTTCTCAAAAAATCAAACAGGG - Intergenic
1131206796 15:90456085-90456107 GTACATAAACAAATCAATCATGG - Intronic
1133381416 16:5333990-5334012 GTGGCTCAACAAGTCAAAGATGG + Intergenic
1134001728 16:10788125-10788147 AAGGCAAAACAACTCAAACAGGG + Intronic
1137339236 16:47583095-47583117 GTGGCTAAAGAAATAAGACATGG - Intronic
1137782831 16:51112375-51112397 ATGGTTAAAAAAATAAAACAAGG - Intergenic
1138004292 16:53316692-53316714 GTAGCTAAACAATTATAACATGG + Intronic
1138217790 16:55220010-55220032 TTGGCCAAACAGATCAAGCATGG + Intergenic
1139085289 16:63577391-63577413 GTGATTAAACAAACAAAACAGGG + Intergenic
1145022019 17:19439855-19439877 GTCACTAAATAAAACAAACATGG - Intergenic
1145407618 17:22619270-22619292 GTGAATAAATAAATCCAACACGG + Intergenic
1145744914 17:27310371-27310393 ATGCCTAAACAAGTTAAACAAGG - Intronic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1148939191 17:51192934-51192956 GTGGCTACACATATTAAACGTGG + Exonic
1149711042 17:58742266-58742288 GTGTCAAAAAAAACCAAACAAGG - Intergenic
1150258315 17:63767947-63767969 GTGGCTATAGGAATCAAAGAAGG - Intronic
1158918664 18:62164800-62164822 GTGGGTAAAGAAATGAATCAAGG + Intronic
1159070795 18:63621776-63621798 GTGGAGCTACAAATCAAACAGGG - Intergenic
1162831813 19:13289476-13289498 GAGGTTAAGCAAATCACACAGGG - Intronic
1163587445 19:18171823-18171845 GTGGCTGTACAAAACAGACAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926911287 2:17853672-17853694 GTGGCTAAAGAAACCTAGCATGG - Intergenic
930736272 2:54782614-54782636 GTGTCTAATCAAATCATAAAGGG + Intronic
935367201 2:102307394-102307416 GTGGCTAAAAAAAAGAAAGAAGG - Intergenic
936750606 2:115636802-115636824 GTGGATAAATAACTTAAACAGGG + Intronic
937824682 2:126355431-126355453 GTGGCTAAATATATCAATCAGGG - Intergenic
938479082 2:131644566-131644588 GAAGCTAAATAAATTAAACATGG - Intergenic
938736382 2:134190311-134190333 CTTGCTACAAAAATCAAACATGG - Intronic
938778204 2:134560356-134560378 GTGCCTAAACACATAGAACATGG + Intronic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
940557597 2:155250952-155250974 TTGTCAAAACAAATCAAAGAAGG + Intergenic
941648771 2:168070359-168070381 GATGATAAACAAATGAAACAAGG + Intronic
941866451 2:170339881-170339903 GTGACAAAACACATCAAGCAGGG - Intronic
943600112 2:189907282-189907304 GTGGCTAGAGAAATGAAACATGG - Intronic
1170506880 20:17035617-17035639 GGGGCTAGCCATATCAAACATGG - Intergenic
1171116822 20:22531890-22531912 GTGGCCAATCACATCAAATAAGG + Intergenic
1175340123 20:58223551-58223573 GTGGTTATACAAATCATATAGGG + Intronic
1175462920 20:59166974-59166996 ATTTCTTAACAAATCAAACATGG - Intergenic
1176522354 21:7833930-7833952 GTGACCAAGCAAATCAGACAGGG - Intergenic
1178656374 21:34463942-34463964 GTGACCAAGCAAATCAGACAGGG - Intergenic
1178895488 21:36553877-36553899 GTGGCTAAACAGAGTCAACATGG - Intronic
1179165766 21:38933983-38934005 GTAGCAAAACAAATCCAAAAGGG - Intergenic
1180123393 21:45769109-45769131 GTGGAGAAACAAATGAAAGAGGG - Intronic
1180480221 22:15747046-15747068 GAAGCTAAATAAATTAAACATGG - Intergenic
1181785834 22:25226204-25226226 GTGTATAATCAAATCAAACTTGG + Intronic
1182351426 22:29702223-29702245 GTCGGTAAACAAAGCAAAGAAGG + Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
1183613348 22:38926213-38926235 GTGGGTACACAAATCCAAAAAGG + Intergenic
1185357430 22:50382301-50382323 CTGGATAAAAAAGTCAAACAGGG + Intronic
949369735 3:3321725-3321747 GTGGCTAAATTAATAATACACGG + Intergenic
949419791 3:3853572-3853594 ATGGCTTAAAAAATCAAACTGGG - Intronic
949597855 3:5566541-5566563 GGGGCAAAACAAAGGAAACATGG + Intergenic
953231609 3:41070273-41070295 GTGGCCAAAGAAACCAAAGATGG - Intergenic
953880553 3:46689249-46689271 GTGGCTCAGCAAGTCCAACAAGG + Intronic
954638257 3:52083322-52083344 GTGGCGAAACAGAGCAAACAAGG + Intronic
955061352 3:55494276-55494298 GTTCTTAAACAACTCAAACATGG + Intergenic
957540386 3:81561836-81561858 GTGGCTACACAAAGCTAAGAAGG - Intronic
960276785 3:115738162-115738184 GTAGGTAAACAAATCAGCCAGGG - Intergenic
960344063 3:116510811-116510833 GTGGCTAAGGAAATCAGAGAGGG + Intronic
963908974 3:150798802-150798824 GTGGCTAAGAAAATCAGAAAAGG - Intergenic
965430189 3:168577328-168577350 GTGGCTGTAGAAATCAAATAAGG - Intergenic
966477593 3:180367803-180367825 GTAGGTAAACAAAGCTAACAGGG + Intergenic
968325670 3:197812924-197812946 GTTCCTCAAAAAATCAAACACGG - Intronic
970452738 4:16188148-16188170 ATGGCTAACCAAATAAAATAAGG + Intronic
971671939 4:29571852-29571874 GAGGCCAAACAAATAAAACAGGG + Intergenic
974881915 4:67769481-67769503 GTGGCTGAAATAATAAAACAAGG + Intergenic
975100715 4:70509910-70509932 GTGGCTGAAGATATAAAACAGGG - Intergenic
976809207 4:89082358-89082380 GTTGCTCCACAAATTAAACAAGG + Intronic
977103260 4:92845932-92845954 GTGGAAAAATAGATCAAACAGGG - Intronic
978254402 4:106676339-106676361 GTGGTGAAACAAAACAAGCAGGG + Intergenic
978299635 4:107252672-107252694 TTGGCAAAGCAAATCAAAGAAGG + Intronic
978638158 4:110836333-110836355 GTGGCTCAATAAAACAGACATGG - Intergenic
979371937 4:119899393-119899415 GTATCTAAAATAATCAAACATGG - Intergenic
979861027 4:125693969-125693991 ATGGCTAAAGAAAACAATCATGG - Intergenic
982244895 4:153341904-153341926 GTGGCCAAATAATTCAAACAAGG + Intergenic
982493596 4:156061900-156061922 ATAAATAAACAAATCAAACATGG + Intergenic
984475909 4:180234835-180234857 GTGGCCAAACACATGAAAAATGG - Intergenic
986453892 5:7895642-7895664 TTTGCTAAACAAATCAGAAAGGG - Intronic
986489940 5:8279065-8279087 GTGGCTAAACAAAACAAGTGGGG + Intergenic
987590781 5:19923347-19923369 GTGGATCAAGAAATCAGACAGGG - Intronic
989122631 5:38019689-38019711 GTTGCTAACAAAATCACACAAGG - Intergenic
990293586 5:54379355-54379377 GGGGAAAAACAAATCAAATAAGG - Intergenic
991564969 5:67996026-67996048 GTGGCTAGACAAATCATCCAAGG - Intergenic
991990209 5:72330712-72330734 CTGGCTAAACAAATTAAATGTGG - Intronic
993012472 5:82498956-82498978 GTGGCCAAAGAAAACAAACTTGG + Intergenic
994371990 5:98977960-98977982 GGGGGTAAACATATCTAACAGGG - Intergenic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
1000550487 5:162656569-162656591 GTGGAGAAACAAAACAGACATGG - Intergenic
1006795746 6:36731375-36731397 GGGGCTGAACAAAACAGACATGG - Intronic
1006883114 6:37356452-37356474 GTGGATAAAATAATAAAACAGGG + Intronic
1013062579 6:106650542-106650564 AGGGGTAAACAAATCAAAAAGGG - Intronic
1013490676 6:110643519-110643541 GTGGCTCAATAAATAAAAAAGGG + Intronic
1014320406 6:119921778-119921800 GTGGCTAAATAAATAAAAAAGGG - Intergenic
1015051187 6:128842361-128842383 GTGGTAAAACAATTCACACAAGG + Intergenic
1016288331 6:142499547-142499569 TTGGCTAAACTAATCAATCATGG + Intergenic
1017689543 6:156949843-156949865 GTAGCTCAACAAACCAAAAATGG - Intronic
1017763123 6:157586227-157586249 GTGGCTGGATAAATAAAACAAGG + Intronic
1018566409 6:165159208-165159230 GCCACTAAAGAAATCAAACAAGG + Intergenic
1019187318 6:170228318-170228340 GTGGCCACAAAAACCAAACAAGG + Intergenic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1020768745 7:12359610-12359632 TTGGGTCTACAAATCAAACAAGG + Exonic
1021503259 7:21352938-21352960 GTGTCTAATCAAATGAAAGAAGG + Intergenic
1021881306 7:25097704-25097726 ATGGCAAAACAAAACAAAAATGG - Intergenic
1023255950 7:38312227-38312249 GTGGCTAAGCAAAGAAAATAAGG + Intergenic
1026088178 7:67279549-67279571 GTGTCAAAACAAAACAAAAAAGG + Intergenic
1028708211 7:93875187-93875209 AAGGCTTAACAAATAAAACATGG + Intronic
1029034889 7:97509084-97509106 GTGGCTACTCAAATGAAAGAAGG + Intergenic
1030992605 7:116318457-116318479 GTATCTATACAAATAAAACATGG - Intronic
1032146058 7:129382084-129382106 GTCACACAACAAATCAAACATGG - Intronic
1033278991 7:139992482-139992504 GTGGCAAAACAAAGTAAAAACGG - Intronic
1033633212 7:143181864-143181886 ATGGATAAACAAATCAAATGAGG + Intergenic
1035793430 8:2329854-2329876 GTGGCTACATTAATCAGACAGGG - Intergenic
1035799374 8:2391851-2391873 GTGGCTACATTAATCAGACAGGG + Intergenic
1041745579 8:61205656-61205678 GTTGCTCAAAAAATTAAACATGG - Intronic
1042105557 8:65322833-65322855 GTGCCAAAGCAAACCAAACAGGG + Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1045920239 8:107520868-107520890 CTGGCAAACCAAATAAAACATGG + Intergenic
1046469062 8:114644330-114644352 TTGGCTATACAAATCACCCAAGG - Intergenic
1046733515 8:117751302-117751324 GTGGCTATACAAATCAAGGCAGG - Intergenic
1046852793 8:118994316-118994338 GTGGCAAAACAAATGAGAGATGG + Intergenic
1047989485 8:130270980-130271002 TTGGCCAAACAAATCACACTGGG + Intronic
1048193301 8:132309908-132309930 ATGCCTAAACAAAGCAAAGATGG - Intronic
1048194144 8:132318282-132318304 GTGCCTAAACAAAGCAAAGATGG + Intronic
1050326982 9:4507308-4507330 GAGACCAAAAAAATCAAACATGG - Intronic
1051681540 9:19612565-19612587 GAGGATAAACAAATCATCCAAGG + Intronic
1053213569 9:36252414-36252436 GAGGCAAAACAAATCATTCATGG + Intronic
1053213891 9:36255182-36255204 GAGGCAAAACAAATCATTCATGG - Intronic
1055229576 9:74045389-74045411 GTAACTAAACAAATAAAATATGG - Intergenic
1058182402 9:101815056-101815078 GTGGCTAAAGAAATGAGCCAGGG + Intergenic
1058295967 9:103307053-103307075 GTGGCAAAAAAAAACAAAAACGG + Intergenic
1060125426 9:121039985-121040007 GTAGTGAAACAAATCAGACATGG + Intronic
1060647841 9:125297254-125297276 GTGAATGAACAAAGCAAACAAGG + Intronic
1185984004 X:4810450-4810472 ATGGCTAAATAAGGCAAACACGG - Intergenic
1188976415 X:36681485-36681507 GTGGCTAAAGAACTAAAAAATGG - Intergenic
1189062355 X:37768162-37768184 GGGGCTACACAAATCATAGAAGG + Intronic
1190006018 X:46738852-46738874 CTGGCTAAACTCATCAAAAACGG + Intronic
1190051512 X:47153577-47153599 ATGGCTAATAAAATCTAACAAGG - Intronic
1190299757 X:49050268-49050290 GTGGCTTAAAAAAACAAAGAGGG - Intergenic
1192815088 X:74581980-74582002 GCGTGTGAACAAATCAAACAGGG + Intergenic
1192965248 X:76170360-76170382 GTGGAAGAACCAATCAAACAGGG - Intergenic
1193021460 X:76797762-76797784 CTGGGTATTCAAATCAAACATGG - Intergenic
1199295619 X:146154810-146154832 GTGTATATACAAATCAAATATGG - Intergenic
1199784773 X:151095326-151095348 GTGGCTGAACAATGCAAAGATGG + Intergenic
1201406195 Y:13652622-13652644 TGGGCTAAAAAAATCAGACAGGG - Intergenic